ID: 1144067008

View in Genome Browser
Species Human (GRCh38)
Location 17:11633639-11633661
Sequence TTGAACCAATTCCAAAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 264}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144067004_1144067008 -9 Left 1144067004 17:11633625-11633647 CCCTCTCCAAGCATTTGAACCAA 0: 1
1: 0
2: 2
3: 14
4: 181
Right 1144067008 17:11633639-11633661 TTGAACCAATTCCAAAGAAAGGG 0: 1
1: 1
2: 1
3: 26
4: 264
1144067002_1144067008 4 Left 1144067002 17:11633612-11633634 CCTTTTGAGATTCCCCTCTCCAA 0: 1
1: 0
2: 2
3: 20
4: 192
Right 1144067008 17:11633639-11633661 TTGAACCAATTCCAAAGAAAGGG 0: 1
1: 1
2: 1
3: 26
4: 264
1144067003_1144067008 -8 Left 1144067003 17:11633624-11633646 CCCCTCTCCAAGCATTTGAACCA 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1144067008 17:11633639-11633661 TTGAACCAATTCCAAAGAAAGGG 0: 1
1: 1
2: 1
3: 26
4: 264
1144067001_1144067008 23 Left 1144067001 17:11633593-11633615 CCGTAATTCACATTGGAAGCCTT 0: 1
1: 0
2: 0
3: 8
4: 182
Right 1144067008 17:11633639-11633661 TTGAACCAATTCCAAAGAAAGGG 0: 1
1: 1
2: 1
3: 26
4: 264
1144067005_1144067008 -10 Left 1144067005 17:11633626-11633648 CCTCTCCAAGCATTTGAACCAAT 0: 1
1: 0
2: 1
3: 9
4: 150
Right 1144067008 17:11633639-11633661 TTGAACCAATTCCAAAGAAAGGG 0: 1
1: 1
2: 1
3: 26
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144067008 Original CRISPR TTGAACCAATTCCAAAGAAA GGG Intronic
900825909 1:4926822-4926844 TTGAAGGAATTCCATAGAAAGGG + Intergenic
904469078 1:30724726-30724748 TTGACCCAAATGCAAAGAAGGGG - Intergenic
904670191 1:32158836-32158858 TTAAAACAATTTCAAAGGAAAGG + Intronic
904934143 1:34114735-34114757 AGAAACCAATTCTAAAGAAATGG + Intronic
905116340 1:35644152-35644174 TTGAAGCAATTCTGAAAAAAAGG + Intergenic
905346536 1:37314959-37314981 TAGAACCAAGACCAGAGAAATGG + Intergenic
906169814 1:43715083-43715105 TTTAACATATTCCAAACAAAAGG - Intronic
907151163 1:52288983-52289005 TGGAACCATTTCCAAGCAAATGG - Intronic
907956792 1:59236200-59236222 TTGTTCCCATTCCATAGAAAAGG - Intergenic
908349302 1:63268548-63268570 TTGAACCAATGCCTCAGCAAAGG - Intergenic
909469724 1:76013592-76013614 TTGAACCAATTCCGAAGAAACGG - Intergenic
910357318 1:86375095-86375117 TAGAACTACTTCAAAAGAAATGG + Intronic
910469389 1:87535251-87535273 TTGAAACAAAACCAAAAAAAGGG - Intergenic
910981879 1:92966121-92966143 TTGAACCAAATGAGAAGAAATGG + Intergenic
911349292 1:96733372-96733394 TTTAACCTATTCTCAAGAAAGGG + Intronic
914709935 1:150203882-150203904 TTGAAACAATTTAAATGAAAAGG - Intergenic
916619752 1:166484047-166484069 TTGCACCAATTTCAAGAAAAGGG - Intergenic
917632250 1:176901963-176901985 TTGAACAATTACCAAAGAACAGG - Intronic
918018585 1:180663106-180663128 AGGAACCAATTCCAGAGAAATGG - Intronic
