ID: 1144070616

View in Genome Browser
Species Human (GRCh38)
Location 17:11668338-11668360
Sequence AATCAGCTGCTTCCAAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 252}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144070610_1144070616 28 Left 1144070610 17:11668287-11668309 CCTGTTCACCTAGAGTGATAAGT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1144070616 17:11668338-11668360 AATCAGCTGCTTCCAAGAAATGG 0: 1
1: 0
2: 0
3: 24
4: 252
1144070609_1144070616 29 Left 1144070609 17:11668286-11668308 CCCTGTTCACCTAGAGTGATAAG 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1144070616 17:11668338-11668360 AATCAGCTGCTTCCAAGAAATGG 0: 1
1: 0
2: 0
3: 24
4: 252
1144070608_1144070616 30 Left 1144070608 17:11668285-11668307 CCCCTGTTCACCTAGAGTGATAA 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1144070616 17:11668338-11668360 AATCAGCTGCTTCCAAGAAATGG 0: 1
1: 0
2: 0
3: 24
4: 252
1144070612_1144070616 20 Left 1144070612 17:11668295-11668317 CCTAGAGTGATAAGTGGAATTGT 0: 1
1: 0
2: 2
3: 12
4: 130
Right 1144070616 17:11668338-11668360 AATCAGCTGCTTCCAAGAAATGG 0: 1
1: 0
2: 0
3: 24
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144070616 Original CRISPR AATCAGCTGCTTCCAAGAAA TGG Intronic
901007067 1:6177196-6177218 AACCAGCTGGTTCCAAAAGATGG - Intronic
901121652 1:6899243-6899265 AATAAGCTGCTTCCCAGAATAGG - Intronic
902661698 1:17908825-17908847 AATCATCTGCTTCCAAAACCTGG + Intergenic
904794567 1:33049629-33049651 AGTCGCCAGCTTCCAAGAAAAGG + Intronic
905687351 1:39918066-39918088 AAACAGCAGCTTTCAAGAACAGG + Intergenic
906827093 1:48993223-48993245 AATCTGCTACTTTGAAGAAAAGG - Intronic
907041573 1:51265465-51265487 AATCATCTGCCTTTAAGAAAAGG - Intronic
907840769 1:58155188-58155210 ATTCAGCTGCTGCCAAGGGAAGG + Intronic
907841538 1:58162798-58162820 ATTCAGCTGCTGCCAAGGGAAGG + Intronic
911011450 1:93285343-93285365 AATCAGCTGAATCCATGAAGTGG + Intergenic
911594983 1:99789153-99789175 AATCAGGTGGCACCAAGAAAGGG - Intergenic
912205058 1:107499899-107499921 ATTCAGATGCTACCAAGAAGTGG + Intergenic
912996964 1:114540119-114540141 AATACTATGCTTCCAAGAAAAGG + Intergenic
917030360 1:170683547-170683569 AAGCAGCTGCTTCCAGGAGAAGG + Intronic
917626958 1:176855964-176855986 ACTCAGCAGCTTCCAACCAATGG + Intergenic
917857036 1:179109241-179109263 CAGCAGCTCCTTCCGAGAAATGG - Exonic
919039905 1:192372376-192372398 AATTAGATGCTTCCAAGTAGAGG + Intergenic
919088466 1:192949550-192949572 GATCAGCTGAGCCCAAGAAATGG + Intergenic
920357012 1:205381281-205381303 AATTAGCTGTTTCCCAGAATTGG + Intergenic
