ID: 1144067330

View in Genome Browser
Species Human (GRCh38)
Location 17:11636360-11636382
Sequence CTGGATAAACCAATAAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 264}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144067330_1144067333 1 Left 1144067330 17:11636360-11636382 CCTTTGTTTATTGGTTTATCCAG 0: 1
1: 0
2: 2
3: 16
4: 264
Right 1144067333 17:11636384-11636406 TTCTTATGCCAAGTAGAGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 117
1144067330_1144067332 0 Left 1144067330 17:11636360-11636382 CCTTTGTTTATTGGTTTATCCAG 0: 1
1: 0
2: 2
3: 16
4: 264
Right 1144067332 17:11636383-11636405 ATTCTTATGCCAAGTAGAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 83
1144067330_1144067335 3 Left 1144067330 17:11636360-11636382 CCTTTGTTTATTGGTTTATCCAG 0: 1
1: 0
2: 2
3: 16
4: 264
Right 1144067335 17:11636386-11636408 CTTATGCCAAGTAGAGCTGGGGG 0: 1
1: 0
2: 1
3: 7
4: 119
1144067330_1144067334 2 Left 1144067330 17:11636360-11636382 CCTTTGTTTATTGGTTTATCCAG 0: 1
1: 0
2: 2
3: 16
4: 264
Right 1144067334 17:11636385-11636407 TCTTATGCCAAGTAGAGCTGGGG 0: 1
1: 0
2: 1
3: 6
4: 106
1144067330_1144067337 15 Left 1144067330 17:11636360-11636382 CCTTTGTTTATTGGTTTATCCAG 0: 1
1: 0
2: 2
3: 16
4: 264
Right 1144067337 17:11636398-11636420 AGAGCTGGGGGTGAGTAACTCGG 0: 1
1: 0
2: 2
3: 44
4: 234
1144067330_1144067338 23 Left 1144067330 17:11636360-11636382 CCTTTGTTTATTGGTTTATCCAG 0: 1
1: 0
2: 2
3: 16
4: 264
Right 1144067338 17:11636406-11636428 GGGTGAGTAACTCGGCAGACAGG 0: 1
1: 0
2: 0
3: 1
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144067330 Original CRISPR CTGGATAAACCAATAAACAA AGG (reversed) Intronic
900696385 1:4013856-4013878 CTGGAAAGACCAATAAAAATGGG + Intergenic
900754350 1:4423335-4423357 CAGGATAAACCTATAAAGGAGGG - Intergenic
904342706 1:29847589-29847611 TTGAATAAACCAATAAACTGAGG - Intergenic
908780174 1:67684013-67684035 TTGCATAAACCATAAAACAAAGG + Intergenic
908855249 1:68419541-68419563 CTGAAGAATGCAATAAACAAGGG - Intergenic
910979619 1:92946637-92946659 CTTGATAAATCAAGAAACAGAGG + Intronic
912159177 1:106960191-106960213 CTGGCCAAACAACTAAACAATGG + Intergenic
915698114 1:157765259-157765281 CTGAATAAACCAATAATGAGTGG + Intronic
916532297 1:165668714-165668736 CTGGATAAACTAATACATATGGG + Intronic
916585501 1:166146411-166146433 CTTGATAAAATAATAAATAAGGG + Intronic
918201446 1:182271023-182271045 CTGAATAAATAAATAAATAAGGG + Intergenic
918721794 1:187861760-187861782 CTGGAGAAACCTAAAAAAAAAGG - Intergenic
918801916 1:188983453-188983475 CTGGCTAGACTAATAAAGAAGGG - Intergenic
919311158 1:195911479-195911501 CTGGGTAAACACAAAAACAAAGG - Intergenic
921839388 1:219812214-219812236 CTGTATAAACGAATAAAGGAAGG + Intronic
923236966 1:232043365-232043387 GTGAATAAATAAATAAACAATGG - Intergenic
923929099 1:238673274-238673296 CTTGAGAAAACAATAAACCATGG - Intergenic
924162734 1:241250783-241250805 CTGTATAAACCAAGAAATATTGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1063774402 10:9244733-9244755 CAGCCTAAAACAATAAACAATGG + Intergenic
