ID: 1144067007

View in Genome Browser
Species Human (GRCh38)
Location 17:11633638-11633660
Sequence TTTGAACCAATTCCAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 336}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144067002_1144067007 3 Left 1144067002 17:11633612-11633634 CCTTTTGAGATTCCCCTCTCCAA 0: 1
1: 0
2: 2
3: 20
4: 192
Right 1144067007 17:11633638-11633660 TTTGAACCAATTCCAAAGAAAGG 0: 1
1: 0
2: 1
3: 19
4: 336
1144067001_1144067007 22 Left 1144067001 17:11633593-11633615 CCGTAATTCACATTGGAAGCCTT 0: 1
1: 0
2: 0
3: 8
4: 182
Right 1144067007 17:11633638-11633660 TTTGAACCAATTCCAAAGAAAGG 0: 1
1: 0
2: 1
3: 19
4: 336
1144067003_1144067007 -9 Left 1144067003 17:11633624-11633646 CCCCTCTCCAAGCATTTGAACCA 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1144067007 17:11633638-11633660 TTTGAACCAATTCCAAAGAAAGG 0: 1
1: 0
2: 1
3: 19
4: 336
1144067004_1144067007 -10 Left 1144067004 17:11633625-11633647 CCCTCTCCAAGCATTTGAACCAA 0: 1
1: 0
2: 2
3: 14
4: 181
Right 1144067007 17:11633638-11633660 TTTGAACCAATTCCAAAGAAAGG 0: 1
1: 0
2: 1
3: 19
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144067007 Original CRISPR TTTGAACCAATTCCAAAGAA AGG Intronic
900825908 1:4926821-4926843 ATTGAAGGAATTCCATAGAAAGG + Intergenic
902968017 1:20025199-20025221 ATTGAAACTATTCCAAATAATGG - Intergenic
904469079 1:30724727-30724749 CTTGACCCAAATGCAAAGAAGGG - Intergenic
904595447 1:31641920-31641942 TATGACCCCATTCTAAAGAAGGG + Intronic
904695199 1:32326463-32326485 TTTGAAAAAATACCAAAGATAGG - Intronic
909169079 1:72271503-72271525 TGTGAACTTATTCCAAAAAATGG + Intronic
911349291 1:96733371-96733393 TTTTAACCTATTCTCAAGAAAGG + Intronic
912137255 1:106676545-106676567 TTTGAAACAATCCCAGAGAGAGG - Intergenic
912574556 1:110655206-110655228 TTTGAAACTATCCCACAGAATGG - Intergenic
913253578 1:116933637-116933659 TTTCAACCAATTCTCAACAAGGG - Intronic
913720324 1:121586665-121586687 TTTGAACGAAGTTCAAACAAAGG + Intergenic
914385858 1:147169775-147169797 TTTGAAACACTTTCAAAGTAGGG - Intronic
915035690 1:152922163-152922185 CTTGAACCAATACCCAAGAAAGG + Intergenic
917014375 1:170512622-170512644 TTTGAACAAAGTTCAAAGCATGG - Intergenic
917108441 1:171519383-171519405 TATGAACCAATCTCAACGAATGG - Intronic
918269483 1:182883345-182883367 TTTTCACCAAATACAAAGAAGGG - Exonic
919965586 1:202520584-202520606 TGTAAACAAATTCCAAATAATGG + Intronic
923403627 1:233639143-233639165 TTAGGACAAAGTCCAAAGAAGGG + Intronic
923881866 1:238112154-238112176 TCTGACCCAATTACAAAGCAAGG - Intergenic
1064630668 10:17307635-17307657 TTGGAACCAATCACAAAGAACGG + Intergenic
1064950481 10:20843606-20843628 TTTAAAACAATTTCAAATAATGG - Intronic
1065174671 10:23064857-23064879 TTCCACCCAATTCCAGAGAATGG - Intergenic
1065228192 10:23568983-23569005 TTTAATCAAATTCCAAAGGAAGG - Intergenic
1065580526 10:27166428-27166450 TTTGAACCCATTCCTGACAAAGG - Intronic
1065796174 10:29310422-29310444 TATGAACGTATTCCAAACAATGG + Intronic
1065946847 10:30612566-30612588 TATGAACATATTCCAAACAATGG - Intronic
1068575486 10:58679632-58679654 TCTGAAACTATTCCAAACAATGG + Intronic
1069495049 10:68896303-68896325 TTTCAACTATTTGCAAAGAAAGG - Intergenic
1070387417 10:75938462-75938484 TTGGAACCATTTGCAAAGCATGG - Intronic
1070719595 10:78746920-78746942 TTCCAACCAGATCCAAAGAAGGG + Intergenic
