ID: 1144062806

View in Genome Browser
Species Human (GRCh38)
Location 17:11598757-11598779
Sequence CTGGAGGTGGGACCTGAGTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 409}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144062792_1144062806 9 Left 1144062792 17:11598725-11598747 CCGGGCCCAGGGGCCTGGCAATA 0: 1
1: 0
2: 0
3: 14
4: 198
Right 1144062806 17:11598757-11598779 CTGGAGGTGGGACCTGAGTCGGG 0: 1
1: 0
2: 1
3: 34
4: 409
1144062793_1144062806 4 Left 1144062793 17:11598730-11598752 CCCAGGGGCCTGGCAATACGCCC 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1144062806 17:11598757-11598779 CTGGAGGTGGGACCTGAGTCGGG 0: 1
1: 0
2: 1
3: 34
4: 409
1144062794_1144062806 3 Left 1144062794 17:11598731-11598753 CCAGGGGCCTGGCAATACGCCCC 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1144062806 17:11598757-11598779 CTGGAGGTGGGACCTGAGTCGGG 0: 1
1: 0
2: 1
3: 34
4: 409
1144062784_1144062806 28 Left 1144062784 17:11598706-11598728 CCGCTGCTGGTGGTGCGGCCCGG 0: 1
1: 0
2: 1
3: 28
4: 604
Right 1144062806 17:11598757-11598779 CTGGAGGTGGGACCTGAGTCGGG 0: 1
1: 0
2: 1
3: 34
4: 409
1144062791_1144062806 10 Left 1144062791 17:11598724-11598746 CCCGGGCCCAGGGGCCTGGCAAT 0: 1
1: 0
2: 1
3: 38
4: 352
Right 1144062806 17:11598757-11598779 CTGGAGGTGGGACCTGAGTCGGG 0: 1
1: 0
2: 1
3: 34
4: 409
1144062797_1144062806 -4 Left 1144062797 17:11598738-11598760 CCTGGCAATACGCCCCGGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1144062806 17:11598757-11598779 CTGGAGGTGGGACCTGAGTCGGG 0: 1
1: 0
2: 1
3: 34
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144062806 Original CRISPR CTGGAGGTGGGACCTGAGTC GGG Exonic
900101317 1:963260-963282 CTGGAGGCTGGACTTGGGTCGGG + Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900316636 1:2060381-2060403 CTGGGGGTGGGAGCAGATTCAGG + Intronic
900572128 1:3363859-3363881 CTGGAGGTGGGAGCTGCAGCGGG - Intronic
900948327 1:5843775-5843797 GAGGTGGTGGGACCTGAGCCAGG - Intergenic
901767807 1:11515088-11515110 CTGGGGGTAGGAACTGTGTCTGG - Intronic
902809348 1:18879468-18879490 CAGGAGGTGGGAGCCAAGTCGGG + Intronic
902910971 1:19597066-19597088 CAGGAAGTGGGACCGGTGTCTGG + Exonic
903454702 1:23479133-23479155 TTGGAAGTGGGACATGAGACTGG + Intronic
903658481 1:24963150-24963172 CTGCAGATGGGGACTGAGTCGGG - Intronic
904200981 1:28818871-28818893 CTGGATGTGGGAGCTGAGGCTGG + Intronic
904330442 1:29754918-29754940 ATGGAGCTGGGATTTGAGTCAGG - Intergenic
904416236 1:30362677-30362699 GTGGAGCTGGGATTTGAGTCAGG + Intergenic
904543383 1:31249207-31249229 GTGGAGGTGGGACCTGGTTATGG + Intergenic
904832287 1:33312762-33312784 CTTGAGGTAGGACCACAGTCAGG - Intronic
905024894 1:34843281-34843303 CTGGGGGTGGGTCCAGAGGCAGG + Intronic
905414256 1:37793905-37793927 CAGGAGCAGGGGCCTGAGTCAGG - Exonic
905921268 1:41720519-41720541 CTACAGGTGAGACCAGAGTCAGG + Intronic
906343764 1:45002844-45002866 GTGGATGTGGGTTCTGAGTCAGG + Exonic
908819349 1:68067387-68067409 CTGGAGGTGGGGCCTGAAGCTGG + Intergenic
908856856 1:68439913-68439935 CTGGAGGTGGGTTTTAAGTCAGG + Intronic
911521474 1:98935202-98935224 CTGGAGACAGGACCTGAATCAGG + Intronic
912491687 1:110066010-110066032 CTGGAGATGGGCCCAGAGCCAGG - Intronic
913366846 1:118048265-118048287 ATGGAGGTGGGCCTGGAGTCTGG - Intronic
915086251 1:153390895-153390917 CTGGAGGTGGGGAGTGAGGCAGG - Intronic
915216114 1:154341847-154341869 CTGGAGCTGAGACCAGGGTCAGG - Intronic
915259283 1:154664719-154664741 TAGGAGGTGGGACTTGACTCGGG + Intergenic
915536676 1:156540572-156540594 CTGGAACAAGGACCTGAGTCAGG + Intronic
916005835 1:160659175-160659197 TAGGAGGTGGGACTTGACTCTGG - Intergenic
916427418 1:164693977-164693999 ATGGAGGTGGGACCTGGGTTAGG - Intronic
918612078 1:186504358-186504380 CTAGTGGTAGGAGCTGAGTCTGG + Intergenic
919504646 1:198384037-198384059 CTGGAGGTGGGCACTGAGAGAGG - Intergenic
919700862 1:200629784-200629806 CTGGAGGAGGGGCCTGGGTTTGG + Intronic
920251828 1:204627225-204627247 CTCGCTGTGGGACCTCAGTCCGG - Intronic
920417721 1:205810053-205810075 GTGCAGGTAGGACCTGAGTAGGG - Exonic
922351705 1:224739431-224739453 CTGGAGGAGGGACCAGAATGAGG + Exonic