1064835010 10:19516924-19516946 CTGCCTAAACCAAGAAAGAACGG + Intronic
1065067013 10:21979634-21979656 CTGGATAAAGTAAGAAATAATGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1068835777 10:61551814-61551836 CTGTAAAAATCAAGAAACAATGG - Intergenic
1069215774 10:65817988-65818010 CAAGATAATTCAATAAACAAAGG - Intergenic
1071004764 10:80870162-80870184 CTGGAAGAGCCAATACACAATGG + Intergenic
1074427418 10:113363976-113363998 CTGGTTGATCCAATCAACAAGGG - Intergenic
1075154076 10:119959477-119959499 CTAAATAAACAAACAAACAAAGG - Intergenic
1077481951 11:2819094-2819116 ATGAATGAACCAATGAACAAAGG - Intronic
1077680180 11:4232733-4232755 CTGGACAAAACTATATACAATGG + Intergenic
1077685582 11:4288616-4288638 CTGGACAAAACTATATACAATGG - Intergenic
1077814969 11:5678009-5678031 CTGGATAAATTAATAAAAATGGG + Intronic
1079906587 11:26255725-26255747 ATGTATAAACAAATAAATAATGG - Intergenic
1080571042 11:33557583-33557605 CTGGATTAAACAATTAAAAAGGG + Intronic
1080845051 11:36019736-36019758 CTGGATACAGAAAGAAACAAAGG + Intronic
1081476414 11:43436949-43436971 CTGGATAACCCAACAAATAAAGG - Intronic
1081781367 11:45715418-45715440 CTGGATCACCCAAAAAAAAATGG + Intergenic
1084623870 11:70293264-70293286 CTGGAAAAAGCAATGAAGAAGGG - Intronic
1084920516 11:72465693-72465715 CTGGAGAAACCCATAGAAAAAGG - Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086744956 11:90413317-90413339 CTGGAAAAATCAATCAAAAATGG + Intergenic
1087586698 11:100130923-100130945 AAGGAAATACCAATAAACAATGG + Intronic
1088129741 11:106472952-106472974 ATGAATAAACCAACAAACAAAGG + Intergenic
1089328152 11:117671523-117671545 CAGGATAAGCCAATTACCAAAGG + Intronic
1090148070 11:124349306-124349328 CTGAAGAAACCACCAAACAATGG + Intergenic
1093328671 12:17809811-17809833 CTGAATAAACTAATAAAGAAGGG + Intergenic
1098424271 12:70341512-70341534 CAGAATAAATAAATAAACAATGG - Intronic
1098600021 12:72319736-72319758 ATGAATAAAAAAATAAACAATGG - Intronic
1099290232 12:80767847-80767869 CTGGATAGGCCAATAAATAGAGG - Intergenic
1099690310 12:85943610-85943632 CTGCATAAACCAAGAATGAAAGG + Intergenic
1103113371 12:118302700-118302722 TTGGATAAATGAATAAAAAATGG + Intronic
1106499155 13:30310446-30310468 CTGGTGAAAACAATAAACTATGG - Intergenic
1106579769 13:31007464-31007486 CTGGCTAACCCAATTAGCAAAGG - Intergenic
1107577651 13:41744551-41744573 CTGGCTAAAGCAATAAGGAATGG + Intronic
1108235998 13:48405791-48405813 AAAGATAAACCAAAAAACAAGGG - Intronic
1110009159 13:70309770-70309792 CTGGATAAAATAATCCACAAGGG + Intergenic
1110478130 13:75941824-75941846 CTGGATAAAGAAATAAACCCAGG - Intergenic
1111148694 13:84219011-84219033 CTGGGTCAACAAAGAAACAATGG + Intergenic
1111325207 13:86685299-86685321 TTGAATAAACAAATAAATAAAGG + Intergenic
1111703517 13:91719921-91719943 TTGGATAAAGCTATAAAGAAAGG + Intronic
1111944716 13:94652805-94652827 CTGCAAAAACCAAGAAACAATGG + Intergenic
1111982209 13:95028674-95028696 CGAGAAAAACCAAAAAACAAAGG + Intronic
1115492586 14:33972656-33972678 CTGGAGAACACAATATACAATGG + Intronic