1073858870 10:107712706-107712728 TTTGAACATATTCCAATAAATGG - Intergenic
1074000087 10:109363004-109363026 TTTGTACCAATTAGACAGAAGGG + Intergenic
1074221919 10:111446202-111446224 TTTGATCAATTTCGAAAGAAAGG + Intergenic
1074910958 10:117908380-117908402 TTTCAACCAACACCAATGAAAGG + Intergenic
1076004392 10:126936606-126936628 TTTGAACCAATACCAGAGGTGGG - Intronic
1078225334 11:9386351-9386373 TTTGAACCATTACCAAACTATGG + Intronic
1078505797 11:11943602-11943624 TTTGAAGTAACTCCAAAGCAAGG + Intronic
1078838544 11:15055808-15055830 GTTGAAGCAGTGCCAAAGAAGGG + Intronic
1080724509 11:34882083-34882105 TTTAAAACAATTTTAAAGAAAGG + Intronic
1081897370 11:46598105-46598127 ATAGAAATAATTCCAAAGAAGGG - Intergenic
1082146721 11:48679485-48679507 TCTGAAACTATTCCAAACAATGG - Intergenic
1082851129 11:57765842-57765864 TTTGTACCACTTGCCAAGAAAGG - Intronic
1087046983 11:93850642-93850664 GTTGAACCAGTTCCCAAGGATGG + Intergenic
1087052386 11:93899113-93899135 TCTGAAACCATTCCAAACAATGG + Intergenic
1087096591 11:94325088-94325110 TTTTATCCAAATCCAACGAAGGG - Intergenic
1087243737 11:95809796-95809818 TCTGAAACAATTCCAATCAATGG + Intronic
1087428114 11:98015961-98015983 TTTGAAACTATTCCAAACAATGG + Intergenic
1087522842 11:99264625-99264647 ATTGAACAAATTCTAAAGGAAGG - Intronic
1087616605 11:100493066-100493088 TTTGAAGCAATTGTGAAGAATGG - Intergenic
1087696623 11:101384999-101385021 TTTGAATCAATTCCAGAGTTGGG + Intergenic
1088161076 11:106871248-106871270 TTTGATCTAATTTCAAAAAAGGG + Intronic
1088935796 11:114399415-114399437 TTGGAACCTTTGCCAAAGAAAGG + Intronic
1090318718 11:125821526-125821548 TCTGAAACTATTCCAAATAATGG + Intergenic
1091595676 12:1877535-1877557 TTTGAACCAAATGGAATGAATGG + Intronic
1093708095 12:22297504-22297526 TATGAACCATTTTCACAGAATGG + Intronic
1094773376 12:33692412-33692434 ATTGAACCAAGTAAAAAGAATGG - Intergenic
1095692239 12:45103269-45103291 TTTCAGTCAGTTCCAAAGAAAGG - Intergenic
1096417120 12:51424270-51424292 GTTGAAGCAATTCCACAAAAAGG - Intronic
1096950772 12:55467362-55467384 TTTCACCCAAATTCAAAGAAAGG + Intergenic
1097293829 12:57942321-57942343 CATGAACCACTTCCAAGGAACGG - Intronic
1097335058 12:58372851-58372873 TTTCAATCAATGCAAAAGAAGGG - Intergenic
1097514251 12:60584779-60584801 TTTTAACTAATTCAAAGGAATGG - Intergenic
1099172855 12:79386145-79386167 TTTAAACCATTCCTAAAGAAAGG + Intronic
1099590230 12:84577707-84577729 TTTCAAACAATTGAAAAGAAGGG + Intergenic
1100327103 12:93550149-93550171 TTTGCACCTTTTCAAAAGAAAGG - Intergenic
1100898610 12:99213529-99213551 TTTGAAGTACTTACAAAGAAAGG + Intronic
1105226616 13:18440767-18440789 TCTGAAACTATTCCAAACAATGG - Intergenic
1106885368 13:34178974-34178996 TTTAAACAAATTCAAAATAATGG - Intergenic
1107211380 13:37859378-37859400 TTTGGACCATTTTCAAAGCATGG - Intronic
1108172189 13:47752871-47752893 TCTGAAACTATTCCAAACAATGG + Intergenic
1108624681 13:52216165-52216187 TTTGAAACTATTCCAAACAACGG + Intergenic
1108851090 13:54730075-54730097 TATGAACCAATACCAGAGACCGG - Intergenic
1109369904 13:61410137-61410159 TTTAATCCAAAACCAAAGAAAGG + Exonic
1110067892 13:71131931-71131953 TCTGAAACTATTCCAAACAATGG + Intergenic
1110569329 13:76987965-76987987 TTTTCACCAAATGCAAAGAAGGG - Intergenic
1110569624 13:76990372-76990394 TTTTCACCAAATACAAAGAAGGG - Intergenic