923262887 1:232284232-232284254 CTGGCAGTGGGAGCTGTGTCAGG - Intergenic
923558369 1:235019817-235019839 CTGGTTGTGAGACCCGAGTCAGG + Intergenic
923664755 1:235990241-235990263 CTGGAGGTTGGTCCTGTGGCAGG + Intronic
924083225 1:240420946-240420968 ATGGAGGTTGGACCTGCATCAGG - Intronic
1062968547 10:1628832-1628854 CTGGAAGTGGGACCAGGGCCTGG - Intronic
1063282910 10:4650447-4650469 CTGGAGGCTGGACCTGGGTTTGG - Intergenic
1063374966 10:5548806-5548828 CCGGAGGTGTGAGCTGAGTTTGG - Intergenic
1065589225 10:27249311-27249333 GTGGAAGTGTGACTTGAGTCAGG + Intergenic
1065871357 10:29959038-29959060 TTGGAGGTGGGACCTGGGGGAGG + Intergenic
1066048849 10:31617611-31617633 CTGCAGGTGGGCCCTGAGGTGGG + Intergenic
1066387700 10:34955026-34955048 ATGGACGTGGGACCTGAGTCAGG - Intergenic
1068779943 10:60908774-60908796 CTAGAGGTGGGGTCTGTGTCAGG + Intronic
1069562675 10:69441806-69441828 GTGGAAGTGGGACATAAGTCAGG - Intergenic
1070746547 10:78937179-78937201 CTGTGCCTGGGACCTGAGTCAGG + Intergenic
1071479955 10:86057659-86057681 CTTGAGGTGAGACCTGAGAGTGG - Intronic
1072548683 10:96460377-96460399 CTGGAGGTGGGACCTTTGAGAGG + Intronic
1073119215 10:101111342-101111364 TTGGAGGAGGGACCTGGGCCTGG + Intronic
1074775631 10:116766449-116766471 TTGGAGGTGGGAGCTGGGTAGGG - Intergenic
1075066722 10:119293790-119293812 CTCGGGGTGGTACCCGAGTCTGG + Intronic
1075678923 10:124318585-124318607 GTGGATGTTGGAACTGAGTCTGG - Intergenic
1075787846 10:125061985-125062007 GTGGAGGTGGGACCGAAGCCGGG + Intronic
1076205425 10:128596619-128596641 CTGCAGGTAGTACCTGAGTTTGG + Intergenic
1076757413 10:132579672-132579694 CTGTAGGTGGGGCCTCAGTGAGG + Intronic
1076849387 10:133085757-133085779 CTGGAGATGAGACCTGAAGCAGG + Intronic
1077184659 11:1230739-1230761 CTGGAGGGGGGACCTGACCTGGG - Intronic
1077192872 11:1262786-1262808 CAGGAGGTGGGACAGGAGGCGGG - Intergenic
1077254386 11:1573814-1573836 CTGGAGGGGGACCCTGAGACTGG + Intergenic
1078699593 11:13668393-13668415 CGGGAGGTGGGCCCTGCGGCCGG - Intergenic
1080057699 11:27924643-27924665 CTGGAGATGGGCCCTGATGCGGG - Intergenic
1081722588 11:45301273-45301295 ATGGATGTGGGGCCAGAGTCAGG - Intergenic
1084219734 11:67670664-67670686 CTTCAGCTGGGACCTGAGCCGGG - Intronic
1089846983 11:121466298-121466320 CTGGGTGTGGGACCTGTGTGGGG + Intronic
1089855187 11:121537364-121537386 CTGGAGGTGAGAGCTGATGCTGG + Intronic
1089969063 11:122677925-122677947 ATGGAGGTGGGAGCTGGGTGTGG - Intronic
1090744723 11:129696571-129696593 GTGGAGCTGCGACCTGAGCCGGG - Intergenic
1091899782 12:4135429-4135451 CTGGCTGTGTGACCTTAGTCAGG - Intergenic
1092263817 12:6966368-6966390 AAGAACGTGGGACCTGAGTCTGG - Intronic
1092478001 12:8835537-8835559 CTGGAAGTGGTACCTGAGCAAGG + Exonic
1096849859 12:54428606-54428628 CTGGAGGTGGGAGGTGGGGCAGG - Intergenic
1097196547 12:57245212-57245234 CTGGAGGGGGCACCAGAGTTAGG + Intronic
1097231596 12:57515252-57515274 CTGGAGGTGGGAGCTGCAGCTGG - Exonic
1098987674 12:77030012-77030034 CTGCAGGAGGGACCAGCGTCAGG - Exonic
1101612412 12:106303319-106303341 CTGGAGTAGGGAACTGAGCCAGG + Intronic
1102825980 12:115948262-115948284 CTGGAGTAGGAACCTGAGTAAGG + Intergenic
1103440511 12:120959400-120959422 CTGGAGGTTGGAACTGATACAGG - Intergenic
1103720807 12:122974434-122974456 CTGGATGTGTGACCTGCGGCGGG + Intronic
1104674119 12:130701217-130701239 CAGCAGGTGGGAGCTGAGCCGGG + Intronic
1104717984 12:131029387-131029409 CTGGAGGTGGGAGGTGATCCTGG - Intronic
1105712755 13:23028932-23028954 TTGGAGGTGGGACCTAATGCAGG + Intergenic
1105978676 13:25496304-25496326 CTGGAGGTGGCACATGAGCCAGG - Intronic
1108002088 13:45913175-45913197 CAAGAGGTGGGACCAGAGGCAGG + Intergenic
1108436399 13:50405548-50405570 TTGGAGGTGGGAGCTGAGCAGGG - Intronic
1109252000 13:60031334-60031356 CTGGAGGTGGGGCCTGGGGGAGG - Intronic
1112363671 13:98739426-98739448 TTGGAGGTGGGACCTGGGGGAGG + Intronic
1112656040 13:101453615-101453637 CTGGAGGAAGGACCTGTGTCCGG + Intronic
1112930734 13:104733007-104733029 CAGGAGGTGGACCCTGTGTCAGG + Intergenic
1113660938 13:112105840-112105862 CTGGGGGAGGGACCTGAGGTGGG - Intergenic
1113874394 13:113585144-113585166 CTGGAGGTGGGGCCGGGGCCGGG + Intronic