1116202900 14:41822048-41822070 CTAGATTAACCAAGAAAAAAAGG - Intronic
1116560631 14:46374474-46374496 CTAGATAGACTAATAAAGAAAGG - Intergenic
1117275768 14:54191756-54191778 CTTAATAAATGAATAAACAAAGG - Intergenic
1118019796 14:61699071-61699093 CTGGAGAAACTCATAAGCAAAGG - Intronic
1119747358 14:77053706-77053728 CGGGATATAGCAATGAACAAAGG + Intergenic
1120138056 14:80893817-80893839 TTGGATAGACAAATAAACTAGGG + Intronic
1120253910 14:82093572-82093594 ATAGATAAACCAGTAAAGAAAGG - Intergenic
1121715775 14:96072702-96072724 CTGGATGATGCAAAAAACAATGG - Intronic
1122713172 14:103675779-103675801 CTGGAAAAACCAAAAAGCAGGGG + Intronic
1123166114 14:106326702-106326724 CTGGAGAAACCAATAAGAACTGG + Intergenic
1123168811 14:106351737-106351759 CTGGAGAAACCAATAAGAACTGG + Intergenic
1124001446 15:25763772-25763794 GTGGATCAATCAATAAGCAATGG + Intronic
1125326600 15:38541646-38541668 CTGGATAAATCACTAACCCACGG + Intronic
1125926868 15:43569987-43570009 CTGCATAAACCAGAAAAAAATGG + Intronic
1125940012 15:43669552-43669574 CTGCATAAACCAGAAAAAAATGG + Intergenic
1126214844 15:46143254-46143276 CTGGAAAAAGAAAGAAACAAAGG + Intergenic
1126381537 15:48052795-48052817 CTGGAGAAATAAAAAAACAATGG + Intergenic
1127279785 15:57479129-57479151 CTGGAAAAGGCAATAAACCAGGG - Intronic
1127362037 15:58252736-58252758 CTGGTTAGACCAATCCACAAGGG - Intronic
1128424640 15:67528755-67528777 GTGGAAAAACCAAGACACAAAGG - Exonic
1128597895 15:68968894-68968916 CTGGAAAAGTCACTAAACAATGG + Intronic
1128955030 15:71931910-71931932 CTGGAGACAACAAAAAACAAAGG - Intronic
1128955044 15:71932027-71932049 CTGGAGACAACAAAAAACAAAGG - Intronic
1130810522 15:87372805-87372827 CAGGAAAAACAAATAAATAAAGG - Intergenic
1131016857 15:89065071-89065093 CTGGATAAAAGAAAAAACATGGG + Intergenic
1131080731 15:89532526-89532548 CTGAATAAAATATTAAACAAGGG + Intergenic
1132997787 16:2832244-2832266 CTGAATCCACCAATAAATAAAGG + Exonic
1137449446 16:48557127-48557149 CTGGATAGGCAAATGAACAAAGG + Intronic
1141945179 16:87304736-87304758 ATGGATAACCCAAAAAACAGGGG + Intronic
1144067330 17:11636360-11636382 CTGGATAAACCAATAAACAAAGG - Intronic
1146410940 17:32584278-32584300 CTTGATAAGACAATAACCAATGG + Intronic
1148378518 17:47173529-47173551 TTGATTATACCAATAAACAATGG + Intronic
1149549270 17:57527876-57527898 CTGGGCAAAGCAATAAACCAAGG - Intronic
1150583133 17:66493521-66493543 ATGAATGAACCAACAAACAAAGG - Intronic
1151690297 17:75679965-75679987 GTGGAGAAAAAAATAAACAAGGG - Intronic
1151895896 17:76980760-76980782 CTGGAGAAACCACTAAACTCTGG - Intergenic
1152164844 17:78696313-78696335 CTGGATATACTAGTAAACATTGG - Intronic
1155327527 18:24680299-24680321 TTGGATAAACCAAATATCAAAGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156068006 18:33168520-33168542 TTGTATAAACAAATTAACAAAGG - Intronic
1156729332 18:40171513-40171535 AAAGATAAACCAATAAAAAAAGG - Intergenic
1157106681 18:44780593-44780615 CTGGATAAACGAATATATGAAGG - Intronic
1158071020 18:53470591-53470613 CTGGGTAATTCAAAAAACAAAGG + Intronic