1110849640 13:80230790-80230812 TTAGAACCAGGTCCAAAGACAGG + Intergenic
1111348682 13:86997448-86997470 TTTCAAACAATTGAAAAGAAGGG + Intergenic
1111501056 13:89120254-89120276 ATTAAACAAATTCCAAAAAAGGG - Intergenic
1111875922 13:93895476-93895498 CTTGAATCAATTCCCAAGCAAGG - Intronic
1113119726 13:106913546-106913568 AATGAGCCAATTTCAAAGAAGGG - Intergenic
1113692054 13:112318068-112318090 TGTGAACCATTTCTTAAGAATGG + Intergenic
1114011071 14:18369269-18369291 TCTGAAACTATTCCAAACAATGG - Intergenic
1114175902 14:20319330-20319352 TATAAACCAGTTCCAAAAAAAGG + Intronic
1115372423 14:32632782-32632804 TTTTAAAAAATTCCAAAGAAAGG + Intronic
1115756014 14:36526295-36526317 TTTGACCAGAGTCCAAAGAAGGG - Intergenic
1116334115 14:43635397-43635419 TCTGAACCAATGGCAAAGAAGGG - Intergenic
1116374643 14:44183487-44183509 CTTCAACGAGTTCCAAAGAAAGG + Intergenic
1116692112 14:48121474-48121496 ATTGAATCAAGTCCAGAGAAGGG - Intergenic
1116920936 14:50573507-50573529 TTTCAACCAAGTTCAAAGCATGG - Intronic
1117814271 14:59581268-59581290 TTTGACCCAACTACCAAGAATGG - Intergenic
1120253829 14:82092801-82092823 TTTGAAATAATTCTAAAGATTGG + Intergenic
1121981612 14:98459446-98459468 TTTGAACCAAAAGCATAGAAGGG + Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1122094287 14:99360091-99360113 TATGAACAATTTCTAAAGAATGG - Intergenic
1124446596 15:29739799-29739821 TTTCAAGCAATTCCCAAGAAAGG + Intronic
1125025202 15:35022708-35022730 TATGAACAAATTACAAACAAAGG - Intergenic
1126828788 15:52578183-52578205 TTTGAATAAATTAAAAAGAAAGG + Intergenic
1127330085 15:57930470-57930492 TCTGAAACTATTCCAAACAATGG - Intergenic
1127471126 15:59291281-59291303 TTTGGTCCAACTCCAAGGAAAGG - Intronic
1127483173 15:59395873-59395895 TTTCCCCCAAATCCAAAGAAAGG + Intronic
1127665494 15:61142009-61142031 TCTGAACAAAGTACAAAGAAGGG + Intronic
1127839473 15:62818596-62818618 TTTGAACTAATTCAAAAGAGAGG + Intronic
1129098405 15:73234197-73234219 TTTGAATCATTTCCCAATAAGGG + Intronic
1130832308 15:87613866-87613888 CTTAAACCAAGTCAAAAGAAGGG - Intergenic
1133697473 16:8278580-8278602 TTTGAAACATCTCTAAAGAAAGG - Intergenic
1133880917 16:9780930-9780952 TTTGAAACAATTCCAACAATTGG - Intronic
1133892767 16:9896396-9896418 TTTTAAGTAAATCCAAAGAAAGG - Intronic
1133936661 16:10275021-10275043 CTTAGAACAATTCCAAAGAAAGG + Intergenic
1138576440 16:57910339-57910361 TTTCAACCAATTGCCAAGCAGGG + Intronic
1139238554 16:65366407-65366429 TTTTAATCAAGTCCAGAGAATGG - Intergenic
1140146636 16:72317598-72317620 TATGAGCCAATTTCTAAGAACGG + Intergenic
1141795702 16:86272301-86272323 TTTGACCCAGTTGCAAAGCAAGG + Intergenic
1142019214 16:87770291-87770313 TTTGAATCCATTCCAGAGAGAGG + Intergenic
1142787660 17:2236816-2236838 TTTGAACAAATTCAAGATAAAGG + Intronic
1144067007 17:11633638-11633660 TTTGAACCAATTCCAAAGAAAGG + Intronic
1144513152 17:15894810-15894832 TTTAAATAAAGTCCAAAGAATGG + Intergenic
1144755045 17:17674899-17674921 ATTGAACCCACTCTAAAGAAGGG - Intergenic
1145420060 17:22816878-22816900 TTTGAACGAAGGCCAAAGAGTGG - Intergenic
1145421174 17:22832346-22832368 TTTGAACGAAGGCCAAAGAGTGG - Intergenic
1145421976 17:22843393-22843415 TTTGAACGAAGTCCACAGAGTGG - Intergenic
1145423268 17:22860894-22860916 TTTGAACGAAGGCCAAAGAGTGG - Intergenic
1145428249 17:22929886-22929908 TTTGAACGAAGGCCAAAGAGTGG - Intergenic
