ID: 1144058103

View in Genome Browser
Species Human (GRCh38)
Location 17:11559215-11559237
Sequence CCTGAGTGGCAGTCATGGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144058103_1144058110 11 Left 1144058103 17:11559215-11559237 CCTGACCATGACTGCCACTCAGG 0: 1
1: 0
2: 0
3: 15
4: 147
Right 1144058110 17:11559249-11559271 ACCCCTGCTCTGCTCCCAGGAGG 0: 1
1: 1
2: 4
3: 54
4: 341
1144058103_1144058115 23 Left 1144058103 17:11559215-11559237 CCTGACCATGACTGCCACTCAGG 0: 1
1: 0
2: 0
3: 15
4: 147
Right 1144058115 17:11559261-11559283 CTCCCAGGAGGCACCTGCGGTGG 0: 1
1: 0
2: 2
3: 25
4: 253
1144058103_1144058114 20 Left 1144058103 17:11559215-11559237 CCTGACCATGACTGCCACTCAGG 0: 1
1: 0
2: 0
3: 15
4: 147
Right 1144058114 17:11559258-11559280 CTGCTCCCAGGAGGCACCTGCGG 0: 1
1: 0
2: 5
3: 58
4: 408
1144058103_1144058108 8 Left 1144058103 17:11559215-11559237 CCTGACCATGACTGCCACTCAGG 0: 1
1: 0
2: 0
3: 15
4: 147
Right 1144058108 17:11559246-11559268 TCCACCCCTGCTCTGCTCCCAGG 0: 1
1: 2
2: 5
3: 62
4: 560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144058103 Original CRISPR CCTGAGTGGCAGTCATGGTC AGG (reversed) Exonic
900172246 1:1274641-1274663 CCTGAGAGGCAGTCAGGGTTGGG - Intergenic
901225998 1:7613362-7613384 CCTGAGTGGTGGGCATGGACTGG + Intronic
902277350 1:15349493-15349515 CCTGAGTTTCAGCCAGGGTCAGG + Intronic
902359834 1:15936245-15936267 CCTGAGCAGCTGTCTTGGTCCGG - Exonic
902425216 1:16315663-16315685 CCAGAGTGGCAGCCAAGTTCTGG + Intronic
903311969 1:22465737-22465759 CCTGAGTTGCAGCCATGGTTTGG + Intronic
904868829 1:33603586-33603608 CCTGGGTGCCAGCCATGGCCTGG + Intronic
909054797 1:70807777-70807799 CCTGAGTGGCTGCCAGAGTCTGG - Intergenic
913227704 1:116714284-116714306 TCTGGGTGGCAGTGATGGTGTGG + Intergenic
913296773 1:117329265-117329287 CCTGGGTGGAAGTGATGCTCTGG + Intergenic
915069984 1:153258886-153258908 CCTGAGGGGCAGTCATTGAATGG - Intergenic
915619679 1:157073403-157073425 CCTGGGTGGCGGTTATGGTGGGG + Intergenic
919458549 1:197848513-197848535 TCTGAGTTGCAGTCATGTGCTGG - Intergenic
919820036 1:201466882-201466904 CCTGACTGGCACTCAGGGGCAGG + Intronic
920231056 1:204469787-204469809 CCTGAGTCGAAGACATGGTGAGG + Exonic
923104550 1:230844044-230844066 CCTGAGTGGTGGGTATGGTCAGG + Intronic
1063580092 10:7298275-7298297 AGTGAGTGGACGTCATGGTCAGG - Intronic
1064202944 10:13299893-13299915 CCTGAGTGGTGGCCCTGGTCCGG - Intronic
1065219510 10:23481842-23481864 CCTGTGCTGCAGTCATGTTCTGG - Intergenic
1072527275 10:96284006-96284028 ACAGATTGGCAGTCGTGGTCTGG - Intergenic
1072662817 10:97373045-97373067 CCTGAGTGTCAGTGATGGTGAGG + Exonic
1074702265 10:116102825-116102847 CCTGAGTGGTCGATATGGTCTGG - Intronic
1077232775 11:1465529-1465551 CTTGAGAGGCAGAGATGGTCTGG - Intergenic
1082810099 11:57474429-57474451 CCTGGGTGGCAGGCATGGGGAGG + Intronic
1084161623 11:67353391-67353413 CCTGGGTGGCCGCCATGGGCCGG - Exonic
1087293040 11:96340466-96340488 TCTCAGTGCCAGTCCTGGTCAGG - Intronic
1089113809 11:116078110-116078132 CCTGAGTGGCAGACAAGGAAAGG - Intergenic
1090420856 11:126573924-126573946 TCTGCCTGCCAGTCATGGTCTGG + Intronic