921302368 1:213763448-213763470 AGTCTGCTGCTGCCAGGAAAAGG + Intergenic
922811924 1:228421024-228421046 CATCACCTGCTTTCAGGAAAAGG + Intergenic
1064255719 10:13741497-13741519 GATCAGCTCCTTGGAAGAAATGG + Intronic
1064829679 10:19448479-19448501 AATCATCTAGTTCCCAGAAAGGG + Intronic
1064978018 10:21138268-21138290 AAACAGATGCATCCAAGGAATGG + Intronic
1066794413 10:39103282-39103304 AATCAGCTGAATCAAAGGAAAGG - Intergenic
1066794547 10:39104880-39104902 AATCAGCTGAATCAAAGGAAAGG - Intergenic
1066795823 10:39119490-39119512 AATCTGCTGATTCAAAGGAAAGG - Intergenic
1066807671 10:39277638-39277660 AAACAGCTGAATCCAAGGAAAGG + Intergenic
1069260682 10:66391862-66391884 AATCAGTAGCTTCCAAGTCAAGG - Intronic
1071015047 10:80987113-80987135 AATCAGCAGATTCCAGAAAAAGG - Intergenic
1071361756 10:84853126-84853148 AATCTGATGCTTCCAAGCACTGG - Intergenic
1071710295 10:88043088-88043110 ACCCAGCTGCTTCCAAGTAACGG - Intergenic
1071782051 10:88856801-88856823 TATGAGCAGCTACCAAGAAATGG + Intergenic
1072568128 10:96635095-96635117 AATCAGCTGACTTCAAGATATGG - Intronic
1073817303 10:107222187-107222209 AAACAGCTGATTCCAGGGAAGGG - Intergenic
1074441147 10:113478401-113478423 ATAAAGATGCTTCCAAGAAAAGG + Intergenic
1074701456 10:116096223-116096245 AAAAGGCTGCTTCCCAGAAATGG - Intronic
1075021636 10:118956630-118956652 CAGCAGGTGCTTCCAAGAAAAGG + Intergenic
1079591436 11:22188000-22188022 AACCAGCTGCTTGAAAGCAAGGG + Intergenic
1081326455 11:41751491-41751513 AATAACCTGCTTCTAAGTAATGG - Intergenic
1082585684 11:54936427-54936449 AATCTGCTGTATCCAAAAAAAGG + Intergenic
1082761749 11:57133477-57133499 AATCAGCTTCTTCCAAATTACGG + Intergenic
1083017807 11:59474623-59474645 TATCCGCTGCCTCCCAGAAAGGG + Intergenic
1087290761 11:96317735-96317757 AATCAGCTGCTTCCTAGCTCAGG + Intronic
1088003320 11:104908920-104908942 GACCATCTGCCTCCAAGAAATGG - Intergenic
1088635417 11:111815489-111815511 CATCAGCTGCTTCCCAGAGATGG - Intronic
1089813319 11:121149301-121149323 CAGCAGCTGCCTCCAATAAAAGG - Intronic
1089892984 11:121899809-121899831 AATCAGCTTTTTCCTGGAAAAGG + Intergenic
1090494567 11:127197675-127197697 AATCAGTAGCTTTTAAGAAAAGG - Intergenic
1091372115 11:135069615-135069637 AATCAGCTGCCTTTAACAAAAGG + Intergenic
1091694394 12:2618134-2618156 AGTGAGCTGCTCCCAGGAAAGGG + Intronic
1092746627 12:11678517-11678539 AATAAGGAGATTCCAAGAAAAGG - Intronic
1094647323 12:32338357-32338379 AAAAACCTGCTTTCAAGAAAAGG - Intronic
1095093622 12:38131024-38131046 AATCTACTGTTTCCAAGAAGTGG + Intergenic
1096119644 12:49079765-49079787 GGCCAGCTGCTTCCAAGAGAAGG + Intergenic
