ID: 1144069081

View in Genome Browser
Species Human (GRCh38)
Location 17:11651176-11651198
Sequence TGTGGCTAATTTAGAGTTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144069076_1144069081 11 Left 1144069076 17:11651142-11651164 CCATGTTCTCCTCCAGGGATTTC 0: 1
1: 0
2: 3
3: 23
4: 316
Right 1144069081 17:11651176-11651198 TGTGGCTAATTTAGAGTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 151
1144069073_1144069081 27 Left 1144069073 17:11651126-11651148 CCTGAGACAGCAGCAGCCATGTT 0: 1
1: 0
2: 1
3: 36
4: 304
Right 1144069081 17:11651176-11651198 TGTGGCTAATTTAGAGTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 151
1144069078_1144069081 2 Left 1144069078 17:11651151-11651173 CCTCCAGGGATTTCTATCGGCAG 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1144069081 17:11651176-11651198 TGTGGCTAATTTAGAGTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 151
1144069079_1144069081 -1 Left 1144069079 17:11651154-11651176 CCAGGGATTTCTATCGGCAGCTT 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1144069081 17:11651176-11651198 TGTGGCTAATTTAGAGTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144069081 Original CRISPR TGTGGCTAATTTAGAGTTGA TGG Exonic
900078872 1:840498-840520 TGTAGCTAATTTTGAGTTTCTGG - Intergenic
900734099 1:4284088-4284110 TGTGGCTATTGTAGAATTAAGGG + Intergenic
901116259 1:6847441-6847463 TATGGCTAGTTTAGGGTTTAAGG + Intronic
903788929 1:25879582-25879604 TGTGGCTATTTGAGAGCTGAAGG + Intergenic
904957525 1:34297425-34297447 TGGTAATAATTTAGAGTTGAAGG - Intergenic
905682256 1:39882582-39882604 AATGGCTGATTTAAAGTTGAAGG - Intronic
905855805 1:41312658-41312680 TTTGGCTGATATAGAGTTGTAGG + Intergenic
908072053 1:60471611-60471633 TGTGGCTAATCCGGAGATGAAGG - Intergenic
909061945 1:70889112-70889134 TGGTGCTGATTTAGATTTGAGGG - Intronic
909506637 1:76398189-76398211 TTTGGTTAATTCAGAGTTCAAGG - Intronic
911767041 1:101690066-101690088 TGTGGATTATTGAGAGCTGATGG + Intergenic
913241249 1:116831686-116831708 TTTGTCCAATTTACAGTTGAAGG - Intergenic
915464981 1:156091847-156091869 GGTGGCTAATTTAGAAAGGATGG + Intronic
916589282 1:166174925-166174947 TGTGGCTAAATGTGAGTGGAGGG - Intergenic
918498639 1:185168710-185168732 TGAGGCTAATTTAGAGATTTTGG + Intronic
918610631 1:186486604-186486626 TATGTATAATTTAGATTTGATGG - Intergenic
919619935 1:199852937-199852959 TATTTCTAATTTAGAGATGATGG - Intergenic
920438945 1:205965739-205965761 TGTAGCATATTTAGAGATGATGG - Intergenic
920546821 1:206825077-206825099 TGTTACTAATTTAGGGTTCATGG + Intronic
921923003 1:220689642-220689664 TCTGGCTAATGTAGAATTAAGGG - Intergenic
1064144576 10:12817407-12817429 AGGGACTAATTGAGAGTTGATGG + Intronic
1065548474 10:26846185-26846207 GGTGGCTAGTCTAGAGGTGATGG - Intronic
1067412983 10:46080828-46080850 TTTGCCTAATTTGTAGTTGAAGG - Intergenic
1069239155 10:66117088-66117110 TGTGGTTATTTGAGAGTTGGTGG + Intronic
1071425322 10:85543672-85543694 TATGGATAATTTTGAGCTGAAGG + Intergenic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1072824552 10:98593286-98593308 TGTGGGTAATTAAGAGTAGGTGG + Intronic
1077658609 11:4046219-4046241 TGGGGTTAAATTAGTGTTGAGGG - Intronic