1090768948 11:129902301-129902323 CCAGGGTGGAAGTCATGGTTTGG + Exonic
1091935882 12:4434232-4434254 AATGAGTGACAGTCATGATCGGG + Exonic
1093083515 12:14840940-14840962 CGTGTGTGGTAGTCATGTTCTGG + Exonic
1095976534 12:47943957-47943979 CCTGGGTGGCTGTCTTGGCCAGG + Intergenic
1096846163 12:54408212-54408234 CCTGAGTGGCAGACAGGATCTGG + Exonic
1097256013 12:57675088-57675110 CCAGGGTGGCTGTCACGGTCTGG - Intergenic
1115309897 14:31968577-31968599 CTTGAGTAGCAGTCATGACCTGG + Intergenic
1116514205 14:45786265-45786287 CCTGAGGGGCTGTCAGGGGCTGG - Intergenic
1116952055 14:50887676-50887698 CCTGAAAGGCAGTTATGGTAGGG + Intronic
1117726471 14:58679704-58679726 AATGAGTAGCTGTCATGGTCTGG + Intergenic
1119415381 14:74466168-74466190 CCTGAGTGACAGGCAGGGTGGGG + Intergenic
1124145647 15:27122997-27123019 CCTGGCTGGCAGTGATGGTGTGG + Intronic
1124358772 15:29018926-29018948 CCTGCTTGGCAGAGATGGTCAGG - Intronic
1125717986 15:41830540-41830562 CCTGAGTTGCAGTCCTGGCTTGG - Intronic
1129392504 15:75227551-75227573 CCTGGGTGGAGGTCATGGTGGGG + Intergenic
1132898208 16:2238758-2238780 CCTTAGGGGCAGCCATGGCCTGG + Intergenic
1133013216 16:2926056-2926078 AGTCAGTGGCAGTCATGGTGTGG - Intronic
1133013575 16:2928737-2928759 AGTCAGTGGCAGTCATGGTGTGG - Intronic
1139465231 16:67150724-67150746 CCTGGGTCGCAGTCCTGGGCCGG - Intronic
1139518236 16:67464524-67464546 CCTGAGTGGCCCTCAGGGGCTGG - Intronic
1142713037 17:1733685-1733707 CCTGAGTGGCCGTCATCCTGAGG - Exonic
1143092340 17:4456281-4456303 CTTGCGTGGAAGTCATGCTCAGG - Intronic
1144058103 17:11559215-11559237 CCTGAGTGGCAGTCATGGTCAGG - Exonic
1145114644 17:20198041-20198063 CCTGAGTGGCACTAGTGATCTGG + Intronic
1146904703 17:36610626-36610648 CCTGCGTGGCAGTCAGGGACAGG - Intergenic
1147772517 17:42877808-42877830 CATGAGGGGCAGCCCTGGTCCGG - Intergenic
1152901372 17:82942938-82942960 CCCTGGTGGCAGGCATGGTCTGG + Intronic
1154323067 18:13369916-13369938 CCTGGGTGGCAGGCGTGGTCAGG - Intronic
1159158631 18:64615440-64615462 GCTGTGTGTCAGTCATGGCCTGG + Intergenic
1160369191 18:78357170-78357192 CCTCAGTGGCAGGCAGTGTCTGG - Intergenic
1160731379 19:643083-643105 CCTGAGTGTCCGTCGTGGTCGGG + Intronic
1163289947 19:16372767-16372789 CCTGAGTGGGTCCCATGGTCAGG + Intronic
1163439575 19:17314856-17314878 CCTGGGTGGCAGTGATGGGAAGG + Intronic
1163700246 19:18783193-18783215 CCTGAGGGTCAGACATGGTGAGG + Exonic
1164411106 19:28006165-28006187 GCTGTGAGGCAGTCATGTTCTGG - Intergenic
1167117748 19:47497977-47497999 CCTGAGCAGCAGCCATGGTTGGG + Intronic
925058611 2:874029-874051 GCTGAGTGCCAGCCATGATCTGG - Intergenic
925346517 2:3175693-3175715 CCTGAGTTGGAATCATGGTTGGG - Intergenic
925998549 2:9311743-9311765 CCTGAGTGGCGGGCAGGCTCTGG - Intronic
929098408 2:38285944-38285966 TCTGGGTGGCAGTGATGGTGTGG - Intergenic
930120629 2:47757798-47757820 GCTGACTTGCAGTCCTGGTCGGG + Intronic
930582786 2:53232365-53232387 CCTGAGTGGCAGGAGTAGTCTGG + Intergenic
932671848 2:73744065-73744087 GCTGAGTTGCAGTCATTGTATGG - Intergenic
937407687 2:121645847-121645869 ATTGTGTGGCAGTAATGGTCTGG + Intronic
938382086 2:130842291-130842313 CTTGAGTGACAGTCAGGGTATGG - Intronic