1098092036 12:66913676-66913698 AATCAGCTGCTTCCTGGAGGTGG + Intergenic
1099239410 12:80120965-80120987 AATATGCTGCCTCCAAGAATGGG - Intergenic
1099613742 12:84910737-84910759 AATAAGATGCTTCCATGAAGAGG - Intronic
1100056604 12:90519023-90519045 AAACTGCTACTTCCAAAAAATGG - Intergenic
1100784469 12:98064543-98064565 GCTCAGCTGCCTCCTAGAAAAGG + Intergenic
1101624453 12:106425339-106425361 AATCCTCTGATTCCAGGAAAAGG - Intronic
1102020314 12:109677759-109677781 TTTCAGCTCCTTCCAGGAAAGGG + Intergenic
1102945137 12:116980031-116980053 AATCAGCTTCCCCCAAGAACTGG - Intronic
1104150478 12:126077486-126077508 AATGAGCTGGTTTCCAGAAAAGG + Intergenic
1104675183 12:130707608-130707630 AATCAGAAGCTTCCAAGAGTGGG + Intronic
1106895884 13:34302027-34302049 AAGCAGCTGCTGCCAGGAAATGG - Intergenic
1107053829 13:36081560-36081582 AAGCAGTTATTTCCAAGAAATGG + Intronic
1107194294 13:37629507-37629529 AATCAGCTGTGTCCAAAAACTGG - Intergenic
1109585591 13:64398183-64398205 TATCAGCACCTTCTAAGAAAAGG + Intergenic
1110276716 13:73649169-73649191 AAGCAACTTCTTCCAAGACATGG - Intergenic
1111273927 13:85923508-85923530 TATCACCTTCTTCCAATAAAAGG + Intergenic
1114260383 14:21032314-21032336 CAACAGCTGCTTCCAAGAACAGG + Intronic
1116269433 14:42742207-42742229 AATCAGCTGCCTTGAAGGAAAGG + Intergenic
1116592975 14:46803632-46803654 AAGCAATGGCTTCCAAGAAATGG + Intergenic
1116764912 14:49058665-49058687 CTTAAGCTGCTTCCATGAAATGG - Intergenic
1117290901 14:54331622-54331644 TATCATCTTCTTCCAAGAAATGG + Intergenic
1121265820 14:92601983-92602005 GAAGAGCAGCTTCCAAGAAAAGG + Intronic
1122724656 14:103742224-103742246 AAGCAGCTGCCTCCAAGCTATGG - Exonic
1124208317 15:27742078-27742100 TATCACCTGCCTCCAAGCAAAGG - Intergenic
1125178144 15:36849473-36849495 AATTAGCTGATGCCAGGAAAAGG + Intergenic
1125741237 15:41966313-41966335 TGTCAGATGCTTCCAGGAAAAGG - Intronic
1128956187 15:71948114-71948136 AGTGACTTGCTTCCAAGAAATGG - Intronic
1129539505 15:76339101-76339123 AATCAGCAGCTGCCCAGAGATGG + Intronic
1133023493 16:2977169-2977191 AATAAGCACCTACCAAGAAAAGG + Intronic
1134817852 16:17220896-17220918 AATCTGTTGCTTTTAAGAAAAGG - Intronic
1137647322 16:50087263-50087285 AATCAGCTCCTACCATGCAAAGG - Intronic
1138916526 16:61471453-61471475 AACCAGCTGCTTTGAAGGAAAGG + Intergenic
1144070616 17:11668338-11668360 AATCAGCTGCTTCCAAGAAATGG + Intronic
1144298368 17:13900337-13900359 ATTCATCTTCTTCCCAGAAAAGG + Intergenic
1144878566 17:18417983-18418005 AAGCAAGTGGTTCCAAGAAATGG - Intergenic
1144885186 17:18453257-18453279 AAGCAAGTGGTTCCAAGAAATGG + Intergenic
1145147032 17:20491120-20491142 AAGCAAGTGGTTCCAAGAAATGG - Intergenic