1145428598 17:22934645-22934667 TTTGAACGAAGGCCAAAGAGTGG - Intergenic
1145428767 17:22937025-22937047 TTTGAACGAAGGCCAAAGAGTGG - Intergenic
1145429803 17:22951299-22951321 TTTGAACGAAGGCCAAAGAGTGG - Intergenic
1145430499 17:22960815-22960837 TTTGAACGAAGGCCAAAGAGTGG - Intergenic
1145437144 17:23052422-23052444 TTTGAACGAAGGCCAAAGAGTGG - Intergenic
1145439034 17:23078598-23078620 TTTGAACGAAGGCCAAAGAGTGG - Intergenic
1145440656 17:23101202-23101224 TTTGAACGAAGGCCAAAGAGTGG - Intergenic
1145445070 17:23161890-23161912 TTTGAACGAAGGCCAAAGAGTGG - Intergenic
1145446797 17:23185682-23185704 TTTGAACGAAGGCCAAAGAGTGG - Intergenic
1145447306 17:23192821-23192843 TTTGAACGAAGGCCAAAGAGTGG - Intergenic
1145449537 17:23225698-23225720 TTTGAACGAATGCCACAGAGTGG - Intergenic
1145558798 17:24815100-24815122 TTTGAACGAAGGCCACAGAATGG - Intergenic
1145595041 17:25342163-25342185 TTTGAACGAAGGCCACAGAATGG - Intergenic
1145657988 17:26257315-26257337 TTTGAACGAATGCCACAGAGTGG - Intergenic
1146246486 17:31288460-31288482 TTTGGAACAATTCTAGAGAAAGG - Intronic
1146285555 17:31572000-31572022 TTAAAGCCAATTCCAAACAAGGG + Intronic
1146833694 17:36092306-36092328 TTGCTACCAATTCCAAATAAAGG + Intergenic
1146848284 17:36199145-36199167 TTGCTACCAATTCCAAATAAAGG + Intronic
1150003033 17:61453097-61453119 TGTGAACAATTACCAAAGAAAGG + Intronic
1150695629 17:67402606-67402628 TTTGAAACAAATGCAATGAATGG + Intronic
1153400225 18:4677085-4677107 TTTGACTCAAGTCCAAAGACAGG + Intergenic
1153530325 18:6039484-6039506 TTTAAACCAATGCAAATGAAAGG + Intronic
1154953602 18:21233664-21233686 TCTTAACAAATTCTAAAGAATGG - Intergenic
1155225527 18:23726182-23726204 TTTAAACTGATTCCAAAGAGGGG - Intronic
1155640137 18:28003823-28003845 TTTGAACTAATTCGATACAAAGG - Intronic
1155731324 18:29162731-29162753 TTTGGATAAAGTCCAAAGAATGG - Intergenic
1155848919 18:30745468-30745490 TTTGAACCTAGTTTAAAGAAAGG - Intergenic
1157275712 18:46309993-46310015 CTTGAACTAACTCCAAAGAATGG + Intergenic
1158098973 18:53807769-53807791 TTTGAAACTATTCCAAACAATGG + Intergenic
1159977517 18:74732345-74732367 TCTGAACCAAGTCCAAAGGCAGG - Intronic
1160105766 18:75974466-75974488 TTTAAAGCAATTAGAAAGAAGGG + Intergenic
1164046761 19:21549947-21549969 TCTGAAACTATTCCAAACAATGG - Intronic
1168513002 19:56988398-56988420 TAAGAACCAACTCCAAAGACTGG + Intergenic
925244970 2:2373754-2373776 TCTGAAACTATTCCAAACAATGG - Intergenic
926184222 2:10675974-10675996 TTGTAACCAAATCAAAAGAAAGG + Intronic
926352425 2:12008450-12008472 TTTGACCCATTTCCTTAGAAAGG + Intergenic
927020996 2:19017091-19017113 TCTGAAACTATTCCAAACAACGG - Intergenic
928251931 2:29688650-29688672 TTTGAAACAAGTGAAAAGAAAGG + Intronic
929409342 2:41679165-41679187 TTTTAATGTATTCCAAAGAATGG - Intergenic
931039306 2:58279287-58279309 TTTGAAAGACTTCCAAAGAAAGG - Intergenic
931885633 2:66614523-66614545 TTTGAACTCATTGCAAGGAAGGG - Intergenic
933219554 2:79672422-79672444 TTAGAACCGATTACAAAAAAAGG - Intronic
935441933 2:103109128-103109150 TTTGAACATATTCTAAATAACGG + Intergenic
936735468 2:115437161-115437183 TTTGAATTAATTCAAAATAATGG + Intronic
936877483 2:117209376-117209398 TTCCAACCAATTGAAAAGAAAGG + Intergenic
938525858 2:132130068-132130090 TCTGAAACTATTCCAAACAATGG + Intergenic
939489480 2:142860027-142860049 TTTGAACCTTTGCCAAGGAAGGG + Intergenic