1158156014 18:54426249-54426271 CTAGATAAACAAATAGTCAAGGG - Intergenic
1158197542 18:54905600-54905622 CTGGATTCACAAATATACAATGG - Intronic
1158353434 18:56589367-56589389 ATGAATAAATCAATAAACAGGGG + Intergenic
1158562798 18:58529641-58529663 CTGGATTATCCAAAAAACTACGG + Intronic
1158728830 18:60000935-60000957 CTGGATAAATAAGGAAACAAAGG - Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1162249994 19:9434427-9434449 CAGGATACACCAATAAATGAAGG + Intronic
1162362779 19:10229991-10230013 ATGAATGAACCAATGAACAAAGG + Intronic
1165332208 19:35146653-35146675 CTGGTTACATCAATAAATAAAGG + Intronic
1168580271 19:57549683-57549705 CTGGTGAAACCAATATAAAAGGG + Intronic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
925947286 2:8877570-8877592 CTGGATACGGCAGTAAACAAAGG + Intronic
926729301 2:16023557-16023579 GTTTATAAATCAATAAACAATGG - Intergenic
926998915 2:18771607-18771629 ATGGCTAAAACAATAAAGAAAGG + Intergenic
928867726 2:35937388-35937410 CTGGATAAAGTAATTAATAAAGG - Intergenic
930230954 2:48843382-48843404 CTGAATAAATGAATAATCAATGG - Intergenic
931826204 2:66003729-66003751 CTCAAGAAACCAATAAACACTGG + Intergenic
931900659 2:66784501-66784523 CAGGATAAGCTATTAAACAAAGG - Intergenic
933336983 2:80971078-80971100 CTAGATTAACAAATAAATAAAGG + Intergenic
933558617 2:83863760-83863782 CTGGTTAAACCCATAAAGACTGG - Intergenic
935448021 2:103176941-103176963 CAGGCTAAACCAATCAAGAAGGG + Intergenic
936265716 2:111004657-111004679 AAAAATAAACCAATAAACAATGG + Intronic
936723058 2:115276906-115276928 CTGGATCAACCTAGACACAAAGG - Intronic
937178493 2:119966911-119966933 CTGAATAAATCACTTAACAAAGG - Intronic
937529582 2:122811757-122811779 CAAGATTAACCAATAAACGAAGG + Intergenic
939464984 2:142545384-142545406 CTGGAAAAATAAATAAATAAAGG - Intergenic
939602756 2:144213761-144213783 CTTGTTAAAGCAAAAAACAATGG + Intronic
939682303 2:145153101-145153123 CTTGTTAAACCAATAAAAACAGG - Intergenic
941156477 2:161984839-161984861 CTGGCTAAATCATAAAACAATGG - Exonic
942137178 2:172937776-172937798 CAGAATAAACCAATCAACATGGG - Intronic
942764569 2:179439353-179439375 CTGGAAAAACGAACAAACGAAGG - Intergenic
943763813 2:191638638-191638660 ATGGATAACTCAAAAAACAAGGG + Intergenic
943974466 2:194455243-194455265 CTGGCTAAACCAAGAGACAGAGG - Intergenic
944991728 2:205245279-205245301 CTAGACAAAACAAGAAACAATGG - Intronic
945279925 2:208026348-208026370 CTGAATAAATGAATGAACAAAGG + Intergenic
945916017 2:215704697-215704719 CTGGATCAACCAAGATAAAAAGG + Intergenic
948254114 2:236553438-236553460 ATGGAAAAGCCAATAAAGAAAGG + Intergenic
1169159786 20:3367616-3367638 CAGGATAAAGCAAAAAACGAGGG + Intronic
1170484304 20:16800535-16800557 ATGGATACAACAATAATCAAGGG + Intergenic
1171181606 20:23094916-23094938 CTGGATCCCCCAATACACAAAGG + Intergenic
1171227035 20:23450586-23450608 CTTGCTAAAACAAAAAACAAAGG + Exonic
1172504601 20:35452323-35452345 CTGGGTAAATGAATAAATAAGGG + Intronic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1174505397 20:51014558-51014580 CTGAATAAACGAACAAATAAAGG - Intronic