920796871 1:209146627-209146649 TAGACCCAATTTCAAACAAAAGG - Intergenic
921053037 1:211524695-211524717 TTGACCCAATTCCCAGGGAATGG - Intergenic
921078850 1:211722667-211722689 TTCAACCAATTCCAAACAGGAGG - Intergenic
922174018 1:223180919-223180941 TTAAAACAAGTCCAGAGAAAGGG + Intergenic
923720606 1:236463832-236463854 TTGTCCCATCTCCAAAGAAATGG + Intronic
923927502 1:238649753-238649775 TTCAACCAATTTCAAATAATTGG + Intergenic
924226418 1:241925768-241925790 TTAAACAAAATCAAAAGAAAAGG - Intergenic
924228841 1:241946223-241946245 TTGAAGCACTTCTAAAGAAATGG - Intergenic
1064630669 10:17307636-17307658 TGGAACCAATCACAAAGAACGGG + Intergenic
1064664188 10:17632813-17632835 TGGAAACAAATACAAAGAAAGGG + Intergenic
1065228191 10:23568982-23569004 TTAATCAAATTCCAAAGGAAGGG - Intergenic
1066571635 10:36779791-36779813 ATAAACCATTTCCAAAGAAGAGG + Intergenic
1075681218 10:124333872-124333894 ATGTAACAATTCCTAAGAAAAGG + Intergenic
1076906360 10:133363896-133363918 TTGAGCCTATTCCAAATAATTGG + Intronic
1077208917 11:1359174-1359196 TTGGAACAACCCCAAAGAAAAGG - Intergenic
1078795342 11:14586678-14586700 TTATACCAATTCCTAAAAAAAGG - Intronic
1079222198 11:18573033-18573055 TTGATATAATTCCAAAGCAAAGG + Intronic
1079411935 11:20196254-20196276 TTAAACCAATTCCCTAGAATTGG - Intergenic
1081847303 11:46249996-46250018 TGGAACCAATTCCCAAGATTTGG - Intergenic
1083261544 11:61525783-61525805 ATGAATCAATGCCAATGAAATGG + Intronic
1087046984 11:93850643-93850665 TTGAACCAGTTCCCAAGGATGGG + Intergenic
1087267142 11:96072956-96072978 TTGAGCCAAATCCTAAGAGAAGG - Intronic
1087474105 11:98616083-98616105 TTTAACTAATACCAAAGGAAAGG + Intergenic
1089853859 11:121523524-121523546 TTATACCAATTCCTAAGACAGGG + Intronic
1091159261 11:133405030-133405052 TTGAATGAATACAAAAGAAACGG - Intronic
1091995677 12:4991559-4991581 TTTAACCAAGGACAAAGAAATGG - Intergenic
1093476273 12:19558173-19558195 TTGAAGCAATTCATAATAAAAGG - Intronic
1094474555 12:30831388-30831410 TTAACCCAATTTCATAGAAAGGG - Intergenic
1094773375 12:33692411-33692433 TTGAACCAAGTAAAAAGAATGGG - Intergenic
1098039380 12:66338766-66338788 TTGAAGCAGTGGCAAAGAAAAGG + Exonic
1098739457 12:74153899-74153921 TTGAGCTATTTCTAAAGAAAAGG + Intergenic
1099819065 12:87686420-87686442 TTGAAACAACTCAAATGAAAAGG + Intergenic
1099822175 12:87726348-87726370 TAGATGCAATTCCAAAGGAATGG + Intergenic
1100914351 12:99402069-99402091 GTGAAACAATTCCATAGAACAGG - Intronic
1101717408 12:107322359-107322381 TTTAAACAAGCCCAAAGAAAAGG - Intronic
1102265241 12:111478440-111478462 TTGAACCATTTACTAAAAAAAGG + Intronic
1104276287 12:127331272-127331294 TTGATCCAGACCCAAAGAAAGGG - Intergenic
1106777559 13:33023473-33023495 TTGAAATAATTTCAAAGAAGAGG - Intronic
1107774828 13:43827441-43827463 TTTAACCTATTCTAAACAAAAGG + Intronic