1145153668 17:20526404-20526426 AAGCAAGTGGTTCCAAGAAATGG + Intergenic
1145177099 17:20710210-20710232 AAGCAAGTGGTTCCAAGAAATGG - Intergenic
1146300039 17:31680806-31680828 AGTCAGTTACTCCCAAGAAAAGG + Intergenic
1146853280 17:36242001-36242023 AAGCAAGTGGTTCCAAGAAATGG + Intronic
1146869188 17:36365891-36365913 AAGCAAGTGGTTCCAAGAAATGG + Intronic
1147058582 17:37854795-37854817 AAGCAAGTGGTTCCAAGAAATGG + Intergenic
1147072062 17:37966522-37966544 AAGCAAGTGGTTCCAAGAAATGG + Intergenic
1147083588 17:38046054-38046076 AAGCAAGTGGTTCCAAGAAATGG + Intronic
1147099534 17:38170021-38170043 AAGCAAGTGGTTCCAAGAAATGG + Intergenic
1147323211 17:39658284-39658306 AAGCAGCTGCTACCAGGAATGGG + Intronic
1149021940 17:51978454-51978476 AATAAGCTCTTTCCAACAAATGG + Intronic
1149435249 17:56628452-56628474 ATTCAACTGTTTCCAAGAAGGGG - Intergenic
1149863813 17:60139413-60139435 ATTTACCTGCTTCCCAGAAACGG + Intergenic
1150082546 17:62253315-62253337 AAGCAAGTGGTTCCAAGAAATGG + Intergenic
1150290238 17:63977010-63977032 AATCAGGTGCTTCCAGAAAGGGG - Intergenic
1150511019 17:65753112-65753134 AATCATTTGCTTCCAACTAAAGG - Intronic
1156447777 18:37249825-37249847 AATCAGCTGGTCTCAAGCAAAGG + Intronic
1156911377 18:42414610-42414632 AAGCAGATGCTTCCAAAATAAGG - Intergenic
1157729928 18:49994658-49994680 AATCAGCTTCCTCCAACCAAAGG + Intronic
1159764241 18:72468344-72468366 AAGCAGCTCCTTCTCAGAAAGGG + Intergenic
1160406335 18:78648978-78649000 AATCACCTGCGTTCAAGAAATGG + Intergenic
1160686963 19:441410-441432 AGACAGCTGTTTCCATGAAAAGG + Intronic
1161195196 19:2982758-2982780 TCTGAGCTGCTTCCAAGAGAGGG + Intronic
1163943824 19:20518069-20518091 AATCACCTGCTTCCCAGTCAGGG + Intergenic
1164335036 19:24307966-24307988 AAACTGCTGATTCCAAGGAATGG - Intergenic
1164534923 19:29078314-29078336 AGTAAGCTTCTTCCCAGAAATGG + Intergenic
1165056688 19:33181656-33181678 CATCAGCTGCTTCCAGGAGAGGG + Intronic
1168321662 19:55513894-55513916 AAACAGGTGATTCCCAGAAAAGG + Intronic
927530034 2:23788438-23788460 AATAAACTGACTCCAAGAAAGGG + Intronic
928325094 2:30313101-30313123 CAACAGCTGCTTCCAAGGACAGG + Intronic
929062251 2:37934355-37934377 AATCAGCTGAGCCCCAGAAAAGG - Intronic
929175727 2:38973600-38973622 AAACAGTTGCTTCCTAGAACTGG - Intronic
930411490 2:51031103-51031125 AATGAGCTTCCTCCAAGAACTGG - Intronic
930946869 2:57085176-57085198 AGTCGGCTGCCTCCAAGATACGG + Intergenic
931932691 2:67158459-67158481 AATCAGCTTCTTACAAATAAGGG - Intergenic
932547374 2:72728185-72728207 GATCAGCTGGATCAAAGAAAGGG - Intronic
932680861 2:73824292-73824314 AATGAGCTGATTCAAATAAAGGG - Intergenic