939647080 2:144713514-144713536 GTTGAACCAAGCACAAAGAAAGG + Intergenic
939704152 2:145431246-145431268 TTTGAACAAATGCCAAATGAGGG + Intergenic
940033273 2:149287344-149287366 TATGAACCAGTTCCACAGAAGGG - Intergenic
940977320 2:159960464-159960486 TTTGAATAAATTCCAAAAAGAGG + Intronic
941374347 2:164708384-164708406 TTTGAAATAATTCAAAACAAGGG + Intronic
941406257 2:165092506-165092528 CTAGAACAAATTCCAAGGAATGG - Exonic
943001533 2:182334176-182334198 TCTGAAACTATTCCAAACAATGG + Intronic
943112012 2:183618524-183618546 TCTGAAACTATTCCAAACAATGG - Intergenic
943158698 2:184218116-184218138 TCTGAAGCTATTCCAAACAATGG - Intergenic
944302258 2:198137330-198137352 TTTGAAATAATTACTAAGAACGG + Intronic
944546970 2:200808825-200808847 TTTGAACTACTTAAAAAGAAAGG - Intergenic
944635530 2:201672813-201672835 TCTGAAACTATTCCAAACAATGG + Intronic
945371463 2:209023754-209023776 TCTGAAACTATTCCAAACAATGG + Intergenic
945414737 2:209557059-209557081 TTTTAAACAGTTCAAAAGAAAGG - Intronic
947144139 2:227048865-227048887 TTGTAACCATTTCCCAAGAAGGG + Intronic
947175715 2:227365209-227365231 TTTGAACCAAAACCCAAGGAAGG - Intronic
1169554467 20:6734964-6734986 TATGTACCACTTCCAAACAAAGG + Intergenic
1169948711 20:11017986-11018008 TTTGAAACAATTCAAGAGATAGG + Intergenic
1170311099 20:14992785-14992807 TTTAAAAAAATTTCAAAGAAAGG - Intronic
1174972807 20:55296130-55296152 TTTGAACCAATATGAAAGGATGG - Intergenic
1175233826 20:57494526-57494548 TTTGAACCATTTCCAAGGCATGG - Intergenic
1176770666 21:13069794-13069816 TCTGAAACTATTCCAAACAATGG - Intergenic
1176892114 21:14330763-14330785 TGTGAAACTATTCCAAACAATGG + Intergenic
1177586467 21:23102336-23102358 TTATAACCAATTCCAAAAAACGG - Intergenic
1177856900 21:26409864-26409886 TTTGAAGCGATTACACAGAAAGG - Intergenic
1178134913 21:29616011-29616033 TTTGCCCCAATTCCCAACAAGGG + Intronic
1179087981 21:38237366-38237388 TTCCCACCAATTCCAAAGGAGGG + Intronic
1179119147 21:38527002-38527024 TGTTCACCAATTCCTAAGAAGGG + Intronic
1180435565 22:15300073-15300095 TCTGAAACTATTCCAAACAATGG - Intergenic
1180517755 22:16163887-16163909 TCTGAAACTATTCCAAACAATGG - Intergenic
1180761644 22:18214415-18214437 TTTCAAGCATTTCCAAAGAGTGG - Intergenic
1180774023 22:18410195-18410217 TTTCAAGCATTTCCAAAGAGTGG + Intergenic
1180805371 22:18709669-18709691 TTTCAAGCATTTCCAAAGAGTGG - Intergenic
1181070133 22:20329208-20329230 TTTCAAGCATTTCCAAAGAGTGG + Intergenic
1181193127 22:21157146-21157168 TTTCAAGCATTTCCAAAGAGTGG + Intergenic
1181216319 22:21335455-21335477 TTTCAAGCATTTCCAAAGAGTGG - Intergenic
949470034 3:4384825-4384847 TTGGAATCAATGCCAAAGGAGGG + Intronic
950379857 3:12602998-12603020 TTTAAATCAATTCCAACCAAAGG - Intronic
951280003 3:20736498-20736520 TTTGACAGAATTCCAAACAATGG - Intergenic
952153378 3:30616966-30616988 TTTTAACCAATTCAGAGGAAGGG - Intronic
957466271 3:80597172-80597194 TCTGAAACTATTCCAAACAATGG + Intergenic
958093264 3:88904724-88904746 TCTGAAACTATTCCAAACAATGG - Intergenic
962611091 3:137076785-137076807 TTCAAACCAATTCCAGATAAAGG - Intergenic
964170185 3:153760577-153760599 TTGGAAGCAATTTTAAAGAAAGG - Intergenic
964182994 3:153910154-153910176 TTTGATCGAATTTCAAAGGAAGG - Intergenic
964590429 3:158357322-158357344 TTTGCACCAATTTAATAGAATGG + Intronic