1108317054 13:49247359-49247381 CTGAACAAATTTCAAAGAACTGG + Intergenic
1109936407 13:69291373-69291395 TTGGAACAATTCTAAAGGAAGGG + Intergenic
1109992794 13:70081180-70081202 TTGAAGCAGTTCCCAAGACATGG - Intronic
1110088580 13:71414504-71414526 TTCAAACTATTCCAAAAAAATGG - Intergenic
1110280104 13:73683208-73683230 CTGAACAAATTACAAAGAAATGG + Intergenic
1110444288 13:75560356-75560378 TAAATTCAATTCCAAAGAAATGG + Intronic
1110717231 13:78720206-78720228 CAGAAGCAATTCAAAAGAAAGGG - Intergenic
1111749132 13:92305454-92305476 TTGATCCAATTTAAAAAAAAGGG - Intronic
1112524992 13:100136640-100136662 ATGAACCAATTCCTCAAAAATGG - Intronic
1113203910 13:107894852-107894874 TAGAACGACTGCCAAAGAAAGGG - Intergenic
1114673800 14:24428530-24428552 GTGAACAGATTCAAAAGAAATGG + Intronic
1116252645 14:42506455-42506477 ATGAACCAATCCCAAAGAAATGG + Intergenic
1116374644 14:44183488-44183510 TTCAACGAGTTCCAAAGAAAGGG + Intergenic
1116533573 14:46003352-46003374 TAGAACCCATTGCAAAAAAATGG - Intergenic
1116968599 14:51041281-51041303 TGCAATCATTTCCAAAGAAAAGG + Intronic
1118682633 14:68259193-68259215 TTGAACGAAATGCAAAGCAAGGG + Intronic
1118860823 14:69661603-69661625 TAGAAGCTACTCCAAAGAAAGGG - Intronic
1120523679 14:85553104-85553126 CTTAACCAAATCAAAAGAAAAGG - Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1123471164 15:20553480-20553502 CTCAACAAATTCCAAAGAAGCGG + Intergenic
1123646895 15:22447221-22447243 CTCAACAAATTCCAAAGAAGCGG - Intergenic
1123731464 15:23148474-23148496 CTCAACAAATTCCAAAGAAGCGG + Intergenic
1123749602 15:23345886-23345908 CTCAACAAATTCCAAAGAAGCGG + Intergenic
1124281975 15:28369761-28369783 CTCAACAAATTCCAAAGAAGCGG + Intergenic
1124300727 15:28541838-28541860 CTCAACAAATTCCAAAGAAGCGG - Intergenic
1125025201 15:35022707-35022729 ATGAACAAATTACAAACAAAGGG - Intergenic
1126152363 15:45534822-45534844 TTGAAAAAATTCCTTAGAAATGG - Intergenic
1126828789 15:52578184-52578206 TTGAATAAATTAAAAAGAAAGGG + Intergenic
1127483174 15:59395874-59395896 TTCCCCCAAATCCAAAGAAAGGG + Intronic
1127546579 15:59998998-59999020 GCAAACCAATTCCAAAGAGAAGG + Intergenic
1127839474 15:62818597-62818619 TTGAACTAATTCAAAAGAGAGGG + Intronic
1129143250 15:73622277-73622299 TTGAACCCATTAGAAAGAAAAGG + Intronic
1130096347 15:80859080-80859102 TTGACCCAAGTCAAAAAAAAGGG - Intronic
1130832307 15:87613865-87613887 TTAAACCAAGTCAAAAGAAGGGG - Intergenic
1134055285 16:11166202-11166224 TTGAAGCTATTTCAAGGAAAAGG - Intronic
1135090862 16:19515448-19515470 ATGCACAAATTCCAGAGAAATGG + Intronic
1138032197 16:53568518-53568540 TTGAACCTATGCAAAAAAAATGG - Intergenic
1138851820 16:60638604-60638626 TTGAGGCAAGTCCAAAGAACTGG + Intergenic
1140033220 16:71354661-71354683 TTTGACCCATTCCAAAGATAGGG - Intergenic