1113919348 13:113898262-113898284 CTGGAGGTCGGACTGCAGTCTGG - Intergenic
1115137886 14:30132986-30133008 TTGGAGGTGGGACCTGGGGGAGG + Intronic
1115345055 14:32334080-32334102 CTGTAGATGGGCCCTGAGTGTGG + Intronic
1115398834 14:32937157-32937179 TTGGAGGTAGGGTCTGAGTCAGG + Intronic
1116061114 14:39925235-39925257 CTGGAGGTGGGGCCTGGTGCGGG - Intergenic
1116340837 14:43721869-43721891 TTGAAGGTGGGACCTGAGGGTGG - Intergenic
1117080076 14:52142719-52142741 CTGGAGGTGGGAGCAGGGCCAGG + Intergenic
1117186789 14:53247734-53247756 CAGGAGCTGGGACATGAGACGGG - Intergenic
1117313454 14:54551165-54551187 CTGGAGCTGGGTCCTGGGTGGGG - Intergenic
1117545810 14:56794397-56794419 CTTGACGTGGGAACTGAGACAGG - Intergenic
1118045527 14:61967165-61967187 CTGGAGGTGTGACCTACGTTTGG + Intergenic
1118430208 14:65711071-65711093 CTGGAGGTGGGGCCTGGTCCTGG - Intronic
1119199621 14:72742894-72742916 CAGGCGGAGGGACTTGAGTCTGG - Intronic
1119545546 14:75469039-75469061 AGAGAGGTGGGACGTGAGTCTGG + Intronic
1119626498 14:76181398-76181420 CTGGAGGTGGCCCCTTAGACGGG - Intronic
1119685319 14:76626475-76626497 CTGAAGGGGGGTCCTGGGTCGGG - Intergenic
1121038524 14:90726478-90726500 CTGAAAGTGGGACCAGATTCAGG - Intronic
1121228239 14:92337352-92337374 CTAGAGGTGAGACCAGAGTCAGG + Intronic
1121501528 14:94442118-94442140 GAGGAGGTTGGACCTGTGTCAGG - Intergenic
1121553284 14:94818605-94818627 CTGGAGGTGGGAAATGACACTGG - Intergenic
1121564011 14:94895188-94895210 CTGGAGGCTAAACCTGAGTCTGG + Intergenic
1121665713 14:95670642-95670664 GTGGAGGTGGGAGCTGGGCCAGG + Intergenic
1122781593 14:104146094-104146116 CTGGTGGTGTGGCCTGAGGCAGG + Intronic
1124346265 15:28923545-28923567 CTGGGGGTGGGTGCTGAGTCTGG + Intronic
1128061848 15:64740449-64740471 GTGGAGGTGGGAGCTGAGCCTGG + Exonic
1128324413 15:66714631-66714653 GTGGAGGCGGGACCTGAACCTGG + Intronic
1128709395 15:69860437-69860459 CTGGAGGTGGGATTTGAGCTGGG - Intergenic
1129678241 15:77643769-77643791 CTGGAGGTGGCACCAGACTCGGG - Intronic
1130830149 15:87591140-87591162 CTGGTGGTGGGACACTAGTCAGG - Intergenic
1132828503 16:1916616-1916638 CTGGGGGTGGGATCTGAGCTGGG - Intronic
1133007311 16:2891287-2891309 CTTGACCTGGGACCTGAGTCAGG - Intronic
1133200353 16:4200430-4200452 CAGGAGGTGGGAGGTGAGCCTGG + Intronic
1133995970 16:10748504-10748526 ATGGAGCTGGGACCTGAGTTTGG - Intronic
1135791549 16:25401304-25401326 CTAGAGGAGGATCCTGAGTCAGG - Intergenic
1135932513 16:26750375-26750397 CAGGAGGTAGGAGCTGAGACAGG + Intergenic
1136291122 16:29272034-29272056 CTGGAGATGAGCCCTGAGGCTGG + Intergenic
1136318278 16:29466581-29466603 CTGGAGGCGGGACCTGAGGTGGG + Exonic
1136432853 16:30205930-30205952 CTGGAGGCGGGACCTGAGGTGGG + Exonic
1136583867 16:31171083-31171105 CTAGAGGTGGGGCCTGGGTCTGG + Intergenic
1136777077 16:32877707-32877729 CTGGATGTGGGAGCCGTGTCCGG + Intergenic
1136845716 16:33574090-33574112 CTGGGTGAGGGACCTGAGCCTGG - Intergenic
1136893542 16:33983806-33983828 CTGGATGTGGGAGCCGTGTCCGG - Intergenic
1137321482 16:47387547-47387569 TTGGAGGTGGGGCCTGGGTGAGG - Intronic
1137688341 16:50402398-50402420 CTGGAGGTGAGAGATGAGGCTGG - Intergenic
1139354604 16:66360114-66360136 CTGGAGGGCAGGCCTGAGTCTGG - Intergenic
1139426026 16:66880518-66880540 CTGGAGCTGGGTCCTGACTAGGG + Exonic
1140419591 16:74807515-74807537 CTGAAGGTGGGACCTTACTGGGG + Intergenic
1140748791 16:78004699-78004721 CTGGAGATGGGGCCTGAGTATGG - Intergenic
1140838717 16:78819250-78819272 CAGCAGGTGGGACTTGATTCTGG + Intronic
1141194076 16:81846423-81846445 CTGGAAGTTGAGCCTGAGTCAGG - Intronic
1141638806 16:85329492-85329514 CTGCAGGTGGACCCTCAGTCGGG + Intergenic
1142096986 16:88245495-88245517 CTGGAGATGAGCCCTGAGGCTGG + Intergenic
1142268531 16:89077405-89077427 ATGAAGGTGGGACCTGGGACTGG - Intergenic
1203079492 16_KI270728v1_random:1139816-1139838 CTGGATGTGGGAGCCGTGTCCGG + Intergenic
1203107424 16_KI270728v1_random:1422743-1422765 CTGGGTGAGGGACCTGAGCCTGG - Intergenic
1142599069 17:1044224-1044246 CTGGATGGGGTCCCTGAGTCTGG + Intronic
1142809198 17:2387368-2387390 CTGGAGCTGGCACCAGTGTCTGG + Exonic
1143619034 17:8070715-8070737 GGGGAGGTGGGACATGAGTTGGG - Intergenic