1079777862 11:24556813-24556835 TCTGGGTAAGTTAGTGTTGAGGG - Intronic
1084664126 11:70567098-70567120 TGTGTTTAACTTAGAGTAGATGG - Intronic
1086594964 11:88559796-88559818 TGTGGCGAGTCTAGAGATGATGG + Intronic
1088468919 11:110173630-110173652 TGTTGCTGTTTTAGAGTTAATGG + Intergenic
1089845955 11:121458640-121458662 TGTGGCTCATTTTAAATTGAGGG - Intronic
1090145963 11:124322922-124322944 TGTGACTATTTTAGAGATGATGG - Intergenic
1095343019 12:41114549-41114571 TTTGTCTAATTCAGATTTGAGGG - Intergenic
1095734284 12:45539532-45539554 TGTGGATAATTTTCAGTTGTTGG - Intergenic
1097638432 12:62149762-62149784 TGTGGCTGAGTGAGAGTTGGAGG - Intronic
1098159480 12:67635695-67635717 TGAGGTTAATTTATTGTTGAAGG - Intergenic
1099721178 12:86363450-86363472 TGCAGCTAATTCAGAGTTGGGGG + Intronic
1102024184 12:109704089-109704111 AGTGGCTATTTGAGAGGTGATGG - Intergenic
1107177852 13:37420527-37420549 GATGGCTAATTTAGAGGTGAAGG + Intergenic
1107516839 13:41137597-41137619 TGTAGCTAGTTTGGGGTTGAGGG - Intergenic
1108538647 13:51414030-51414052 TGTGGCCAAATTCTAGTTGATGG + Intronic
1108848158 13:54699719-54699741 TTTGGCTATTGTAGAGTTTAAGG + Intergenic
1109692256 13:65909363-65909385 TTTGGCTAGTTCAGAGTTCAGGG + Intergenic
1110591723 13:77270513-77270535 TGTAGCGAATTTAGAATTGTTGG + Exonic
1110733961 13:78912768-78912790 TGTGGCTACATTAAAGTTGAAGG - Intergenic
1110988941 13:82012320-82012342 TGTGGATAATTTACACTTGAGGG + Intergenic
1112235932 13:97636781-97636803 TTTGGCTCATTTAGAGGTGAAGG - Intergenic
1113312479 13:109144660-109144682 TGTGGCTAATTTACCCTTCAGGG + Intronic
1114711911 14:24787321-24787343 TGTGGTTTATTGAGAGTTGGGGG - Intergenic
1116516883 14:45815264-45815286 TGTTACTAATATAGAGGTGAGGG + Intergenic
1118293215 14:64545213-64545235 TGGGGCTAAATTACAGTTTAAGG + Exonic
1120282657 14:82458661-82458683 TGTGACTAAATTAGAGCTAATGG - Intergenic
1121159083 14:91718372-91718394 TGAGGGTAAGTTAGAGATGATGG - Intronic
1122474663 14:101998696-101998718 TGTGCTTAATTTTGATTTGATGG + Intronic
1123994656 15:25710071-25710093 GGTGGCTGATTTCGAGCTGAAGG + Intronic
1124408996 15:29420170-29420192 TGGGGCTAATTTGGTGTAGAAGG + Intronic
1124533726 15:30526344-30526366 TGTGGAGAAGTTAGGGTTGAGGG + Intergenic
1124702124 15:31925003-31925025 TGTAGCTAATGCAGAGCTGAGGG - Intergenic
1124764929 15:32481300-32481322 TGTGGAGAAGTTAGGGTTGAGGG - Intergenic
1126028168 15:44469096-44469118 TGTGTCTAATTTATAATTCAAGG + Intronic
1126357708 15:47813587-47813609 TGTGGTTAATTTATATTTTAAGG + Intergenic
1126966029 15:54055255-54055277 AGTAGCTAATTTAGTGTTCAGGG - Intronic
1127206664 15:56727562-56727584 TGAGGATTATTTTGAGTTGAAGG - Intronic
1130161771 15:81408464-81408486 TGTGGCTTATTTAGTTTAGATGG + Intergenic
1130282196 15:82528413-82528435 TGTGGCTAATTAACAGTGGTAGG + Intergenic
1131952845 15:97700227-97700249 TGTGTCTAGTATAGATTTGAAGG + Intergenic
1138392819 16:56682738-56682760 TGCCTCTAAGTTAGAGTTGAGGG + Intronic
1141288142 16:82691717-82691739 AGAGGCTAATGGAGAGTTGAAGG + Intronic
1141382398 16:83588127-83588149 TGTGGCTGCTTTGGAGCTGATGG - Intronic
1144069081 17:11651176-11651198 TGTGGCTAATTTAGAGTTGATGG + Exonic
1144293046 17:13845017-13845039 CGTTGCCAATTTAGAGTTTATGG - Intergenic