1140816938 16:78629793-78629815 TTGAACTCATTCCAAAAAAGTGG + Intronic
1140909698 16:79440084-79440106 TTGAACCATGTCCAAAGGGAAGG - Intergenic
1141795703 16:86272302-86272324 TTGACCCAGTTGCAAAGCAAGGG + Intergenic
1144067008 17:11633639-11633661 TTGAACCAATTCCAAAGAAAGGG + Intronic
1149331467 17:55587164-55587186 ATCAACCAAATCTAAAGAAAAGG - Intergenic
1150003034 17:61453098-61453120 GTGAACAATTACCAAAGAAAGGG + Intronic
1151916189 17:77119863-77119885 CTGAACCAATGCCACAGAAAAGG + Intronic
1203197251 17_KI270729v1_random:243515-243537 TAGAATGAATTCGAAAGAAATGG + Intergenic
1203206857 17_KI270730v1_random:44286-44308 TAGAATGAATTCGAAAGAAATGG + Intergenic
1153530326 18:6039485-6039507 TTAAACCAATGCAAATGAAAGGG + Intronic
1153673455 18:7434768-7434790 TTGAACAAATGGCAAAAAAATGG + Intergenic
1154969575 18:21393955-21393977 CTGAAAGAATTCCAAAGAAAAGG + Intronic
1157024746 18:43829403-43829425 TTGAACAATTACAAAAGAAAAGG + Intergenic
1158424549 18:57327334-57327356 TAAAACCTATTCCAAAGCAATGG + Intergenic
1158914587 18:62109994-62110016 TTGAAACACTTCCAAACCAATGG + Intronic
1158985491 18:62811767-62811789 TTAAACCCATTCCAAATAGATGG - Intronic
1159858893 18:73622555-73622577 CTGAAACGATTCCAAAAAAATGG + Intergenic
925165611 2:1713851-1713873 TTTAAGCAATACCAAAAAAATGG - Intronic
925408313 2:3623809-3623831 GTAAACCAATCCCAAAGAAATGG - Intronic
926026070 2:9545734-9545756 TTGTAACACTTCCAAAGACAGGG + Intronic
926227809 2:10980912-10980934 TTGAACCAAATCTCAGGAAATGG + Intergenic
928798025 2:35048292-35048314 TCTAAACATTTCCAAAGAAATGG + Intergenic
928816658 2:35304006-35304028 TTCAACAAATTCCAAACAAGTGG + Intergenic
930271861 2:49266482-49266504 TTGAACCAATTTATAACAAAAGG - Intergenic
930606747 2:53500959-53500981 TTTAAACAGTTCCAAAAAAATGG - Intergenic
931012621 2:57935073-57935095 CACAACCAAGTCCAAAGAAATGG - Intronic
931039305 2:58279286-58279308 TTGAAAGACTTCCAAAGAAAGGG - Intergenic
931658036 2:64527909-64527931 TTAGACCTATTCCCAAGAAAAGG + Intronic
933219553 2:79672421-79672443 TAGAACCGATTACAAAAAAAGGG - Intronic
935285302 2:101559181-101559203 TAGAACCAGTTCCAAAGTCATGG - Intergenic
935764811 2:106355886-106355908 TTGAAACAATTCCAAGGAACTGG - Intergenic
936723558 2:115284327-115284349 TTAAACCAGTTCAACAGAAAGGG + Intronic
937799531 2:126065448-126065470 TTGAAAGAATTCCACAGATAAGG - Intergenic
938959240 2:136326352-136326374 AAACACCAATTCCAAAGAAATGG - Intergenic
939725195 2:145711349-145711371 TGTAACCAATCTCAAAGAAATGG - Intergenic
939980925 2:148779863-148779885 GTGCACCAATTCAAAAGAAATGG - Intronic
939991607 2:148881227-148881249 GTGAACAAATGCCTAAGAAATGG - Intronic
941535073 2:166712196-166712218 TTAAACCAAATACAAACAAATGG - Intergenic
941835628 2:170016207-170016229 TTGAATTGATTCCAAAGCAAAGG + Intronic