965261619 3:166493294-166493316 ATTGAACTAATTCCAGAGCATGG - Intergenic
965511274 3:169570435-169570457 TCTGAAACTATTCCAAACAATGG + Intronic
968696135 4:2029056-2029078 TCTGAAACTATTCCAAACAATGG - Intronic
969451984 4:7279173-7279195 TTTGAACCACCACCAAAAAAGGG - Intronic
969948641 4:10810942-10810964 TTTAAAGCAAGCCCAAAGAAAGG - Intergenic
970418780 4:15884933-15884955 TTTGAACCTATTCCCAGGATGGG - Intergenic
970666173 4:18339778-18339800 TTCCAAACAATTCCAAAGGAGGG - Intergenic
970937269 4:21587988-21588010 TTTAAGACAATACCAAAGAAAGG - Intronic
973661259 4:53108813-53108835 TCTGAAACTATTCCAAACAATGG + Intronic
973753650 4:54049985-54050007 TTTAAACTATTTTCAAAGAATGG + Intronic
974543657 4:63272182-63272204 GTTGAAACTATTCCAAAAAATGG - Intergenic
975662895 4:76705120-76705142 TTTCAGCCAATACAAAAGAAAGG - Intronic
975865680 4:78721388-78721410 TTTGAACAATTTTCAAAGCAAGG - Intergenic
975922370 4:79407549-79407571 CTTTATCCCATTCCAAAGAATGG + Exonic
977112742 4:92979749-92979771 CTTGCACTAATTCCAAAGTATGG - Intronic
977879026 4:102183334-102183356 GCTGAACCAATTTCAAACAAGGG + Intergenic
978646485 4:110938611-110938633 ATTCAAACAACTCCAAAGAAGGG - Intergenic
979396594 4:120196917-120196939 TTTGAATCAAATCTAAGGAAAGG + Intergenic
980460058 4:133098158-133098180 TTTGTATCAATTTCAAAGTAAGG - Intergenic
980660151 4:135847487-135847509 TCTGAAACTATTCCAAACAATGG + Intergenic
981131899 4:141166396-141166418 TTGGAAACTATTCCAAACAATGG + Intronic
981411583 4:144438538-144438560 TCTGAAACTATTCCAAACAATGG + Intergenic
982224351 4:153152556-153152578 TTTGGACCATTTCCAAAGCACGG - Intronic
983408270 4:167360970-167360992 TTTAAAGCATTTCCAATGAATGG + Intergenic
984406531 4:179338762-179338784 TTGGAACCATATCAAAAGAATGG - Intergenic
986784625 5:11102907-11102929 TTTAAAGCAAATCCAAAGAAAGG - Intronic
987078823 5:14408110-14408132 TCTGAATCAATTCCCAAGGACGG - Intronic
987506407 5:18779385-18779407 TTTCAAAGAATTCCAAAGACTGG + Intergenic
988758490 5:34286631-34286653 TTTGAATCAAATCCAACCAACGG - Intergenic
989323530 5:40164826-40164848 TTTTAACCAATCTCAAAGAGAGG + Intergenic
989692975 5:44167609-44167631 ACTGAAACTATTCCAAAGAAGGG - Intergenic
990490680 5:56300075-56300097 TTTAGACCAATTCCACAGGAGGG + Intergenic
992292012 5:75289190-75289212 TCTGAAACTATTCCAAACAATGG - Intergenic
992658287 5:78932092-78932114 TTTCACCCAATTCCAAAAGATGG + Intronic
993357486 5:86932543-86932565 TTAGAACCATATCCACAGAATGG - Intergenic
993375626 5:87146709-87146731 TCTGAAACTATTCCAAACAATGG - Intergenic
993990044 5:94645111-94645133 TTTGAACCAATTCTGATCAATGG + Intronic
995068639 5:107891562-107891584 TTTGAATCAATTTTAAAGATAGG + Intronic
995268097 5:110188243-110188265 TCTGAAACTATTCCAAACAATGG + Intergenic
995428902 5:112052997-112053019 TTTGAAAAAATTCAGAAGAATGG + Intergenic
996155730 5:120097090-120097112 TTTGCACCAACTACAAAGTAAGG - Intergenic
996894166 5:128459408-128459430 TTTCAAACAATTGAAAAGAAGGG + Intronic
997804116 5:136897299-136897321 TCTCAACAAATTCCAAAGATTGG - Intergenic
998294740 5:140956691-140956713 TCTGAAGCTATTCCAAACAATGG - Intronic
999221083 5:149978226-149978248 TTTGAAACCATTCCTAAGGAAGG - Exonic
999489512 5:152035882-152035904 TCTGAAACTATTCCAAACAATGG - Intergenic
999917891 5:156283767-156283789 TTTTAACCAATTCTCAAGAGAGG + Intronic
1002673878 5:180893291-180893313 TCTGAAACTATTCCAAACAATGG + Intergenic