935070792 2:99692018-99692040 AAACAGCTGCCTCCAAGAAGGGG - Intronic
938023853 2:127927828-127927850 AATCAGCTAACTACAAGAAAAGG + Intergenic
940243291 2:151586750-151586772 AATCAGTAGATTCCAAGTAAAGG + Intronic
940244247 2:151597303-151597325 AATCAGTAGATTCCAAGTAAAGG + Intronic
940245203 2:151607849-151607871 AATCAGTAGATTCCAAGTAAAGG + Intronic
941383002 2:164819135-164819157 AAGCATTTCCTTCCAAGAAAAGG + Intronic
941407366 2:165107339-165107361 AATTAAATTCTTCCAAGAAATGG + Intronic
941658206 2:168167233-168167255 AATATGCTGGTTCCAACAAAAGG + Intronic
942687673 2:178550591-178550613 CATCAGCTGCATTCAAGCAAGGG + Intronic
943440140 2:187917647-187917669 AATCAGCTGATGCCATGAAGGGG - Intergenic
944397906 2:199290147-199290169 CATCAGAGGTTTCCAAGAAAGGG - Intronic
944580493 2:201128231-201128253 CATCATCAGCTTCCATGAAAAGG - Intronic
945212581 2:207398817-207398839 ATCCAGCTGGTTCCAAGAATAGG - Intergenic
948156354 2:235786191-235786213 AATCAGCGTCTTCCAAGACGAGG - Intronic
1169147433 20:3262132-3262154 AATTATCTGATTCCTAGAAATGG + Intronic
1169189603 20:3649831-3649853 AATAAACTGATTCCAGGAAATGG - Exonic
1169311046 20:4540348-4540370 ACTCAGATGCTCCCAAGAGAAGG + Intergenic
1170565876 20:17604693-17604715 AATAAGGTGCTTCTCAGAAAAGG - Intronic
1170759195 20:19234874-19234896 AATCATCTGCTCCCAGGAGAAGG + Intronic
1173600418 20:44291083-44291105 AATGAGCTGTCTCCAATAAATGG + Intergenic
1173671376 20:44801385-44801407 ATTCAGATGTTTCTAAGAAAGGG - Intronic
1174108897 20:48184132-48184154 CTTCAGAGGCTTCCAAGAAAAGG - Intergenic
1178994255 21:37383476-37383498 AATTAGCATCTTCCAAGTAAAGG - Intronic
1181378418 22:22479469-22479491 AATTAACTGCTCCCAAGCAAAGG + Intergenic
1184556251 22:45234587-45234609 ACACAGCAGCCTCCAAGAAATGG + Intronic
949304069 3:2619917-2619939 AATCAGTTGTTTCTAAGATAGGG + Intronic
949481174 3:4494690-4494712 TCTCAGCTACTTCCAAGAAACGG - Intronic
950544047 3:13628524-13628546 CATCAACTCCTTCCAAAAAAGGG + Intronic
951246992 3:20352655-20352677 AAATAGCTTCTTCCCAGAAAAGG - Intergenic
952898283 3:38093731-38093753 AATCAGCTGCTTCCTAGCCGTGG - Exonic
954117516 3:48475433-48475455 ACTCGGCGGCCTCCAAGAAATGG + Intronic
954767250 3:52929649-52929671 AATAATCTTCTTCCAAGACAGGG + Intronic
955904589 3:63793473-63793495 AATTTGCTGCCTCCAAGAGAAGG - Intergenic
956612870 3:71142390-71142412 AATCAGCTGACTTGAAGAAAGGG + Intronic
956752472 3:72354263-72354285 AAACAGAAGCTTCCAACAAAGGG - Intergenic
958867915 3:99522621-99522643 AATCAGCTTCTCCCTAGAAGTGG - Intergenic
960223704 3:115146802-115146824 GAGCCGCTGCTTCCAAGAAGAGG - Intronic