943964190 2:194310665-194310687 TTAAACCAATTATAATGAAAAGG - Intergenic
945576822 2:211541517-211541539 TTTAACCATTGCTAAAGAAAAGG - Intronic
945838053 2:214855893-214855915 TTGCAGCAATTGCAAAGAACAGG + Intergenic
946883563 2:224200646-224200668 TTGAATCAATTCCAAAAACCAGG - Intergenic
946996979 2:225404427-225404449 TGGAAACAATTGTAAAGAAATGG + Intronic
1169436676 20:5599014-5599036 TAGAACCAAAGCCAGAGAAAAGG + Intronic
1169948712 20:11017987-11018009 TTGAAACAATTCAAGAGATAGGG + Intergenic
1170037081 20:12001034-12001056 TTTACCCAACACCAAAGAAATGG - Intergenic
1170218942 20:13920685-13920707 TTGAAGCCATTTCAAAGGAAAGG + Intronic
1170390860 20:15872561-15872583 ATGGACCAATTCCAAATATAAGG + Intronic
1170795601 20:19544228-19544250 TAAAAGCAATTCCAAAGAACAGG + Intronic
1171481480 20:25458679-25458701 CTGTCCGAATTCCAAAGAAATGG - Intronic
1172455185 20:35065876-35065898 ATGAAACAATTCAAAAGTAAAGG + Intronic
1172695437 20:36819505-36819527 TTGACCAAATTCCAAAGAGTTGG + Intronic
1173586846 20:44188818-44188840 TGGAACCAAGTCCTAAGAACAGG - Intergenic
1175233825 20:57494525-57494547 TTGAACCATTTCCAAGGCATGGG - Intergenic
1175625348 20:60484633-60484655 TTAAGAGAATTCCAAAGAAAAGG - Intergenic
1177708965 21:24745760-24745782 TTAAACTAATTCCACAGAAATGG - Intergenic
1177712666 21:24799369-24799391 TTGGAAAAATTCCAAAGGAAAGG + Intergenic
1177892409 21:26822434-26822456 ATAAACTAATTCCAAATAAATGG - Intergenic
1178222581 21:30676906-30676928 TTTAACCAATTAAAAAGTAAAGG + Intergenic
1178390957 21:32197873-32197895 TGCATCTAATTCCAAAGAAATGG + Intergenic
1178481374 21:32982285-32982307 TTGAATAAATTCCTAAGAAATGG + Intergenic
1180720150 22:17901982-17902004 GTGAACCAAAACCAAATAAATGG + Intronic
1183787798 22:40041005-40041027 TTGGACAAATTCCAAGGCAATGG - Exonic
1185237143 22:49720619-49720641 TTGGAGCAATTCCAAAGCACAGG + Intergenic
951310421 3:21118733-21118755 GTGCACCAATTGAAAAGAAAAGG + Intergenic
951754525 3:26075694-26075716 TTGAGCCTATTCAAAAGGAAAGG - Intergenic
952579810 3:34819650-34819672 TTCAACAAATTTAAAAGAAATGG - Intergenic
953304466 3:41814399-41814421 CTCAACAAATTCCAAAGAAGTGG - Intronic
955795459 3:62632089-62632111 TTGCATCAATTCCTAGGAAATGG - Intronic
956791611 3:72684382-72684404 TTAAACCAATTCCCACCAAAAGG + Intergenic
957216825 3:77330941-77330963 TTCATCCATTTTCAAAGAAAAGG + Intronic
957318391 3:78597393-78597415 TTGAAAAAGTTCCATAGAAAAGG - Exonic
957482567 3:80817131-80817153 CTGAACCTATTCCAAAAAAATGG + Intergenic
959235875 3:103721189-103721211 GGTAACCAATCCCAAAGAAATGG - Intergenic
959767703 3:110052118-110052140 TTCAACCAATGCCTTAGAAATGG + Intergenic
959995299 3:112674241-112674263 AAGAAACAATTCCAGAGAAAAGG - Intergenic
960201902 3:114847262-114847284 ATGAACCAATTCTAAAGGTAAGG - Intronic