1004802736 6:19168663-19168685 TTTGAACTAACTCCTAAGAAAGG + Intergenic
1005795100 6:29351743-29351765 TTTCAAACAATTCAAAAGGAGGG - Intergenic
1008313132 6:50003285-50003307 TATGTATCCATTCCAAAGAAAGG + Intergenic
1009493055 6:64315663-64315685 TCTGAAACTATTCCAAACAATGG + Intronic
1009717701 6:67422159-67422181 TTTCAACCATTTCAAAATAAAGG + Intergenic
1009783331 6:68298043-68298065 ATTGAAATAATTCAAAAGAATGG + Intergenic
1009842739 6:69097264-69097286 TTTTAAACATTTCCAATGAATGG + Intronic
1009959161 6:70498019-70498041 TCTGAAACTATTCCAAACAATGG - Intronic
1009974693 6:70660269-70660291 TTGGAAATAATTCCAAAGGAAGG + Intergenic
1010038250 6:71351544-71351566 GTGGAACCAATTACAAATAAGGG + Intergenic
1010747879 6:79584634-79584656 TTTGAACCAATTACACATAGAGG + Intergenic
1012181897 6:96164661-96164683 TATGCCCAAATTCCAAAGAAAGG + Intronic
1012314548 6:97769592-97769614 TTTCAAACAATTCAAAAGGATGG - Intergenic
1013540028 6:111099066-111099088 TTTGAACCAATATCAAAATATGG - Intronic
1013747846 6:113366919-113366941 TATGAACCTATACCAAAGCATGG + Intergenic
1014052410 6:116970480-116970502 TTTGAATTAATTTCAAAGTAAGG + Intergenic
1014141319 6:117946685-117946707 TTTGATACAGTACCAAAGAAGGG + Intronic
1014220306 6:118792744-118792766 TATGAACCCATTTTAAAGAAAGG - Intergenic
1014967678 6:127776055-127776077 ATTGAACAAATGCCAAATAACGG + Intronic
1015493100 6:133851199-133851221 TTTGAACCAGTTGGAAACAAGGG - Intergenic
1015845872 6:137520093-137520115 TTTCAACCAAAACCAAAAAAAGG - Intergenic
1016743808 6:147556535-147556557 TTAGAACCAAAACCAGAGAATGG + Intronic
1017341726 6:153331653-153331675 TATGAAGAAATACCAAAGAATGG - Intergenic
1020643841 7:10789491-10789513 TTTTAGCCAATTCCAAAAAGAGG - Intergenic
1021369308 7:19821597-19821619 TTTGAAAAAATTGAAAAGAAGGG - Intergenic
1022155674 7:27660361-27660383 TTTAAAACAATTCCAAAGAAAGG + Intronic
1022564391 7:31383297-31383319 TTTGAACAAATTACCAAGGATGG + Intergenic
1023637150 7:42223682-42223704 TTTGAACAAATTCCAAAGGGAGG + Intronic
1023650889 7:42367980-42368002 TCTGAAACTATTCCAAACAAAGG - Intergenic
1024719606 7:52120347-52120369 TATGAACAAATTTTAAAGAATGG + Intergenic
1026175950 7:67997186-67997208 TTTAACCCAAGTGCAAAGAATGG - Intergenic
1028554606 7:92108689-92108711 TGTGAAAGAATTTCAAAGAAAGG - Intronic
1029324922 7:99797874-99797896 TATCAACCAAATACAAAGAAAGG + Intergenic
1029906311 7:104096983-104097005 TTTGCAAGAATTCCAAAGGAAGG - Intergenic
1030853430 7:114519730-114519752 ATTAAACCTATTCCATAGAAGGG - Intronic
1030991269 7:116303415-116303437 TTTGAACAAATGCCTAGGAAAGG + Intronic
1031670683 7:124540875-124540897 TTTGCAGCAATTCTAAACAAGGG - Intergenic
1032341406 7:131076829-131076851 TTTAAACTCATTCCAAAAAAAGG + Intergenic
1032900249 7:136299415-136299437 TTTGAACCAAGTCTTAAAAATGG + Intergenic
1033919521 7:146372287-146372309 TTTCAGCCAATGCCATAGAATGG + Intronic
1034590352 7:152133095-152133117 TGTAGACAAATTCCAAAGAATGG - Intergenic
1035030816 7:155857626-155857648 TTTGATCCAGATCCAAAGAGTGG - Intergenic
1035733596 8:1871287-1871309 TATTAACAAATGCCAAAGAATGG + Intronic
1035838396 8:2783951-2783973 TTTGAACCAATATGAAACAAAGG + Intergenic
1035915427 8:3615751-3615773 TTTGAAAAAAATCCAAAAAAAGG - Intronic
1037058427 8:14475706-14475728 TCTGAAGCAATTCCAAATTAAGG + Intronic