1174643306 20:52063847-52063869 CTGAATAAATCAATAAATAGGGG + Intronic
1174931767 20:54823991-54824013 CTGAATCAACCAAGAAAAAAAGG + Intergenic
1175243488 20:57567062-57567084 CTGGAATATCCAATAAACACTGG - Exonic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1178169843 21:30027918-30027940 GTGTTTAAACCAACAAACAATGG - Intergenic
1178343409 21:31805110-31805132 CTGGATAGAAAAAGAAACAAAGG - Intergenic
1178769273 21:35487864-35487886 CTGGATAAGCACATAAATAAGGG - Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1181783442 22:25208958-25208980 CTAAATAAACAAACAAACAAAGG - Intergenic
1184118741 22:42437096-42437118 CTGGAAGAAACAAAAAACAAAGG + Intergenic
1184342337 22:43892784-43892806 CTGGATAAGCACACAAACAATGG + Intergenic
949691788 3:6648842-6648864 ATGGATGAACGAATGAACAACGG - Intergenic
951033625 3:17908980-17909002 GTAAATAAAGCAATAAACAATGG - Intronic
952638780 3:35566074-35566096 ATGGAAATTCCAATAAACAAAGG + Intergenic
952705633 3:36374933-36374955 CTGAATAAAACAATGACCAATGG + Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
957682189 3:83451275-83451297 CTGTATATGCAAATAAACAATGG + Intergenic
958773618 3:98455622-98455644 CATGATTAAGCAATAAACAAAGG - Intergenic
960324343 3:116276869-116276891 CTGAATGGACCAATTAACAAGGG + Intronic
963913658 3:150837976-150837998 CTGGATAAACAATGAAATAAAGG - Intergenic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
964742351 3:159980074-159980096 CTGTATAAAACAATAAAAATGGG + Intergenic
965816985 3:172647033-172647055 CTGAATAAAAGAATAAACAACGG + Intronic
966462450 3:180191963-180191985 CTTGATAAGCCAACAAACTATGG + Intergenic
967261235 3:187644575-187644597 CTGGCTAAAGCAATTAACAAAGG - Intergenic
970715709 4:18920050-18920072 ATAGGTAAACAAATAAACAAAGG + Intergenic
971539960 4:27803551-27803573 CTGAATAAACAAATAAATGATGG - Intergenic
971758556 4:30734755-30734777 CTTGTTGAACAAATAAACAAAGG + Intronic
972519214 4:39837982-39838004 CTAAATAAACCTATTAACAAGGG - Exonic
974973076 4:68854727-68854749 CTGAATAGACCCATAAAAAACGG - Intergenic
975686492 4:76921060-76921082 CTGTATAAAGCAAGAAATAAAGG - Intergenic
979776810 4:124599459-124599481 CTGTACAAACCCAAAAACAATGG - Intergenic
980192414 4:129541901-129541923 CTGTGTAAAGCAATAAATAATGG + Intergenic
981248894 4:142574785-142574807 CTGTATAAACAAACAAACAAAGG - Intronic
982432764 4:155341027-155341049 CTGAATGAACCAGTAAACACTGG + Intergenic
982571910 4:157060861-157060883 CTAAATAAATTAATAAACAATGG - Intergenic
982714070 4:158788405-158788427 CTGAATAAATCAATAAGCAAAGG + Intronic
982832164 4:160076041-160076063 CTGGATAAAGGAGTCAACAAAGG + Intergenic
983250836 4:165344783-165344805 ATAGATAATCCAAGAAACAAAGG - Intergenic
983529901 4:168799355-168799377 CTGGACAAAGCAAAGAACAAGGG - Intronic
983603493 4:169557630-169557652 CTGGTTAAAAAAAGAAACAAAGG + Intronic
985561398 5:588146-588168 CTGGATGAGCCAATCAGCAAGGG - Intergenic
986857964 5:11893465-11893487 ATGCATAAATCAATAAACAGTGG + Intronic
991912465 5:71575258-71575280 CTGGAAAAACAAATAGAAAAGGG + Intergenic