960456228 3:117875818-117875840 AAACACCAATTCCAAAGAAATGG - Intergenic
961593528 3:127998630-127998652 TTGAACAAGCTCCAAAGTAAAGG + Intergenic
963278048 3:143352427-143352449 TTCAAGGAATTCCAAGGAAATGG + Intronic
963959779 3:151296539-151296561 TTGAAGAAAGTTCAAAGAAAAGG - Intronic
965782158 3:172297306-172297328 TTGAAACTATTCCAAATAAAAGG - Intronic
965828303 3:172752548-172752570 CTCAACCATTTCCAATGAAAAGG - Intronic
965895396 3:173569832-173569854 TAGAATACATTCCAAAGAAATGG - Intronic
967559402 3:190900952-190900974 TGGAACCAAGACAAAAGAAAGGG - Intergenic
970066333 4:12098198-12098220 TTGAAATTATTGCAAAGAAATGG - Intergenic
970696115 4:18679132-18679154 TTGGATAAATTCCAAAGCAAGGG - Intergenic
970937268 4:21587987-21588009 TTAAGACAATACCAAAGAAAGGG - Intronic
972818627 4:42673493-42673515 TCCAACTGATTCCAAAGAAAAGG - Intergenic
972918578 4:43909089-43909111 TTGAACATTTTCCAATGAAAAGG + Intergenic
973083797 4:46029158-46029180 ATGAAACAATTCCAAAAAAGTGG + Intergenic
974221917 4:58986096-58986118 TTAAAAAAATTCCAAAGAAGTGG - Intergenic
975662894 4:76705119-76705141 TTCAGCCAATACAAAAGAAAGGG - Intronic
977060435 4:92252572-92252594 TTGAAACTATTCCAAACAATTGG - Intergenic
977207750 4:94182477-94182499 TTGAACCCATTCAAATCAAAAGG + Intergenic
978333595 4:107642679-107642701 TTGAACCAGTTTCACTGAAATGG - Intronic
979263623 4:118675818-118675840 AAGAACCAAATCCATAGAAAGGG + Intergenic
979495125 4:121374857-121374879 TAAAAGCAATTCCAAAAAAAAGG - Intronic
979684345 4:123495215-123495237 TTGTACCAACTACAAAGCAAAGG + Intergenic
980524269 4:133969203-133969225 ATGAACTAATTCCAGGGAAATGG + Intergenic
981792175 4:148550760-148550782 TAAAACCATTTCAAAAGAAAAGG - Intergenic
982224350 4:153152555-153152577 TTGGACCATTTCCAAAGCACGGG - Intronic
982393146 4:154887522-154887544 GTAAACAAATTCCATAGAAAAGG - Intergenic
983102790 4:163645509-163645531 AGCAACCAAGTCCAAAGAAATGG + Intronic
988697451 5:33637175-33637197 TTGAAGTAATTGCAAAAAAAAGG - Intronic
989051112 5:37321377-37321399 TTTAACTAATTCCAATAAAATGG + Intronic
989572520 5:42957873-42957895 TTGACCAAATTCCACAGAGAGGG + Intergenic
990858762 5:60302212-60302234 CTGAAACTATTCCAAAAAAAAGG - Intronic
991662203 5:68961783-68961805 TTGAACAAACTTCAAGGAAATGG - Intergenic
996972866 5:129394464-129394486 TTGTACTAACTCCAAAGGAATGG - Intergenic
997032120 5:130142643-130142665 TAGAAACAATTGCAAAGGAAAGG - Intronic
998550469 5:143072399-143072421 TGGAAACTATTCCAAAGGAAAGG + Intronic
999685322 5:154097570-154097592 TTGTAACAATGCCAGAGAAACGG - Intronic
1000043253 5:157500910-157500932 TTGACCCCATTCCACAGACAGGG + Intronic
1001235779 5:170028125-170028147 TTCTATCAGTTCCAAAGAAATGG - Intronic
1003491859 6:6629369-6629391 ATGATTCTATTCCAAAGAAATGG + Intronic
1006740450 6:36304295-36304317 GTAAACCTGTTCCAAAGAAAGGG - Intronic