1143895805 17:10135371-10135393 CAGAAGGTGGGACTTGACTCTGG - Intronic
1144062806 17:11598757-11598779 CTGGAGGTGGGACCTGAGTCGGG + Exonic
1144125239 17:12196975-12196997 CAGGAGGTGGGACCTGACGCCGG + Intergenic
1144392906 17:14812688-14812710 CTGGAGGTGACACCAAAGTCAGG - Intergenic
1144856547 17:18271573-18271595 CAGGAAGTGGGAGCTGAGCCTGG + Intronic
1145261091 17:21355249-21355271 CTGGAAGTGGGACCTGTCTGTGG - Intergenic
1145982219 17:29019859-29019881 CAGGAGCTGGGAACTGAGGCGGG - Intronic
1146121725 17:30201527-30201549 TTGGAGGTGGGAACTGTGTTAGG - Intronic
1146229526 17:31095389-31095411 CGGGAGGTGGGAGCGGAGTGGGG + Intronic
1146658361 17:34648614-34648636 TAGGAGGTGGGACTTGACTCTGG - Intergenic
1146691531 17:34879564-34879586 CTGGGAGAGGGACCTGAGGCTGG + Intergenic
1147690438 17:42311681-42311703 CTGGAGGTGGGGCCTGGAGCAGG + Exonic
1148220542 17:45858706-45858728 CTGGGGTGGGCACCTGAGTCAGG - Intergenic
1149602600 17:57903064-57903086 CTGGAGGTGGGACCATTGCCAGG - Intronic
1150281213 17:63930690-63930712 CTGGGGGTGTGGCCTGGGTCAGG - Intronic
1150455777 17:65305333-65305355 CTTGGGGTGGGAACAGAGTCTGG - Intergenic
1150630877 17:66879665-66879687 CTGGGGGTGGGTCCTGAATGTGG + Intronic
1151441613 17:74132990-74133012 GTGGAGGTGGGAACTGACTGAGG - Intergenic
1151497933 17:74470463-74470485 CTGGAGGTAGGACGAGAGACAGG + Intronic
1151536579 17:74742290-74742312 CTGCAGGTGAGACCAGAGGCTGG + Exonic
1151577299 17:74959147-74959169 CTGGAGGTGGGATCTGGCTCTGG - Intronic
1151578653 17:74965175-74965197 CTGGAGGTGGGCGCTGAGAGGGG - Intronic
1151748809 17:76025524-76025546 CAGGAGGCGGGACCTGAGGAGGG - Intronic
1151802056 17:76384551-76384573 CCGGGGGTGGAACCTGAGCCCGG - Intronic
1151923178 17:77173297-77173319 CTGGGGGAGGGCCCTGAGGCTGG + Intronic
1152633395 17:81420659-81420681 CTGGAGCTGGGGCCAGAGCCCGG + Intronic
1152900517 17:82938377-82938399 CTGGCGGTGGGATCTGGCTCAGG + Intronic
1154304974 18:13223927-13223949 AATGAGGTGGGACCTGGGTCAGG + Intronic
1154328486 18:13409783-13409805 CTGTAGGTGAGACCTGATACTGG + Intronic
1155855444 18:30828833-30828855 CTGGAGGTCTGGCCTGAGTCTGG + Intergenic
1156298800 18:35817781-35817803 CTGAAGGTGGGGCCTTAGCCAGG + Intergenic
1156495787 18:37524528-37524550 CAAGAAGTGGGAGCTGAGTCAGG - Intronic
1156558058 18:38089720-38089742 CTGGAGGTTGGACATCCGTCTGG + Intergenic
1156645983 18:39162768-39162790 TAGGAGGTGGGACTTGACTCCGG - Intergenic
1157408063 18:47440423-47440445 CTGGAGGTAGAACCTGAGAAGGG + Intergenic
1157551462 18:48584641-48584663 CTGGAGAGGAGACCTGAGTTTGG + Intronic
1159095866 18:63900782-63900804 TAGGAGGTGGGACCTGACTCTGG - Intronic
1159897197 18:74008543-74008565 GTGGAGCTGGGGCCGGAGTCTGG - Intergenic
1159939740 18:74397731-74397753 CTCGAGGTGGCTCCTGAGGCTGG + Intergenic
1160008905 18:75088975-75088997 CTGGAGATGGGAGCGGAGGCTGG + Intergenic
1160292801 18:77609445-77609467 CTGAAGGTGGGACCTTACTGGGG - Intergenic
1160739874 19:680758-680780 GTGGCGGTGGGGCCTGAGTAAGG + Intronic
1160742741 19:694971-694993 CTGGAGGGACGGCCTGAGTCAGG + Intronic
1160871593 19:1280245-1280267 CTGGAGGCGGCAGCTGAGGCTGG - Intergenic
1161045170 19:2130718-2130740 CTGGAGGGCAGGCCTGAGTCAGG - Intronic
1161573361 19:5042159-5042181 TTGGAGATGGGCCCTAAGTCTGG + Intronic
1161769136 19:6222024-6222046 AAGGAGGTGGGATCTGAGCCAGG - Intronic
1161983911 19:7643881-7643903 GGAGAGGTGGGACCTGAGTGAGG + Intronic
1162156962 19:8684707-8684729 GGGGAGGTGAGAGCTGAGTCTGG + Intergenic
1162349415 19:10139659-10139681 CTGCAGGTGGGCCCTGGGGCTGG - Exonic
1162752074 19:12835025-12835047 CTGGGGATGGAGCCTGAGTCTGG - Intronic
1163420863 19:17212946-17212968 CTGGAGCCAGGACATGAGTCAGG + Exonic
1164535671 19:29084984-29085006 CTTGAGGTGGGAGCTGACCCTGG - Intergenic
1164897553 19:31890447-31890469 CAGGAGGCGGGACTTGACTCTGG - Intergenic
1165103108 19:33450778-33450800 CAGGAGGCGGGACTTGACTCTGG + Intronic
1166573260 19:43813015-43813037 TCGGAGGTGGGACTTGATTCCGG - Intronic
1166798751 19:45443596-45443618 CCGGGGGCGGGGCCTGAGTCTGG - Intronic
1167784933 19:51628997-51629019 CTGAAGCTGGGACCTGCCTCTGG - Intronic
