ID: 1144069081

View in Genome Browser
Species Human (GRCh38)
Location 17:11651176-11651198
Sequence TGTGGCTAATTTAGAGTTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144069076_1144069081 11 Left 1144069076 17:11651142-11651164 CCATGTTCTCCTCCAGGGATTTC 0: 1
1: 0
2: 3
3: 23
4: 316
Right 1144069081 17:11651176-11651198 TGTGGCTAATTTAGAGTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 151
1144069073_1144069081 27 Left 1144069073 17:11651126-11651148 CCTGAGACAGCAGCAGCCATGTT 0: 1
1: 0
2: 1
3: 36
4: 304
Right 1144069081 17:11651176-11651198 TGTGGCTAATTTAGAGTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 151
1144069078_1144069081 2 Left 1144069078 17:11651151-11651173 CCTCCAGGGATTTCTATCGGCAG 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1144069081 17:11651176-11651198 TGTGGCTAATTTAGAGTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 151
1144069079_1144069081 -1 Left 1144069079 17:11651154-11651176 CCAGGGATTTCTATCGGCAGCTT 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1144069081 17:11651176-11651198 TGTGGCTAATTTAGAGTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144069081 Original CRISPR TGTGGCTAATTTAGAGTTGA TGG Exonic