1007128491 6:39447725-39447747 TTGAAGCATTTCCAAGAAAAGGG - Intronic
1007348536 6:41251418-41251440 TTAAACTCATTCCAAATAAATGG - Intergenic
1007499156 6:42282075-42282097 TTTAACCAACTCCCTAGAAAGGG - Intronic
1007504438 6:42324022-42324044 TTGAACCAACATCAAAGAGAAGG + Intronic
1008204817 6:48641854-48641876 TTGAACCAATTGCTATAAAATGG + Intergenic
1008313133 6:50003286-50003308 ATGTATCCATTCCAAAGAAAGGG + Intergenic
1009270827 6:61611372-61611394 TGGAGCCATTTGCAAAGAAAAGG + Intergenic
1009335334 6:62481991-62482013 GTGAACAAATTCCAAAGAACAGG - Intergenic
1009649477 6:66456009-66456031 TTTAAACAATTCCAAAAATAAGG - Intergenic
1010077828 6:71821291-71821313 TTGAATCAACTCCTATGAAAAGG + Intergenic
1010114358 6:72284620-72284642 TTGGACAAATTGCAAACAAAAGG - Intronic
1010747880 6:79584635-79584657 TTGAACCAATTACACATAGAGGG + Intergenic
1010972355 6:82276372-82276394 TTAAACCAAATCAAATGAAATGG - Intergenic
1011078724 6:83466282-83466304 TTGGTGCAATTCCAAATAAAAGG + Intergenic
1012576991 6:100814486-100814508 TTGAAACCATTCCAAGAAAATGG - Intronic
1012761458 6:103308393-103308415 TAGAACCAATTCAGAAAAAAAGG - Intergenic
1012826678 6:104154821-104154843 TTTAACATATTTCAAAGAAAAGG - Intergenic
1014048008 6:116915938-116915960 TTGAACAAATTAACAAGAAAAGG + Intronic
1014153204 6:118082784-118082806 CTTAAGCAAATCCAAAGAAATGG + Intronic
1014220305 6:118792743-118792765 ATGAACCCATTTTAAAGAAAGGG - Intergenic
1014967679 6:127776056-127776078 TTGAACAAATGCCAAATAACGGG + Intronic
1014977039 6:127900547-127900569 TACAACCAATTTCAAAGCAAAGG + Intronic
1015658696 6:135548431-135548453 TTGAATCAATTCATTAGAAATGG + Intergenic
1017552844 6:155528159-155528181 TCGAACCACTTCTACAGAAAGGG - Intergenic
1023637151 7:42223683-42223705 TTGAACAAATTCCAAAGGGAGGG + Intronic
1023702550 7:42906645-42906667 CTGAATAAATTCCAAACAAAAGG - Intergenic
1024575922 7:50764097-50764119 TTGAAAAAATTCCAAATACAAGG - Intronic
1028244290 7:88457703-88457725 CTGAAGGAATTCCAAACAAATGG + Intergenic
1028456444 7:91043013-91043035 CTGAACCATTTACACAGAAAAGG - Intronic
1028554605 7:92108688-92108710 GTGAAAGAATTTCAAAGAAAGGG - Intronic
1028637548 7:93006384-93006406 TTGAACCAAATACCAAGTAAGGG - Intergenic
1029148709 7:98465151-98465173 ATGAACCAGGTTCAAAGAAATGG - Intergenic
1032782970 7:135178899-135178921 TGGAGCCATTTACAAAGAAAGGG + Intergenic
1034716053 7:153243283-153243305 CTGAAGCAAATACAAAGAAAAGG - Intergenic
1036171520 8:6490011-6490033 TTGATCCAAGTTAAAAGAAAAGG - Intronic
1036956935 8:13198314-13198336 TGGTACCAATTCAAAACAAATGG - Intronic
1037406514 8:18548319-18548341 AGTAACCAATTTCAAAGAAATGG - Intronic
1041963003 8:63641185-63641207 TTGCAAAAATTCCAAAGATATGG - Intergenic
1043100352 8:76037615-76037637 TTGAACCATTTTCAAAACAAAGG - Intergenic