960336708 3:116426575-116426597 AATGAGCTGTTTCTAAGTAATGG - Intronic
960837575 3:121923029-121923051 AATGAGCTGCTTCTGCGAAAAGG - Exonic
961115989 3:124330424-124330446 AATGAGCTGCTTCATAAAAAAGG - Intronic
962347587 3:134629724-134629746 AACCAGATGCTGCCAGGAAAGGG + Intronic
962702281 3:138011466-138011488 AATAAGTGGCTTCCAAAAAATGG - Intronic
963434413 3:145249987-145250009 AATCAGCTACCTCAAAGGAAAGG - Intergenic
965438930 3:168689328-168689350 AAGAAGCTGCTTCAGAGAAAAGG - Intergenic
969517125 4:7654066-7654088 AATAAGCTGCTTCTGAGAGAGGG - Intronic
970781937 4:19748032-19748054 AATCAGTTGATTCCAAAGAAAGG + Intergenic
970834017 4:20378816-20378838 AATTAGTTGCTTCCAAGATTTGG - Intronic
972970715 4:44572529-44572551 AAGAAGCTGCTTCACAGAAAAGG - Intergenic
975699019 4:77043919-77043941 AATAAGCTATTTCCAAGAAATGG + Intergenic
976131156 4:81885288-81885310 AAGCAGCTGCCTTCAAGCAAGGG + Intronic
977181482 4:93880308-93880330 AAGGAGCTGCTGCAAAGAAAGGG + Intergenic
978752059 4:112261045-112261067 AATCATATGCTGCCAAAAAATGG + Intronic
979032297 4:115665488-115665510 AAGCAGCTGTGTCCAAGAAAGGG + Intergenic
981023403 4:140052063-140052085 TATCAGTTGCTTTCATGAAATGG + Intronic
981329176 4:143488461-143488483 AATCTGCTGCCTTGAAGAAAAGG + Intergenic
981335167 4:143561290-143561312 AACCAGCTGCTTGAAAGCAAGGG + Intergenic
981545450 4:145888510-145888532 ATCCAACTGCTACCAAGAAATGG - Intronic
981581708 4:146255850-146255872 TATAAGCTGCTTCAAAGAAAGGG - Exonic
982297476 4:153844441-153844463 CATCAGTTTCTTCCAAGAATGGG + Intergenic
982536215 4:156609338-156609360 AATGACTTGCTTCTAAGAAATGG + Intergenic
982731757 4:158963715-158963737 AATCAGCTGACTTGAAGAAAGGG + Intronic
984340642 4:178452088-178452110 AATTAGCTGGTTCCAAGTATTGG + Intergenic
986279074 5:6308110-6308132 AATGAGCTACTTAGAAGAAAAGG + Intergenic
986995297 5:13601005-13601027 ACTCAGCTGCTCCCAGGAATTGG + Intergenic
988632097 5:32942554-32942576 AATCACCTGGTTTCAAGCAATGG - Intergenic
990023569 5:51159320-51159342 GAGCAGCTGCTGCCAAGACACGG + Intergenic
990028050 5:51220319-51220341 GAACAGCTGCTTCTGAGAAAGGG + Intergenic
990137083 5:52659313-52659335 AATTAGCTGCTTCCTAGAGGGGG + Intergenic
990383639 5:55238507-55238529 TGTCCACTGCTTCCAAGAAAAGG + Intergenic
990397154 5:55394005-55394027 AATAAACTCCATCCAAGAAATGG - Intronic
993404142 5:87489870-87489892 AAAAAGCTGCTGCAAAGAAAAGG - Intergenic
995516881 5:112963150-112963172 AATCAGCTGATTTTAAGATAGGG + Intergenic
997249702 5:132379054-132379076 AATAACCTGCTTATAAGAAATGG - Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
998108714 5:139484950-139484972 AGTAAGCTGCTTCAAAGAAGGGG + Intergenic