1168257963 19:55177315-55177337 CTGGATATGGGGCCTGAATCTGG + Intronic
1168338643 19:55611440-55611462 CTGTAGGTGGAACCTAAGTTGGG - Intronic
1168354515 19:55692888-55692910 CTGGAGGTGGGGGCTGAGGCGGG + Intronic
925263104 2:2545242-2545264 GTGAAGGTGGGGCCTGGGTCTGG + Intergenic
925302458 2:2826860-2826882 CTGGAGGTGGGGTCTGGGCCAGG - Intergenic
925326544 2:3026459-3026481 CTGGAAGGAGGAGCTGAGTCAGG + Intergenic
925999075 2:9315602-9315624 CTGGAGGCGGGAACTGTGACGGG + Intronic
926167519 2:10530775-10530797 CTGGAGCTGGGACCAGAGCCTGG - Intergenic
926431494 2:12790905-12790927 CTGGAGGTGGGAGATGAGCAGGG - Intergenic
927604840 2:24477531-24477553 CTGGATCTGGGAGCTGAGGCAGG - Intergenic
927666383 2:25035819-25035841 CTGTAGGAGGGACATGAATCGGG - Intergenic
928361975 2:30670921-30670943 CTGGAGTTGGGACCATAGTGAGG - Intergenic
930826125 2:55698808-55698830 CAGGAGGGGTGCCCTGAGTCAGG + Intergenic
932580366 2:72989325-72989347 CTAGCAGTGGGACCTGAGGCAGG + Intronic
932625109 2:73291329-73291351 CTGGAAGCGGGACCGGAGGCCGG + Exonic
933503525 2:83147192-83147214 CAGGAGGTGGGACTTGACTCTGG + Intergenic
933996155 2:87671579-87671601 CTGGAGGTGGGACCTTTGGGAGG - Intergenic
934474893 2:94587300-94587322 CTGGGGGTGGAAGCTGAGCCAGG + Intergenic
935365065 2:102280389-102280411 CTGCAGGGGGCACCTGAGGCAGG + Intergenic
936297700 2:111279333-111279355 CTGGAGGTGGGACCTTTGGGAGG + Intergenic
938097882 2:128475256-128475278 CTGGAGGTGGGGGCTGAGCCAGG + Intergenic
938538467 2:132265481-132265503 CGGGACGTGGGACGTGAGTGGGG + Intergenic
938655974 2:133434381-133434403 CTGGAGATCGTACTTGAGTCAGG + Intronic
938695843 2:133834767-133834789 CTAGAGGCGGGACCAGATTCAGG - Intergenic
941684887 2:168438158-168438180 CTGGAGGTGAAAGATGAGTCTGG - Intergenic
942075229 2:172351361-172351383 CTGGAGCTGGGAGCTGGGCCAGG + Intergenic
942462581 2:176178518-176178540 CTGAAGGCGCGACCTGAGCCCGG + Intergenic
943201732 2:184835568-184835590 TAGGAGGTGGGACTTGACTCTGG - Intronic
944207234 2:197169557-197169579 CTGGAGGTGGGAGTGGAGTAGGG - Intronic
944798815 2:203215395-203215417 CTGGAGGTGGAGGCTGAGGCAGG + Intronic
945258816 2:207825347-207825369 CTGGAGCTGGCAACTGACTCCGG - Intergenic
947573117 2:231250781-231250803 CTGGAGGAGAGACCTGAAGCAGG + Intronic
948671483 2:239571381-239571403 CTGGGAGTGGGGCCTGAGTGTGG + Intergenic
1168946850 20:1767956-1767978 CAGGAGGTGGAACCTGTGACAGG - Intergenic
1169031984 20:2416718-2416740 CAGGAGGCGGGACTTGACTCAGG - Intronic
1169296699 20:4406204-4406226 TTGGAGGTGGGACCTTTGACAGG - Intergenic
1171907873 20:30915236-30915258 CGGGACGTGGGACGTGAGTGGGG - Intergenic
1171986009 20:31661778-31661800 CTGGAGGTGGGACATGCCCCAGG - Intergenic
1172193774 20:33078110-33078132 ATGGAGGTAGGACCTGGGTTGGG + Intergenic
1172992800 20:39048622-39048644 CTGGAGGGAGCACCTGAGTTTGG + Intergenic
1174403397 20:50288485-50288507 CTGGTGTTAGAACCTGAGTCAGG - Intergenic
1174524069 20:51157284-51157306 CTGGAGGTGTGAGCTGAGGCAGG - Intergenic
1174547010 20:51333239-51333261 CTGGTGGTGGAACCTTAGGCAGG - Intergenic
1174707353 20:52670172-52670194 AGGGAGGTGGGACTTGACTCTGG + Intergenic
1174767929 20:53271258-53271280 CTGGCTGAGGGACCTGGGTCAGG + Intronic
1175276607 20:57775031-57775053 CTGGTGATGGGTCCTGAGACGGG + Intergenic
1175388457 20:58611861-58611883 CTCCAGGTGGGACCTGAGGGAGG - Intergenic
1176301021 21:5099155-5099177 CAGGAGGTGGGCCCTGCGTAGGG + Intergenic
1177790491 21:25717449-25717471 TTGGAGGTTTGACCTAAGTCTGG + Intronic
1178415343 21:32400404-32400426 CTGGAGGTGGGGCCTGATGGTGG + Intergenic
1179394459 21:41025204-41025226 CTGGAGGTGGGGCCAGAGGGAGG - Intergenic
1179587631 21:42383670-42383692 GAGGAAGTGGGAACTGAGTCAGG + Intronic
1179718828 21:43304042-43304064 TAGGAGGTGGGACTTGACTCCGG - Intergenic
1179856007 21:44162743-44162765 CAGGAGGTGGGCCCTGCGTAGGG - Intergenic
1179928337 21:44550646-44550668 AGGGAGGTGGGGCCTGAGCCCGG + Exonic
1179931712 21:44575050-44575072 TTTCAGGTGGGACCTGAGCCTGG - Exonic
1179939343 21:44628073-44628095 AGGGAGGTGGGGCCTGAGCCCGG - Exonic
1179939411 21:44628308-44628330 CTGGGGGTGAGACCCGGGTCAGG - Intronic
1180090961 21:45533663-45533685 CTGGTGGTCAGGCCTGAGTCGGG - Intronic