1147755500 17:42764530-42764552 TGTGTCTGATGGAGAGTTGAAGG - Intergenic
1149461034 17:56830587-56830609 GGTGGCTAATTGAGAGGAGATGG - Intronic
1154255213 18:12776633-12776655 TGTGTCTAGTTCAGAGTTTATGG - Intergenic
1160368203 18:78347846-78347868 TGTGTGTAAGTTATAGTTGACGG - Intergenic
1165696160 19:37902569-37902591 TGTGGCCAATTTAGCGTGAAGGG + Intronic
925019426 2:557024-557046 TGTGGCTTTTTTAAAGTTAACGG + Intergenic
926702873 2:15815551-15815573 TGAGGCTAAATGAGACTTGAAGG - Intergenic
927449911 2:23199702-23199724 TGTGGATTATTTTGAGCTGAAGG + Intergenic
927907050 2:26866404-26866426 GGTGGCTATTTTAGGGTTGTGGG - Intronic
932683071 2:73843682-73843704 TGTGCCTAATATAGAACTGAAGG + Intronic
937481464 2:122264664-122264686 ATTGGCTAATTTAGTGTGGAAGG - Intergenic
939328605 2:140728312-140728334 TGTGGCTAATTTTGACTTTCAGG + Intronic
941187923 2:162340473-162340495 TGTTGGTAATCTAGAGATGATGG - Intronic
943064530 2:183072175-183072197 GGTGGCAAACTTAGTGTTGAGGG + Intergenic
944418980 2:199508481-199508503 TATGCCTGATTTAGGGTTGAAGG + Intergenic
946182245 2:217955678-217955700 TGTGGCTATTTGACAGGTGAGGG + Intronic
947451336 2:230211708-230211730 AGTGGCTAATTGAGAGTGAATGG - Intronic
1170541785 20:17396494-17396516 AATGGCTAATTTGAAGTTGAAGG - Intronic
1171997192 20:31740726-31740748 TCTGGACAATTTAGAGGTGAGGG + Intronic
1178629690 21:34248380-34248402 TGTGTATAATTTAGAGTTTTCGG - Intergenic
1178661297 21:34509915-34509937 AGTGGCTACTTGAGAGTGGAGGG - Intergenic
949779404 3:7669249-7669271 TGGGCATAATTTAGACTTGAAGG + Intronic
949872613 3:8602154-8602176 TGTGGGCAACTTAGAGTTGCTGG - Intergenic
957912607 3:86640617-86640639 TGTTGCTAATATTGAATTGAAGG + Intergenic
958701995 3:97603596-97603618 TATGGTTAATCTAGAATTGACGG - Intronic
959115213 3:102169408-102169430 TGTGGCTACTTGAAAGTGGAGGG - Intronic
960326011 3:116296783-116296805 TGTGGGAAATTCAAAGTTGAAGG + Intronic
962141016 3:132790922-132790944 TGAGGCTATTTTAGAGTTCCAGG - Intergenic
962573218 3:136732560-136732582 TCTGGTTAATTGAGAGATGAAGG - Intronic
963098379 3:141571525-141571547 TGTGGCTGAATTAGACTTGAAGG + Exonic
965262027 3:166499451-166499473 TGGGGCTAATTGAGGGTGGAAGG - Intergenic
965494856 3:169385170-169385192 TGTGGGTAATTCAGAGGTCATGG - Intronic
967042089 3:185703201-185703223 TCTAACTAATTTATAGTTGACGG + Intronic
970146547 4:13042125-13042147 TGTGGCTAAATAAGATTTTAGGG + Intergenic
970417316 4:15872150-15872172 TGTGGCTAATTTAGGTGTGAAGG + Intergenic
976011383 4:80493415-80493437 ATTGGCTAATTTAAAGATGATGG + Intronic
976020113 4:80612713-80612735 TGTACTTAATTCAGAGTTGAGGG - Intronic
977437151 4:97012802-97012824 TGAGGCCAAGTTAGAGTGGAGGG - Intergenic
983164923 4:164463529-164463551 TTTAGCTAATTCAGAGTGGAGGG + Intergenic
983904169 4:173168169-173168191 CGTGGCTGATTTATAGCTGAAGG - Intergenic
985011152 4:185583408-185583430 TGTGCCCATTTTAGAGATGAGGG - Intergenic
985846353 5:2352422-2352444 TGTGGCTAATATTGAATAGAAGG + Intergenic
991745889 5:69740662-69740684 TGGGCCTACTTTAGAGTGGAGGG - Intergenic
991751814 5:69814571-69814593 TGGGCCTACTTTAGAGTGGAGGG + Intergenic
991797490 5:70320620-70320642 TGGGCCTACTTTAGAGTGGAGGG - Intergenic