940743869 2:157545304-157545326 CCTGAGTGTCAGAACTGGTCAGG - Intronic
942330372 2:174817401-174817423 TCTGAATGGCAGTAATGGTTTGG + Intronic
942929533 2:181473111-181473133 CCTAAGTGGTTCTCATGGTCAGG - Intronic
944763565 2:202841602-202841624 CCTGGGTGGAAGTTATGGTGGGG - Intronic
945971171 2:216233688-216233710 CCTGAGAAGCAGTTATGGTATGG + Intergenic
946093161 2:217248571-217248593 TCTGCGTGGCAGTCCTGCTCCGG + Intergenic
946246306 2:218389737-218389759 CCTGCGTGGCAGTCTGGGGCAGG - Intronic
946440566 2:219691720-219691742 ACTGAACGGCAGTCAAGGTCGGG + Intergenic
947743984 2:232498198-232498220 CCAGAGTGGCAGGCATGGACTGG - Intergenic
948281009 2:236748066-236748088 CCTGAGTGACTGTCCAGGTCTGG + Intergenic
1169399371 20:5266727-5266749 GCTGATTGTCAGTCCTGGTCGGG + Intergenic
1171171508 20:23019502-23019524 ACTGAGTGGCACTCATGGCGTGG - Intergenic
1175868470 20:62194703-62194725 CCTGGGTGGCTGTCAGGGGCAGG + Intronic
1175912955 20:62413400-62413422 CCTGGGTGGCCGTCCAGGTCAGG + Exonic
1176019788 20:62956766-62956788 CCCGAGTGCCAGGCATGGACGGG + Exonic
1179779051 21:43687877-43687899 CCCGAGTGGCAGTCATCCTCAGG + Exonic
1180072287 21:45442568-45442590 CAAGAGTGGCAGTCCTGGTGTGG + Intronic
1181394019 22:22605108-22605130 CCTGAATCCCAGTGATGGTCAGG - Intergenic
1181404578 22:22673560-22673582 CCTGAGCCCCAGTGATGGTCAGG - Intergenic
1181413164 22:22739114-22739136 CCTGAGCCCCAGTGATGGTCAGG - Intronic
1183658617 22:39205605-39205627 CCTGAGGGACAATCAGGGTCAGG + Intergenic
1185083446 22:48722755-48722777 CCACAGGGGCAGTCATGGCCGGG + Intronic
1185346293 22:50312262-50312284 CTGGAGGGGCAGCCATGGTCAGG + Intronic
952167817 3:30770064-30770086 CCTGCATGGCAGTCATGATTAGG + Intronic
952549203 3:34456977-34456999 TCTGAGTAGCAGGCATGGTGTGG + Intergenic
952901725 3:38115614-38115636 CCTCAGGGGCAGGCATGGCCAGG - Intronic
953743575 3:45556674-45556696 CCTGAATGGCAGTCTAGGTCTGG - Intronic
954039493 3:47874078-47874100 CCTGAGCTGCAGTCCTGGTTTGG + Intronic
954140954 3:48605099-48605121 CCTTATTGACAGCCATGGTCAGG + Intronic
954352658 3:50057952-50057974 CGAGAGAGGGAGTCATGGTCTGG + Exonic
956184967 3:66553621-66553643 CCTGAATGGCAGTAATTGGCTGG - Intergenic
957840404 3:85661225-85661247 CCTGAGTGGCAGTGCTGTGCAGG + Intronic
964658486 3:159094194-159094216 CCCCAGTGGCTGTCGTGGTCTGG - Intronic
966091389 3:176142933-176142955 ACTGAGAGCCAGGCATGGTCAGG + Intergenic
968657511 4:1785100-1785122 CCTGGGGGTCAGTCATGGCCTGG + Intergenic
969242440 4:5908954-5908976 GCTAAGAGGCAGTCATGGACTGG - Intronic
970262026 4:14235376-14235398 CCTGAATGGCTGTCAGTGTCAGG + Intergenic
971669356 4:29536340-29536362 CCTGAGTGGCAGACACTATCTGG + Intergenic
982522286 4:156433235-156433257 CCTGATGGCCAGTCATGGGCAGG + Intergenic
983107914 4:163712798-163712820 CCTCAGTGTCACTTATGGTCAGG + Intronic
983263330 4:165480724-165480746 GCTGAGTGGCAGCCAATGTCTGG - Intronic
984035847 4:174666842-174666864 TCTGAGAAGCAGTCATGTTCAGG + Intronic
984932228 4:184858009-184858031 CCTCATTGGCAGTCATGGCCAGG + Intergenic
985104502 4:186487461-186487483 CATGTGTGGGAGGCATGGTCTGG - Intronic
985912916 5:2897200-2897222 CCTGAGTGGCTGGCCAGGTCTGG - Intergenic