1180341318 22:11621406-11621428 CAGGACGTGGGACGTGAGTGGGG - Intergenic
1180897993 22:19351221-19351243 CTGATGCTGGGACCTGAGGCTGG + Intronic
1181934059 22:26427458-26427480 GTGGAGGTGGGTCCTGGGACAGG + Intergenic
1181934102 22:26427596-26427618 GTGGAGGTGGGTCCTGGGACAGG + Intergenic
1181934145 22:26427734-26427756 GTGGAGGTGGGTCCTGGGACAGG + Intergenic
1181934225 22:26428033-26428055 GTGGAGGTGGGTCCTGGGACAGG + Intergenic
1181934278 22:26428217-26428239 GTGGAGGTGGGTCCTGGGACAGG + Intergenic
1182192152 22:28473353-28473375 CTGGAGGTGGGGCTTGAATTCGG + Intronic
1183105270 22:35610867-35610889 CTGGAGGTAGGAGCAGAGCCTGG - Exonic
1183212243 22:36458165-36458187 CTGGGGGTGGGGCCAGAGTAGGG + Intergenic
1183421322 22:37713343-37713365 CTGGAGGTGGGGTCAGAGCCGGG - Exonic
1183687484 22:39369535-39369557 CTGGAGGTGGGCCCTGAAGAAGG - Intronic
1184473761 22:44710065-44710087 GTGGAGGTGGGATGTGAGGCGGG + Intronic
1184669780 22:46006624-46006646 GTGGAGCTGGGATCGGAGTCTGG - Intergenic
1184695949 22:46139223-46139245 CTGGGTGAGGGACCTGAGCCTGG + Intergenic
1184745460 22:46453114-46453136 CTGGATGTGGGGCCAGGGTCTGG + Intronic
950442126 3:13016217-13016239 CTGGAGGAGGGGCCTGGGCCCGG - Intronic
950508278 3:13409800-13409822 TTGGAGGTGGGGGCTGATTCAGG - Intronic
950859151 3:16132280-16132302 CTGGAGGAGGCTCCTGACTCTGG + Intergenic
953369257 3:42373275-42373297 GGGGAGGTGGAAACTGAGTCAGG + Intergenic
954250386 3:49362856-49362878 CTGTAGGTGGGGCCCGAGTAAGG + Intronic
954397326 3:50299625-50299647 CTGGAGGCGGGGCCTGCGCCTGG - Intergenic
954650917 3:52162295-52162317 CTGAAGGTGGGACCTTACTAGGG + Intergenic
956483459 3:69696477-69696499 GTGGAGGTGAGACTTGACTCAGG + Intergenic
956683752 3:71805219-71805241 CTGGAGGTGGGACTTGCGGGAGG + Intergenic
956794960 3:72709471-72709493 CTGGAGGTGGGCACTGGGTTGGG + Intergenic
958721002 3:97843416-97843438 CAGGAGGTGGGACGGGAGTCTGG + Intronic
959333011 3:105030385-105030407 TAGGAGGTGGGACTTGACTCTGG + Intergenic
959609607 3:108278598-108278620 CAGCAGGTGGGCCCTGGGTCTGG + Intergenic
961697140 3:128713181-128713203 TTGGAGGTGGGGCCTGATTGGGG - Intergenic
962665630 3:137651091-137651113 TTGGAGGTGGGAACTGGGTGAGG - Intergenic
962752312 3:138442540-138442562 CTGGGGGTGGGGCCTGAGCTTGG - Intronic
963180274 3:142348069-142348091 GTGGAGGTGGGAAATGAGTAGGG + Intronic
963903461 3:150754472-150754494 TTGGAGGTGGGGCCTGGGGCAGG - Intronic
964241517 3:154600599-154600621 TTGGAGGTGGGACCTGGTGCGGG - Intergenic
964627953 3:158776955-158776977 CTGGAAGTGGGGCCTGATTTGGG + Intronic
965669679 3:171134377-171134399 CTGAGGGTGGGACTTGAGCCTGG - Intronic
965968496 3:174525555-174525577 TTGGAGGTGGGACCTGGTTGGGG - Intronic
967842655 3:194019246-194019268 CTGGAGGAGGGACTTGAGGAAGG - Intergenic
968606296 4:1537341-1537363 CTGGATGTAGGACCTGGGTGTGG - Intergenic
968750618 4:2387088-2387110 CTGGAGGAGGGGGCTGAGCCAGG + Intronic
968810036 4:2795663-2795685 CAGGAGGAGGGATCTGAGCCGGG + Intronic
969523589 4:7692886-7692908 CTGGAGGCTGGACCTGAGGATGG - Intronic
970363174 4:15330707-15330729 TTGGAGGTGGGACCTTTGTAAGG - Intergenic
971242346 4:24900022-24900044 ATGGAGGTGGCACCTGGGCCAGG - Intronic
971389809 4:26175376-26175398 CTGGGGGGGGGATTTGAGTCTGG + Intronic
972817115 4:42656885-42656907 CTGCAGGTGGGTCCTCAGCCCGG + Exonic
973033414 4:45373282-45373304 ATGGAGGTGGGACCTTAGGGAGG + Intergenic
973844323 4:54895102-54895124 AAGGAGGTGGAACCTGAGACAGG - Intergenic
975392237 4:73833645-73833667 CTGGGGGTGGGACCAGAGCTGGG + Intergenic
976331188 4:83832799-83832821 CTGGAGGAGGCCCCTGAGTAGGG + Intergenic
977449528 4:97177035-97177057 TTGGAGGTGGGACTTTAGTGGGG - Intergenic
982321394 4:154080935-154080957 CTAGAGGTGAGATCTGAGACAGG - Intergenic
983366884 4:166802613-166802635 CAGGAGGTGGGACCTGTGGGAGG - Intronic
985683374 5:1268621-1268643 CTGGACGTAGGACCTGGGGCGGG + Exonic
985725858 5:1515474-1515496 CTGGGGGTGGGACTTGGGCCAGG - Intronic
985766944 5:1785093-1785115 CCAGAGGCTGGACCTGAGTCTGG - Intergenic
986639019 5:9853607-9853629 TAGGAGGTGGGACTTGACTCTGG - Intergenic
989837370 5:46009312-46009334 CTGGAGGTGGGACTTGTGGGTGG - Intergenic
