ID: 1144059994

View in Genome Browser
Species Human (GRCh38)
Location 17:11574760-11574782
Sequence CAGTGGGATTGGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144059986_1144059994 12 Left 1144059986 17:11574725-11574747 CCAGCAAGCATGTTCAACAAGTA No data
Right 1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG No data
1144059985_1144059994 22 Left 1144059985 17:11574715-11574737 CCAATTCTAGCCAGCAAGCATGT No data
Right 1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144059994 Original CRISPR CAGTGGGATTGGAGGGAAGA TGG Intergenic
No off target data available for this crispr