1038010288 8:23470438-23470460 TTAGAATGAATTCCCAAGAATGG + Intergenic
1038815396 8:30897974-30897996 TTTGAACCAATACATAAGCAGGG - Intergenic
1038959977 8:32508098-32508120 TTTCAACCATTAACAAAGAATGG + Intronic
1039319735 8:36414968-36414990 TTTTATCCAATTCCTAAGGAGGG - Intergenic
1040402964 8:47071223-47071245 TTTGAACTATTTGCAGAGAAGGG + Intergenic
1041617418 8:59923963-59923985 TTTGAATCAACCCTAAAGAAGGG + Intergenic
1042303110 8:67307323-67307345 TTTGAGCCAAGTCTGAAGAATGG + Intronic
1043251457 8:78078901-78078923 TTTGAAGCAATTTGGAAGAAAGG + Intergenic
1044184231 8:89233417-89233439 TTTCAACCAATTGCCAATAAGGG - Intergenic
1045071505 8:98510008-98510030 TTAGAATAAATTCAAAAGAAAGG + Intronic
1045825982 8:106398697-106398719 CTTGAACACATTCCCAAGAAGGG - Intronic
1046643727 8:116762100-116762122 TTTGAACCTGTTCAAAGGAAGGG + Intronic
1046716953 8:117578578-117578600 TTTGAACAAATCCAAAAGGAAGG + Intergenic
1047548646 8:125845126-125845148 TGTGGATAAATTCCAAAGAATGG + Intergenic
1050070054 9:1801019-1801041 TTTGATCCAATTCAGATGAAAGG - Intergenic
1050150111 9:2611142-2611164 TTTGAACCTACTCAGAAGAAAGG + Intergenic
1051939892 9:22492982-22493004 TCTGAAACTATTCCAAACAATGG - Intergenic
1053704550 9:40737416-40737438 TCTGAAACTATTCCAAACAATGG + Intergenic
1054414631 9:64861023-64861045 TCTGAAACTATTCCAAACAATGG + Intergenic
1056547481 9:87624818-87624840 TTTAAGTCAATTCCAAATAAAGG - Intronic
1058092957 9:100826295-100826317 TCTGAAACTATTCCAAACAATGG - Intergenic
1058101178 9:100919182-100919204 TTTGAACAAAGTCGAGAGAAGGG - Intergenic
1058936687 9:109776208-109776230 TTTGAACCCATTACAAACACAGG - Intronic
1059815344 9:117906107-117906129 CTTGAACCAAATGAAAAGAATGG - Intergenic
1060845135 9:126830821-126830843 TTAGAAACAATTCCTAACAATGG - Intronic
1061644767 9:131992235-131992257 TTTGAACCAATGAGAAAAAAAGG + Intronic
1186550140 X:10495587-10495609 TTGGAACCAAGATCAAAGAAGGG - Exonic
1187839612 X:23473532-23473554 TATGAAACTATTCCAAACAATGG - Intergenic
1187953678 X:24494857-24494879 TCTGAACCAATCCCACTGAAGGG - Exonic
1188772333 X:34167876-34167898 TCTGAAACTATTCCAAAGAATGG + Intergenic
1189361187 X:40353404-40353426 TTTCAACAAATTTCAAAAAATGG + Intergenic
1190977441 X:55419829-55419851 TTCTAAACAATTGCAAAGAAGGG + Intergenic
1194165307 X:90507789-90507811 TTTGTAACAATTCCAACCAAGGG + Intergenic
1194444668 X:93973360-93973382 TTATAAACAATTACAAAGAAGGG - Intergenic
1194452104 X:94056969-94056991 TTAGGATCAATTCCAAGGAATGG + Intergenic
1196015541 X:110936486-110936508 TTTAAACAAATTTCAAAGATTGG - Intergenic
1196559524 X:117128551-117128573 TTCCAAACAATTGCAAAGAAGGG + Intergenic
1197175737 X:123484069-123484091 TGTGCACCAGTTCCAAGGAAGGG - Intronic
1198678975 X:139160941-139160963 TCTGAAACTATTCCAAACAACGG + Intronic
1199220779 X:145313748-145313770 TTTGAATAAATACCTAAGAATGG + Intergenic
1199600042 X:149536474-149536496 TGTGAACCATCTCCAGAGAAGGG + Intergenic
1200511576 Y:4085599-4085621 TTTGTAACAATTCCAACCAAGGG + Intergenic
1200834451 Y:7719247-7719269 GTTCAACCAATTCCAGATAAAGG + Intergenic
1200848089 Y:7852223-7852245 TTTCAACCCATTGCAATGAAGGG + Intergenic
1202098510 Y:21280494-21280516 TCTGAAACTATTCCAAACAATGG + Intergenic
1202301200 Y:23416385-23416407 TGTAAACAAATTCCAAATAATGG + Intergenic
1202569611 Y:26254213-26254235 TGTAAACAAATTCCAAATAATGG - Intergenic