990511497 5:56493212-56493234 CCTGCGTGGCAGTAATGCTGCGG + Intergenic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
992641856 5:78774529-78774551 CCTGGGTAGCAGGGATGGTCAGG + Intergenic
995357509 5:111256082-111256104 ACTGAGTAGCAGCCATGGTATGG - Intronic
999240591 5:150125164-150125186 GCTGAGTAGCAGGCCTGGTCTGG - Intronic
999310619 5:150549419-150549441 CCTGAGGGGCAGGCAGGGTTTGG + Intronic
1000108474 5:158083672-158083694 CCTTAAAGGTAGTCATGGTCTGG + Intergenic
1003364929 6:5464338-5464360 CCTGAGGGCCAGTCCAGGTCAGG - Intronic
1013174967 6:107669097-107669119 CCTGGCTGGCAGTCCTGGCCAGG + Intergenic
1013455356 6:110324892-110324914 CCCAAGAGGCACTCATGGTCAGG + Intronic
1013703532 6:112803711-112803733 TCTGAGTGGTAGTCATTATCAGG - Intergenic
1014653488 6:124070546-124070568 CCTGAGAGGCAGTCTTGGAGTGG + Intronic
1019511552 7:1420021-1420043 CCTGTGTCCCAGTCCTGGTCTGG + Intergenic
1020320302 7:6934854-6934876 CGGGAGGGGCAGTCATGGTCAGG - Intergenic
1020431182 7:8117796-8117818 ACTGAGTGGCATTCTTGCTCTGG - Intronic
1022065074 7:26846609-26846631 CCTGAGAGGCTTTCATGGTTTGG + Intronic
1023818215 7:43966058-43966080 CCTGAGTGCCAGTGGTGGTGGGG + Intergenic
1024287123 7:47767816-47767838 CCTGAGTGGCAGTGTTGGAGGGG - Intronic
1026175014 7:67988875-67988897 ACTCAGTAGCAGTCATGGCCGGG + Intergenic
1026617819 7:71921999-71922021 ACTGAGTGGCCGTTATGGCCAGG + Intronic
1026837439 7:73648051-73648073 CCTGTGGGGCAGCCATGGCCCGG + Intergenic
1027286878 7:76654830-76654852 CATGAGTCGCAGCCATGGTTTGG + Intergenic
1029742843 7:102500890-102500912 CCTGAGTGCCAGTGGTGGTGGGG + Intronic
1029760833 7:102600051-102600073 CCTGAGTGCCAGTGGTGGTGGGG + Intronic
1029937570 7:104443463-104443485 TCTGAGTGGTAGACATGGTGGGG - Intronic
1030665316 7:112271502-112271524 CCTGAGATTCAGTCATGTTCAGG - Intronic
1047784139 8:128137052-128137074 TCTGTGTGGAAGTCATGGCCAGG + Intergenic
1048893055 8:138964933-138964955 ACTGAGTGTGAGCCATGGTCTGG + Intergenic
1049299969 8:141864353-141864375 CCTGAGTGACAGCCGTGGGCAGG - Intergenic
1049687918 8:143946384-143946406 CCTGTGTGGCAGCCATGGACAGG - Intronic
1049749302 8:144275857-144275879 TCTGGGTGGGGGTCATGGTCGGG - Intronic
1050380119 9:5020038-5020060 CAGGAGTGGCAGTGATGGGCTGG + Intronic
1053039698 9:34859391-34859413 CCAGTATGGCAGTCTTGGTCTGG - Intergenic
1056011219 9:82332834-82332856 CCTGAGTGGCAGGCATTGACAGG + Intergenic
1056678441 9:88696620-88696642 TCTGAGTTGCAGACATGGCCAGG - Intergenic
1056943132 9:90972195-90972217 CCTGAATGGCAGGCGTGGCCAGG - Intergenic
1057955856 9:99407242-99407264 CCTGATTGTCTGTCATGGTGGGG + Intergenic
1062424223 9:136498612-136498634 CCTGGGCGGCAGTCATGGCGGGG - Intronic
1185506111 X:633102-633124 CCTGGGTGGCAGTCCTGGCCCGG - Intronic
1187058513 X:15763601-15763623 CCTAAGTGGCTGTATTGGTCAGG + Intronic
1187489519 X:19737754-19737776 CATGAGTGGAAGTCCTAGTCTGG - Intronic
1188252149 X:27909931-27909953 CCTGAGTGGGGGTCAGGGGCAGG - Intergenic
1191735052 X:64380151-64380173 CCTCAGTGGCAGGCATAGTTGGG - Intronic
1195654334 X:107320612-107320634 CCTGAGTTTCAGTCTTGGTTCGG - Intergenic
1196461965 X:115941271-115941293 CCTTAGTGGCAGCCATGTTTGGG + Intergenic