992541841 5:77773756-77773778 GTGGAAATATCAATAAACAAAGG + Intronic
995187277 5:109285289-109285311 CTAGATTAACCAATAAAAGAAGG + Intergenic
995692294 5:114841019-114841041 CTGAATAAACCAATTACAAATGG + Intergenic
996846767 5:127908050-127908072 TTGGATAAACCATTAAAGATTGG + Intergenic
1000430958 5:161152074-161152096 CTGGTTAAAGCAAGAAACTAGGG + Intergenic
1001288508 5:170440293-170440315 CTGAGCAAACCAATACACAAGGG + Intronic
1003363763 6:5453216-5453238 CTGGAGAAAACAAAAACCAAGGG + Intronic
1003553891 6:7123051-7123073 CTAGAGAAACCAACAAACCAGGG - Intronic
1003651989 6:7969240-7969262 CTGGATAAATGAATAAACAAAGG + Intronic
1004604570 6:17181886-17181908 ATGTAAAAACCAATAAACAAAGG - Intergenic
1005553732 6:26952084-26952106 CTAGATAAACAAAGAAAAAAAGG + Intergenic
1006733359 6:36253177-36253199 CTTCATAAACAAATAAATAAAGG + Intronic
1007062513 6:38954811-38954833 CTGAATAAACCAATAATCAAGGG + Intronic
1007409366 6:41653059-41653081 TTGGTTAAACAAATAAACAGAGG + Intronic
1008549749 6:52616913-52616935 CTGGATAAAGAAATAAATTAAGG + Intergenic
1010393675 6:75365703-75365725 CTGTATAAACAAAAAAAAAAAGG - Intronic
1011579747 6:88847389-88847411 CTGGACAAGCTAATAAACTAAGG + Intronic
1012216301 6:96589187-96589209 CAGGATAAACCAAAGACCAATGG - Intronic
1012600343 6:101089073-101089095 CTAGATTAACCAATAAAAAGAGG - Intergenic
1012910245 6:105109789-105109811 GTGTATAAAGCAATAAATAACGG + Intronic
1014792748 6:125693338-125693360 CTGGAGAAACCAAAATACCATGG - Intergenic
1015101862 6:129490959-129490981 CTGGAAAAAACAATAAGCCAGGG - Intronic
1015286900 6:131495992-131496014 CTGAATAGACCAATAACCAGTGG - Intergenic
1015916116 6:138218945-138218967 CTTAATAAATCAATAAAAAAAGG - Intronic
1017157910 6:151338955-151338977 CTGGATAAAGCAAGAATCAATGG - Intronic
1017452563 6:154567336-154567358 CTGAATCAACAAACAAACAAGGG + Intergenic
1018073980 6:160193190-160193212 CTGGTAGAGCCAATAAACAAAGG + Intronic
1018150852 6:160936961-160936983 CTGAATAGACCAATAACAAAAGG - Intergenic
1020723293 7:11776705-11776727 CTGGATAAACTGATAAAACATGG + Intronic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1022487854 7:30794226-30794248 CTGAATTAAACAAAAAACAAGGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024440781 7:49415030-49415052 GTGCATAGACCAAAAAACAAAGG + Intergenic
1025243097 7:57294374-57294396 ATGGTTTAAACAATAAACAAAGG + Intergenic
1026047004 7:66912897-66912919 ATGGATAAACAAACAAACATCGG - Intergenic
1026169906 7:67944828-67944850 ATGGTTTAAACAATAAACAAAGG - Intergenic
1026593206 7:71713609-71713631 CTGGAGAAATCAAGACACAAAGG - Intergenic
1026731392 7:72914685-72914707 CAGGAAACACCAATAAACACTGG - Intronic
1027112646 7:75453115-75453137 CAGGAAACACCAATAAACACTGG + Intronic
1027284891 7:76637720-76637742 CAGGAAACACCAATAAACACTGG + Intergenic
1027614509 7:80404724-80404746 CTGGAGAAACCATAAAGCAAAGG - Intronic
1027730600 7:81867319-81867341 ATGAAAAAACCAGTAAACAAGGG + Intergenic
1027893893 7:84015587-84015609 CTGGATAAAATAATACACTAAGG - Intronic
1028949936 7:96623105-96623127 CTGAATAAAACAAAAAGCAAAGG + Intronic