990923501 5:60993955-60993977 CTGAAGGTGGGGCCTCAGTGGGG + Intronic
991534878 5:67658426-67658448 CTGGATGTGATACCTGAGTTAGG + Intergenic
991582604 5:68172571-68172593 CTGGTGGTGGGGCCTTTGTCTGG + Intergenic
991963690 5:72070511-72070533 CTGGAGGTGGAGCCAGTGTCGGG + Intergenic
994449966 5:99929512-99929534 CTGAAGGTGGGGCCTCAGTGAGG + Intergenic
995005149 5:107183465-107183487 CTGGAGATTGGCCCTCAGTCTGG + Intergenic
996090235 5:119343772-119343794 GAGGAGTTGGGACCTGAGTATGG + Intronic
997679679 5:135741181-135741203 ATGGAGCTGGGACCTGAGTTTGG + Intergenic
998383735 5:141744006-141744028 CTGGAGGTGGCTACTGAGCCAGG - Intergenic
999272886 5:150307880-150307902 CTTGGGGTGGGACCGGGGTCGGG - Intronic
999283227 5:150378810-150378832 CTGGAGCTGGAGCCCGAGTCTGG - Intronic
999921691 5:156328668-156328690 TTGGAGGAGGGACCTGGGACAGG + Intronic
1000205619 5:159055690-159055712 TTGGAGGTGGGACCTTACCCTGG + Intronic
1000410666 5:160933088-160933110 CTGGACGTTGTACCTGAGTTTGG - Intergenic
1000728933 5:164806362-164806384 TAGGAGGTGGGACTTGACTCTGG - Intergenic
1001118515 5:168959564-168959586 CTGGAGGCGGGGCCTGTGACAGG - Intronic
1001218767 5:169881008-169881030 CTGGATGTGAGTCCTGAGTTTGG + Intronic
1001950719 5:175814763-175814785 CTGGAAGCAGGACCTGAGGCCGG + Intronic
1002435449 5:179228353-179228375 CTGGTGGAGTGAGCTGAGTCAGG - Intronic
1002721210 5:181262179-181262201 CTGGAGAGGGGACCTGATCCAGG + Intergenic
1005131093 6:22508858-22508880 CCGGTGGTGAGACCTGAGGCAGG + Intergenic
1005434048 6:25788675-25788697 CAGGAGGTGTGGCCTGTGTCAGG + Intronic
1006284557 6:33082592-33082614 CTAGAGGAGGGACCAGAGGCAGG + Intronic
1006931609 6:37692292-37692314 CCGGAGGTGGGAGGTGAGGCAGG + Intronic
1007074200 6:39056465-39056487 CAGGAGGTGGATCCTCAGTCAGG - Exonic
1011637533 6:89388181-89388203 CTGGATGGGGGCCCTGAGCCAGG - Intronic
1012130323 6:95482826-95482848 CTGGAGTTGGGACCTGGGACAGG + Intergenic
1012666006 6:101970808-101970830 TAGGAGGTGGGACTTGACTCAGG - Intronic
1013268828 6:108527114-108527136 CTGCAGCTGGGTCCTGACTCTGG + Intergenic
1013474225 6:110492860-110492882 CTGGAGGTGATACCTGAGAGGGG - Intergenic
1015256512 6:131184375-131184397 TTGGAGGTGCCACCTGTGTCTGG - Intronic
1015559914 6:134503314-134503336 CTGGCGGTGGCCCCTGACTCTGG + Intergenic
1017446412 6:154510572-154510594 CAGGAGGTGGGACCTGCGCCGGG - Exonic
1018672887 6:166194204-166194226 CTGGAGGTCTGGCCAGAGTCCGG - Intergenic
1018803265 6:167239340-167239362 CTGGCTGTGGGACCTGGGACCGG + Intergenic
1019606224 7:1911615-1911637 CTGGAGGTGACGCCGGAGTCTGG - Intronic
1020102366 7:5401357-5401379 CTGGAGGGAGGACCTGATTCAGG - Intronic
1020815119 7:12895875-12895897 CTGGAGGTGGGGCCTGATGGGGG + Intergenic
1023844037 7:44111262-44111284 CTGGGGGTGGGACCTGTCTGTGG + Intronic
1026847022 7:73704120-73704142 CTGGGGGTGGGGCCTGGGGCGGG - Intronic
1026991363 7:74587764-74587786 CTGGAGATGGGGCCTGAGCTGGG - Intronic
1027145172 7:75688908-75688930 CTGCAGGGTGGACCTGAGCCAGG - Intronic
1027227319 7:76251957-76251979 CTGGAGCTGGGAGCTGAGGTGGG + Intronic
1027459100 7:78429939-78429961 ATGGAGTTGGGATCTGAATCAGG + Intronic
1029364377 7:100107577-100107599 GTGGTGGTGGAACCTGAGCCGGG + Exonic
1029375114 7:100172398-100172420 ATGGAGGAGGGTCCTGAGTAAGG - Intronic
1029685048 7:102141474-102141496 CAGGATTTGGGACCTGAGCCAGG + Intronic
1029730375 7:102434371-102434393 CTGGAGCTGGGTCTTGAGACAGG - Intronic
1032081026 7:128858541-128858563 CTGGAGGTGGGGGCTGAGGCTGG - Exonic
1032091223 7:128912620-128912642 CTGGAGGTGGGGGCTGAGGCTGG + Intergenic
1034226571 7:149489549-149489571 CTGCAGGTGGGACCTGCCTGAGG + Intronic
1034241627 7:149615807-149615829 CTGCAGGTGGGACCTGCCTGAGG + Intergenic
1035105553 7:156439545-156439567 CTGGAGGTGGGAGCAGATGCGGG - Intergenic
1035967542 8:4210054-4210076 TAGGAGGTGGGACTTGACTCAGG - Intronic
1036798657 8:11773570-11773592 CAGGAGGTAGGACTTGAGTTGGG + Intronic
1037471424 8:19215192-19215214 CAGGAGGTGGGATTTGACTCCGG + Intergenic
1037471429 8:19215211-19215233 CCGGAGGTGGGATTTGACTCCGG + Intergenic
1037828966 8:22177179-22177201 CTGGAGGTGGGGGCTGGGGCGGG - Intronic
1037909986 8:22738546-22738568 CTGGAGCTGGGACCAGAATGAGG + Intronic