999932288 5:156446673-156446695 AAGGAGCTGAGTCCAAGAAAAGG + Intronic
1000494094 5:161956609-161956631 AAACAGTGGCTACCAAGAAATGG + Intergenic
1000600887 5:163273428-163273450 ACACAGCTACTACCAAGAAAGGG + Intergenic
1004351272 6:14892307-14892329 ATTCTGCTGCTCCAAAGAAAAGG + Intergenic
1004755052 6:18601841-18601863 AAACAGCTGCCACCAAAAAAGGG + Intergenic
1006024260 6:31137559-31137581 CAGCTGCTGCTTCCATGAAACGG - Exonic
1007155941 6:39743785-39743807 AATCTCCTGCTTCCAGGAAAAGG - Intergenic
1007835542 6:44671275-44671297 ATTCACCTGCTTCAAAGAGAGGG - Intergenic
1010060758 6:71620124-71620146 AATCAGCTGCTTTCAGGCCATGG - Intergenic
1010292553 6:74154976-74154998 AAACAGCTGATTCCAAGACTGGG - Intergenic
1011166054 6:84447735-84447757 ACACAGTTGCTTCCAAGAAGGGG + Intergenic
1011503184 6:88013254-88013276 ACTCAGCTGCTTCAAAGAGAAGG + Intergenic
1012226548 6:96710240-96710262 AAACAGCAGTTTTCAAGAAAAGG - Intergenic
1013971287 6:116022356-116022378 AATCATCTTTTTCCAAGAAAAGG + Intronic
1014560755 6:122887371-122887393 AATCAGTTTGGTCCAAGAAAAGG - Intergenic
1015168583 6:130226307-130226329 AATCAGAATCTTCTAAGAAAGGG - Intronic
1015546421 6:134366454-134366476 CTTCATCTGCTTCCAGGAAAGGG - Intergenic
1016591730 6:145753178-145753200 AATCAGCTTATCCCAAGAAAGGG - Intergenic
1017067671 6:150544481-150544503 ACTCAGATGCTCCCAGGAAAAGG + Intergenic
1017427143 6:154334148-154334170 AGTCAGATGCTTCCAACTAAGGG - Intronic
1018034690 6:159871991-159872013 TATCTGCTGCTGCCAAGAAGGGG + Intergenic
1018064670 6:160116747-160116769 GCTCAGCTGCTGCCAAGAGAGGG - Intergenic
1018451136 6:163908487-163908509 AATCAGATGTTTTGAAGAAAAGG - Intergenic
1019841659 7:3452328-3452350 AATCACCTGCTTCCAAAGAGTGG - Intronic
1021635706 7:22690395-22690417 CAGCAGCTGCTTCCAAGACAGGG - Intergenic
1026135079 7:67653059-67653081 CATCAGCTGTAGCCAAGAAAGGG + Intergenic
1027940416 7:84671522-84671544 TATAAGCTGCTTCAAAGCAATGG - Intergenic
1031142714 7:117962480-117962502 TACCAGCTGCTTACAAGGAAGGG - Intergenic
1031904347 7:127444437-127444459 AAGCAGATGCTCCCAAGAACAGG + Intergenic
1033318298 7:140316506-140316528 AATCAGTGACTTCCAAGAACTGG - Intronic
1034734657 7:153417365-153417387 AATCAGTTGATTTCAAGTAAGGG - Intergenic
1036717446 8:11139467-11139489 TAGCAGCTGCTGGCAAGAAATGG - Intronic
1037034097 8:14144383-14144405 AATCCACTGCTTTGAAGAAAAGG + Intronic
1037372788 8:18197778-18197800 AATCAACTGCTGACAGGAAATGG - Intronic
1037807808 8:22068111-22068133 CATCAACTGCCTCCAAGACAGGG + Intronic
1038152058 8:24950817-24950839 AATCATCTGATTCCATTAAATGG - Intergenic