1029247979 7:99216339-99216361 CTTGAAGAACCAATGAACAAAGG - Intergenic
1030374322 7:108737626-108737648 ATGGAGAAACCAGTAAACAGTGG + Intergenic
1030709576 7:112734377-112734399 CTGGTAAAGCCAATACACAAAGG - Intergenic
1030994684 7:116345079-116345101 CTAGATAAACTAAGAAAAAAGGG - Intronic
1031038172 7:116810722-116810744 CTGGGTAAATCAGTAAAAAAGGG + Intergenic
1031906044 7:127460562-127460584 ATTGAAAAACCAATAAGCAATGG + Intergenic
1034921099 7:155082806-155082828 CTTGATAAATCAGTAACCAAAGG + Intronic
1043784684 8:84383827-84383849 CTGGATAAATAAATGAGCAAAGG + Intronic
1046100129 8:109604451-109604473 CTGGGTACAACAATAAACTAGGG - Intronic
1046489637 8:114933689-114933711 TTTGATAAACTAATAAACACAGG + Intergenic
1047364217 8:124197528-124197550 CTGAATAAATGAATGAACAAAGG + Intergenic
1047438578 8:124856771-124856793 CAGGCCAAACCAATAAATAAAGG - Intergenic
1048858325 8:138703106-138703128 CTGAATAAATCAATAAGCATAGG + Intronic
1050256439 9:3796918-3796940 CTGGATAAACCAAGTCACATGGG + Intergenic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051777126 9:20647214-20647236 CTGGATAAAACCAATAACAAGGG - Intergenic
1052372984 9:27686914-27686936 CAGGATAAAGCAATTAACACAGG + Intergenic
1052402203 9:28014559-28014581 CAGGATAAGACAATTAACAAAGG + Intronic
1052764110 9:32622808-32622830 ATGGATAAACAAATACACATTGG - Intergenic
1054706129 9:68463949-68463971 CTGGATAAACCAATCATAAAGGG + Intronic
1055269340 9:74539698-74539720 CTGGATAAGGGAATAAAGAATGG + Intronic
1055316704 9:75041161-75041183 TTGGATAAATCACTAAGCAATGG + Intergenic
1055699572 9:78928424-78928446 CTGAACATACCAACAAACAATGG + Intergenic
1056416727 9:86384031-86384053 CTGGTAAAGCCAATAAGCAAAGG - Intergenic
1056894195 9:90526172-90526194 CTGTATAAACTAATAAAGAAAGG + Intergenic
1056989847 9:91400576-91400598 CTGGAGAAAGCAATCAAAAATGG - Intergenic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1060807001 9:126584098-126584120 CTGGAAAGACCAATAGCCAAGGG - Intergenic
1203653982 Un_KI270752v1:5880-5902 CTTGAGAAAACAACAAACAAAGG + Intergenic
1187269153 X:17764204-17764226 CTGGATAGACCTATACATAAAGG + Intergenic
1187680940 X:21767419-21767441 CAGGAAAAACCAGGAAACAAGGG + Intergenic
1189894219 X:45636953-45636975 CTAGATTAACAAAGAAACAAAGG + Intergenic
1190149404 X:47931364-47931386 CTGAATAAACAAATAAGCAGGGG - Intronic
1190551395 X:51585693-51585715 CTGGATTGACCAAGAAATAAAGG - Intergenic
1190722432 X:53161099-53161121 CTGGAAAAACAAATAAAGAAGGG - Intergenic
1192855752 X:75009886-75009908 TTGGATAAACAAACAAGCAAAGG + Intergenic
1194935785 X:99946883-99946905 CTGGATGAAAGAACAAACAAGGG - Intergenic
1195414029 X:104601057-104601079 CTGGATTTACTAATAAATAATGG - Intronic
1195640420 X:107168824-107168846 CTGGATAAATGCATAAACCATGG + Intronic
1196035836 X:111143783-111143805 CTGGAAAAATTAATAAAAAAGGG - Intronic
1197921669 X:131601198-131601220 CTGGATAAAGAAAAACACAATGG - Intergenic
1198190044 X:134294868-134294890 CTGTAGTAGCCAATAAACAAGGG + Intergenic
1201678664 Y:16617750-16617772 ATAAATAAACAAATAAACAATGG + Intergenic