991825267 5:70615976-70615998 TGGGCCTACTTTAGAGTGGAGGG - Intergenic
991831104 5:70689472-70689494 TGGGCCTACTTTAGAGTGGAGGG + Intergenic
991889832 5:71319941-71319963 TGGGCCTACTTTAGAGTGGAGGG - Intergenic
992265316 5:75012699-75012721 TGAGGATAATTTTGAGCTGAAGG - Intergenic
996532177 5:124537832-124537854 TGAGGTTAATTGAAAGTTGATGG - Intergenic
997634281 5:135393302-135393324 TGTGACTAAGTTCTAGTTGATGG - Intronic
1003436407 6:6092571-6092593 TGTGACTGATTTTGAGGTGAAGG - Intergenic
1006222400 6:32503342-32503364 TGTGGCTAAATTACACTTAATGG - Intergenic
1006773202 6:36571070-36571092 CCTGGCTAATTTAGAGATGGGGG - Intergenic
1010329991 6:74612042-74612064 TGTGATCATTTTAGAGTTGAAGG + Intergenic
1011533139 6:88346751-88346773 GCTGGCTAAATTACAGTTGAAGG - Intergenic
1013441023 6:110169177-110169199 TGTAAGTAATTTAGAATTGATGG - Intronic
1013996837 6:116318698-116318720 CCTGGCTAATTTAGAAATGAAGG + Intronic
1015498531 6:133906581-133906603 AGTGGCTAGTTTAGGGTTTAGGG - Intergenic
1016076047 6:139796887-139796909 TATGCCTAATTTAGAGGTCATGG - Intergenic
1017230857 6:152072099-152072121 TGTGGCTCTTTTAGAGGAGAGGG - Intronic
1017674890 6:156802765-156802787 TGTGGCTAAGTATAAGTTGAGGG + Intronic
1020869468 7:13608943-13608965 TGTGTCTAATGGAGAGTTGATGG - Intergenic
1021987937 7:26115209-26115231 TGTGGTTGTTTTAGACTTGATGG + Intergenic
1023029257 7:36078758-36078780 TTTAAGTAATTTAGAGTTGAAGG + Intergenic
1028464224 7:91131728-91131750 TGTGGCTACTTTACAGATGTTGG + Intronic
1029793743 7:102872214-102872236 TGTGGGGAATTTAGATGTGATGG - Intronic
1030054333 7:105569452-105569474 TGTGGCTATGTTTGAGATGATGG - Exonic
1031055255 7:116986271-116986293 GGTGGTGAATTGAGAGTTGAGGG + Intronic
1032420742 7:131777149-131777171 TATGGCTACTTTAGAGTGGATGG - Intergenic
1033533384 7:142288675-142288697 GGTGGCCACTTGAGAGTTGATGG + Intergenic
1035526759 8:319187-319209 TGTAGCTAATTTTGAGTTTCTGG + Intergenic
1035811263 8:2493304-2493326 TGAGGATTATTTTGAGTTGATGG - Intergenic
1035986332 8:4435890-4435912 TGTGTCAAATGTAGATTTGACGG + Intronic
1043364176 8:79512668-79512690 TGTTCCTACTTTATAGTTGAGGG - Intergenic
1046761564 8:118026786-118026808 TGTGGCTAATGGATTGTTGAAGG - Intronic
1047415972 8:124664658-124664680 TTTTGCTATTTTAGAGTAGAGGG - Intronic
1047966238 8:130048922-130048944 TGTGGGTAATTTGGAGTGAATGG - Intergenic
1048615662 8:136072888-136072910 TGTGGCTTATTTAAAGGAGAGGG - Intergenic
1185919597 X:4075965-4075987 TGTTGCTATTTCAGAGATGATGG - Intergenic
1185934726 X:4243084-4243106 TGTGACTGCTTTAGAGTTTACGG - Intergenic
1186741801 X:12526094-12526116 GGTAGGTAATTTAAAGTTGAGGG + Intronic
1188309635 X:28600470-28600492 TGTGCCTGATTTTGAGTTTAAGG + Intronic
1188538534 X:31223635-31223657 TGTGCCTATTTTTGAGTTTATGG - Intronic
1189548269 X:42066576-42066598 TGTGGCTTCTTTAGAGAGGAGGG - Intergenic
1190401194 X:50036677-50036699 TTTGGCTAATGTAGAGTTGCTGG + Intronic
1196634221 X:117982339-117982361 TGTGTCTATTTTAGACATGAGGG - Intronic
1197631772 X:128869199-128869221 TGAGGCTAATTTGGGATTGATGG + Intergenic
1198800836 X:140446226-140446248 TGTGGCTAAATTAGCGCTCATGG - Intergenic
1199264261 X:145811796-145811818 TTTGGCTAAAGTAGAGTTCAAGG - Intergenic