1040771617 8:50984145-50984167 AGACAGCTGAGTCCAAGAAACGG - Intergenic
1041617235 8:59921528-59921550 AATTGGCTGCTTCCAAGAGGAGG - Intergenic
1041807816 8:61872751-61872773 AATCAGCTGACTTCAAGATAGGG + Intergenic
1041929062 8:63267330-63267352 CCTCATCTTCTTCCAAGAAATGG + Intergenic
1041947416 8:63461625-63461647 AGACAGCTGCTTTCCAGAAATGG + Intergenic
1044123310 8:88425197-88425219 AATCAGCAGCTTTCAGGAATTGG + Intergenic
1044638979 8:94358634-94358656 AATCTGCTGATTCCAAGCCAAGG + Intergenic
1044830630 8:96244485-96244507 AATCACTTGAATCCAAGAAACGG - Intronic
1045002285 8:97888769-97888791 AATCAGCTGATTCTAAACAAGGG + Intronic
1045844555 8:106618106-106618128 AGTGAGCTGCTTTCAAGAAGAGG - Intronic
1047311260 8:123694339-123694361 AATCAGCTGAGTCCACCAAAAGG + Intronic
1047394767 8:124485995-124486017 ATTGAGCTGCTTCCTCGAAAAGG + Exonic
1048834790 8:138509058-138509080 AATCATCTGATTTCAGGAAATGG - Intergenic
1049256063 8:141614501-141614523 CACCGGCTGCTTCCCAGAAAAGG - Intergenic
1050189686 9:3011569-3011591 AATCACTGGGTTCCAAGAAATGG + Intergenic
1050483180 9:6107072-6107094 AATCAGCTGCTGCTATGGAACGG + Intergenic
1050540613 9:6666336-6666358 AAGCAGCAGCTCCCAAGAAGAGG + Intergenic
1051228442 9:14927701-14927723 AATCATCTATTTCCAAGAAATGG + Intergenic
1052690790 9:31814509-31814531 TTTCAACTGCCTCCAAGAAAAGG - Intergenic
1053234746 9:36442878-36442900 AATTTGCAGCTTCCAAGAATAGG + Intronic
1054895061 9:70300593-70300615 AATCACCTGCTACAAAGAACGGG + Intronic
1054911082 9:70455899-70455921 AAACAGCAGCTTCCAAAAGAGGG - Intergenic
1058626604 9:106939868-106939890 AATCAGCTGCTTAGAAGAGAAGG + Intronic
1062172489 9:135143094-135143116 ACCGAGCTGCTTCCAAGAGAAGG - Intergenic
1186094018 X:6080612-6080634 AATTAGCTTCTTCCTAAAAAGGG + Intronic
1187212084 X:17241737-17241759 AACCAGCTGCTGCCTAGAACAGG - Intergenic
1189581051 X:42406780-42406802 AATCAGTTGATTTTAAGAAAGGG - Intergenic
1190039314 X:47056910-47056932 AATCAGCTCCTGCCAAGGGAGGG + Intronic
1190997328 X:55622881-55622903 AGCCAGCTGTTTCCCAGAAAAGG + Intergenic
1191011262 X:55761899-55761921 AATCAGCTGCCCCCAAGATAAGG + Intergenic
1192238226 X:69309729-69309751 AATCAGTTACCACCAAGAAAGGG - Intergenic
1193789706 X:85802502-85802524 AATCAACAGCTTCCCTGAAATGG - Intergenic
1194980754 X:100438001-100438023 AATCAGCAGCTTTCAGGAATTGG + Intergenic
1195649869 X:107273223-107273245 AGAAAGCTGCTTCCAAGAAGGGG + Intergenic
1195879662 X:109579210-109579232 ATTGAGCTGCTTCCAACACAAGG + Intergenic
1196190223 X:112786685-112786707 ATTCTGCTGCTTCTTAGAAATGG - Intronic
1198601087 X:138284909-138284931 AATCAGCTGCCTTTAAGAAAAGG - Intergenic