1043749422 8:83916830-83916852 TTGCTCCATTTCCATAGAAATGG + Intergenic
1045426483 8:102071300-102071322 GTGAACCAATACCAAGAAAAAGG - Intronic
1046084839 8:109419865-109419887 TGAAAGCAGTTCCAAAGAAAAGG - Intronic
1047585143 8:126263282-126263304 TTGAATCAAATCCAAAGAGATGG - Intergenic
1047816043 8:128463886-128463908 TGGAACCACTTCCAGAGCAAAGG + Intergenic
1047874096 8:129116104-129116126 TTGAGCAAATTTCAAAGAAAAGG - Intergenic
1048428990 8:134350802-134350824 TGGAATCATTTCAAAAGAAATGG + Intergenic
1051561525 9:18446821-18446843 TTGGACCATATCCAAAGAGAAGG + Intergenic
1051570519 9:18552448-18552470 CTCAACAAATTCCAAAGAAATGG - Intronic
1051911353 9:22155732-22155754 TTGATCAAGTTCCAAGGAAAAGG + Intergenic
1051998721 9:23250364-23250386 CTGAAACAATTCCAAACAATAGG + Intergenic
1052643621 9:31202619-31202641 TTTAACCATTTACTAAGAAAAGG - Intergenic
1052696508 9:31885702-31885724 TTGAAACTATTCCAAATAATAGG - Intergenic
1053555253 9:39131123-39131145 TTTAAACAATTCCAAAGCCAAGG + Intronic
1054109639 9:61095027-61095049 TTTAAACAATTCCAAAGCCAAGG + Intergenic
1054611218 9:67236098-67236120 TTTAAACAATTCCAAAGCCAAGG - Intergenic
1055492607 9:76821058-76821080 TTAAACAAATTCAAAAGCAACGG + Intronic
1058672362 9:107370647-107370669 TTGAACAAATAACAAAAAAATGG - Intergenic
1060461748 9:123862198-123862220 TGAAACCCATCCCAAAGAAATGG - Intronic
1062545599 9:137062426-137062448 TTGATCAAGTTCCAAGGAAAAGG - Exonic
1062560806 9:137141048-137141070 TTGAAGCAATTCCCCAGGAATGG - Intronic
1203725260 Un_GL000216v2:44474-44496 TTGAATCAACTCAAAAGGAATGG - Intergenic
1186757738 X:12690648-12690670 TTGAAACCATTAAAAAGAAATGG + Intronic
1186893911 X:13987370-13987392 TAGACCCAATGCCACAGAAAAGG - Intergenic
1187795364 X:22998468-22998490 ATGAACCATTTCCAAAGGAGAGG + Intergenic
1189087697 X:38044182-38044204 TTCAACAAATTTCAAAGAAATGG + Intronic
1189843648 X:45109882-45109904 TTGCACCAAATCCAAAGACATGG - Intronic
1190757798 X:53415887-53415909 TAGAACCCAATCTAAAGAAATGG + Intronic
1191767679 X:64716782-64716804 TTCAAACAATTTCAAAAAAATGG + Intergenic
1193023481 X:76818449-76818471 TTTAACAAATTCTAAATAAATGG - Intergenic
1193642026 X:84021035-84021057 TTTAATCAAATCCAAAGGAAAGG - Intergenic
1194758078 X:97761484-97761506 TTGAAACAATTTAAAAGAGAAGG + Intergenic
1195270991 X:103230929-103230951 TAGAACTAGTTCCAAAGAACAGG - Intergenic
1195842413 X:109188640-109188662 TTTCACCAATTCCAAATTAATGG - Intergenic
1197366505 X:125570307-125570329 CTGAAACTATTCCAAAAAAATGG + Intergenic
1197433761 X:126400036-126400058 AATAACCAATCCCAAAGAAATGG - Intergenic
1200788139 Y:7276441-7276463 TTTAACCAACAACAAAGAAAGGG - Intergenic
1200904642 Y:8469325-8469347 TTGAACCGTTTCCACAGAAAAGG + Intergenic
1202600060 Y:26584598-26584620 TTGAAACTATTCCAAAGAACAGG - Intergenic