1038004496 8:23418188-23418210 CTGCAGTTGAGGCCTGAGTCAGG + Intronic
1038098548 8:24344212-24344234 CTGGAGGTGGGTCCCCACTCTGG - Intronic
1038278729 8:26143515-26143537 CTGGGGGTGGGACCTGGGAAGGG - Intergenic
1038494487 8:27991966-27991988 CTTGAGCTGTGACATGAGTCAGG + Intronic
1038959734 8:32505915-32505937 CAGGTGGTTGGGCCTGAGTCTGG - Intronic
1040008304 8:42639723-42639745 CTGGAGATGGGAGCTGAATAAGG - Intergenic
1041115290 8:54530028-54530050 TTGGAGGTGGGACCTGTGGGAGG - Intergenic
1041323457 8:56638485-56638507 ATGGAAGTGGGAGCTGAGTAAGG - Intergenic
1045320006 8:101075230-101075252 CTGGCGGTGTGACCTGGGGCAGG + Intergenic
1049537130 8:143187679-143187701 CTGGAGGTGGCACCTGACCTGGG + Intergenic
1050991934 9:12166826-12166848 TAGGAGGTGGGACTTGACTCTGG - Intergenic
1052475285 9:28951545-28951567 CTGGGGGTGGCACCTCTGTCAGG - Intergenic
1052855161 9:33402459-33402481 CTGGGGGTGGAAGCTGAGCCAGG - Exonic
1053277662 9:36795411-36795433 ATGGAGGTGGCATCTGAGTAAGG - Intergenic
1053662483 9:40293338-40293360 CTGGAGGTGGGCTCAGAGCCAGG - Intronic
1053912937 9:42923513-42923535 CTGGAGGTGGGCTCAGAGCCAGG - Intergenic
1053933154 9:43127117-43127139 CTGGGGGTGGAAGCTGAGACAGG - Intergenic
1054296279 9:63334299-63334321 CTGGGGGTGGAAGCTGAGCCAGG - Intergenic
1054374612 9:64439563-64439585 CTGGAGGTGGGCTCAGAGCCAGG - Intergenic
1054394296 9:64638804-64638826 CTGGGGGTGGAAGCTGAGCCAGG - Intergenic
1054428945 9:65144003-65144025 CTGGGGGTGGAAGCTGAGCCAGG - Intergenic
1054522128 9:66082946-66082968 CTGGAGGTGGGCTCAGAGCCAGG + Intergenic
1055871178 9:80881791-80881813 CTGTAGGTGGGATCTGAATTTGG - Intergenic
1056639033 9:88354529-88354551 TTGGAGGCTGAACCTGAGTCAGG - Intergenic
1056842007 9:90005381-90005403 ATGGAGGTGTGACCTGAACCAGG - Intergenic
1057161763 9:92894265-92894287 CTGGGGGTGGGCTCAGAGTCAGG + Intergenic
1058591692 9:106572174-106572196 TGGGAGGTGAGACATGAGTCTGG - Intergenic
1059745287 9:117194185-117194207 CTGGAAATGGTACCTGAGCCAGG - Intronic
1060515891 9:124265613-124265635 CTGCATGTGGGACCTGAGGCTGG - Intronic
1060949175 9:127590058-127590080 CTGCAGGTGGCGCCTGATTCTGG + Intergenic
1061237963 9:129352955-129352977 CTGGGGTGGGGAACTGAGTCCGG + Intergenic
1061746135 9:132741540-132741562 CTGGAAGGGGGATCTGAGTGGGG - Intronic
1061877328 9:133550960-133550982 CTGGAGGAGGTACCTGTGGCTGG - Intronic
1062031437 9:134363785-134363807 CCGGAGGTGCGACCTGAGCATGG + Intronic
1062273930 9:135721866-135721888 CTGGAAGGTGGGCCTGAGTCAGG + Intronic
1062393398 9:136342875-136342897 CTGGAGGTGGGGCTTCAGCCCGG + Intronic
1062425028 9:136502168-136502190 TGGGAGGTGGGCCCTGGGTCGGG + Intronic
1062590361 9:137271874-137271896 CAGGGGGTGGGACCTGTGGCAGG - Intronic
1203362353 Un_KI270442v1:228247-228269 CGGGACGTGGGACGTGAGTGGGG + Intergenic
1185780045 X:2836116-2836138 CTGGACGTGGGGACTGAGTGTGG + Intronic
1189276563 X:39790710-39790732 CTGGAGGTGGGACCTGGTGGGGG - Intergenic
1189759433 X:44306170-44306192 CTGGAGCTGGGGGCTGGGTCGGG - Intronic
1190213655 X:48466728-48466750 CTGGATGTGGCTCCAGAGTCTGG + Intronic
1190321798 X:49184212-49184234 CTGTGGGTAGGGCCTGAGTCTGG + Intronic
1190330007 X:49230094-49230116 CTGGGGATGGAACCTGAGCCTGG + Intronic
1194570914 X:95553680-95553702 TAGGAGGTGGGACCTGATTCTGG - Intergenic
1196030611 X:111091967-111091989 CTGGCTGTGGGACTTGAGGCAGG + Intronic
1196798932 X:119524829-119524851 CTGGTGGTGGGGCCAGAGTGAGG - Intergenic
1197194056 X:123680249-123680271 CTGGAGGTGGGACATGCGGGTGG + Intronic
1197331801 X:125161848-125161870 CTTTAGCTGGGACCTGGGTCTGG - Intergenic
1198408868 X:136345606-136345628 GTGGATGTGGGACCTGACTCAGG - Exonic
1198528286 X:137524195-137524217 CTGGATGTGAGAGCTGAGGCTGG + Intergenic
1198978049 X:142359631-142359653 CTGGAGTTGGGCCCTGAGATGGG - Intergenic
1199670816 X:150146782-150146804 CAGGAGCTGGGCCCTGAGCCAGG + Intergenic
1200212224 X:154351837-154351859 GAGGAGGTGGGGCCTGAGTGTGG - Intronic
1201075894 Y:10188009-10188031 CGGGACGTGGGACGTGAGTGGGG - Intergenic
1201774146 Y:17645905-17645927 CTGGAGGTGGGACCTATCTAAGG - Intergenic
1201827411 Y:18260084-18260106 CTGGAGGTGGGACCTATCTAAGG + Intergenic