ID: 1144071186

View in Genome Browser
Species Human (GRCh38)
Location 17:11672504-11672526
Sequence CTGGTGATTTTGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 410}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144071186 Original CRISPR CTGGTGATTTTGAGGGAAGA TGG (reversed) Intronic
900574455 1:3376145-3376167 CTGGAGCTTTTGAAGGGAGAGGG + Intronic
900630165 1:3630693-3630715 CTGGTCAGTCTTAGGGAAGATGG - Intergenic
900722051 1:4183189-4183211 CTAGTGAGTTTAAGGGAAGTAGG + Intergenic
900841270 1:5050423-5050445 CTAGTGAGTTTAAGGGAAGTAGG - Intergenic
902175401 1:14646457-14646479 ATGGTGATAGTGAGGGAAGCTGG + Intronic
902731666 1:18373922-18373944 CTGCTGGTTCTAAGGGAAGAAGG - Intronic
903387158 1:22934804-22934826 TTGCTGGTTTTGAAGGAAGAAGG - Intergenic
903696622 1:25212156-25212178 CTGGTGATTTTGAATGAGGGGGG - Intergenic
906577110 1:46901054-46901076 ATGGCGATTTTCAGGGAACAAGG + Intergenic
906577888 1:46907367-46907389 ATGGTGATTTTCAGGGAACAAGG + Intergenic
906856385 1:49310234-49310256 CTTTTGATTCTGAGGGAAGTAGG + Intronic
906896294 1:49776538-49776560 CTGCTGATTTTGAGGTTAGCAGG - Intronic
906931387 1:50173026-50173048 TTGGTAAGTTTGGGGGAAGAGGG - Intronic
907027211 1:51132186-51132208 ATGGTCATTTGGAGGAAAGAAGG - Intronic
907182493 1:52583152-52583174 CTGGTAATATTAAGGAAAGAAGG + Intergenic
907468152 1:54653197-54653219 CTGGTGATCTGGAGGGAGGCTGG - Exonic
907528640 1:55070549-55070571 CTGCTGAGTTGGAGAGAAGAGGG + Intronic
909024761 1:70468925-70468947 GTGGTCATTTGGAGGAAAGAAGG - Intergenic
909049483 1:70751497-70751519 GTGGTCATTTGGAGGAAAGAAGG + Intergenic
909867425 1:80690964-80690986 CAGGTGGTTAGGAGGGAAGAAGG + Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
911279401 1:95903923-95903945 CTGGTTATTTTGCAGGAAAAGGG - Intergenic
912366359 1:109137036-109137058 CTGGTGAGTTTGAGGGGTGAAGG + Intronic
912617477 1:111118796-111118818 TTCGTGATTTTCAGGTAAGAAGG - Exonic
912927545 1:113926814-113926836 CTAGTGATGGTGAAGGAAGAGGG - Intergenic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913233716 1:116762922-116762944 CCGATGACTTGGAGGGAAGATGG + Intronic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
913919094 1:124810309-124810331 TTGGAGATTTCGATGGAAGAGGG + Intergenic
913919229 1:124811839-124811861 TTGGAGATTTCGATGGAAGAGGG + Intergenic
913921217 1:124834795-124834817 TTGGAGATTTTGATGGAAAAGGG + Intergenic
914228087 1:145738701-145738723 CTGGAGCTTAGGAGGGAAGAAGG - Exonic
914697311 1:150096698-150096720 GTGGAAATTTTGAAGGAAGAAGG + Intronic
915049315 1:153050508-153050530 GTGGTCATTTGGAGGAAAGAAGG - Intergenic
916098114 1:161369280-161369302 ATGAGGATTTTGGGGGAAGAAGG - Exonic
916686226 1:167149759-167149781 ATTCTGATTTTGAGAGAAGAGGG + Intergenic
916975815 1:170076435-170076457 CTGGTGAATTTGAGGCAATTTGG + Intronic
917237384 1:172909016-172909038 CTGGTGAGGTTGTGGGAAAAAGG + Intergenic
917714732 1:177722612-177722634 GTGGTCATTTGGAGGAAAGAGGG - Intergenic
918210235 1:182343912-182343934 CTGGTGTTCTTAAAGGAAGAGGG + Intergenic
918898706 1:190383462-190383484 CTGGAAATTTTTAGGGAACAAGG - Intronic
922368998 1:224890995-224891017 CAGGTGAGTTTAAGGGAAGTAGG - Intergenic
923042205 1:230327430-230327452 CTGCTGTTTCTGAGGAAAGAAGG - Intronic
923260240 1:232261385-232261407 CTGGTGCTTTTGAGGAAAACTGG - Intergenic
923276011 1:232396986-232397008 CTGGAGATTTTCAGGGAATAAGG - Intergenic
923385345 1:233460383-233460405 TTGGGCAATTTGAGGGAAGAGGG + Intergenic
924331838 1:242947248-242947270 GTGGTCATTTGGAGGAAAGAAGG - Intergenic
1064393303 10:14959716-14959738 TCCGTGATTTTTAGGGAAGAGGG + Intronic
1064499446 10:15953549-15953571 CTGTTAATTTTGAGGGATGGGGG + Intergenic
1064841047 10:19592384-19592406 CTGGTGAGTTGGAGATAAGATGG - Intronic
1065849663 10:29777223-29777245 CTGGTGATATTGAAGGAAGCCGG + Intergenic
1065941073 10:30564309-30564331 CTGGTGGTATTGTGGAAAGAGGG + Intergenic
1067141445 10:43660463-43660485 CTGGTGAGTTGGAAGGAACAAGG - Intergenic
1067401226 10:45975637-45975659 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067869578 10:49945215-49945237 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1068420935 10:56792175-56792197 CTGTTGTTTTAGAGGGGAGATGG - Intergenic
1068883008 10:62069939-62069961 CTTGTGATTTTTAGGGAACATGG + Intronic
1069072115 10:63999417-63999439 GTGGTCATTTGGAGGAAAGAAGG - Intergenic
1069393627 10:67964474-67964496 ATGGTTATTTAGATGGAAGAAGG - Intronic
1069947281 10:71996657-71996679 CTGCTGGTTCTGGGGGAAGAAGG + Intronic
1071736312 10:88304289-88304311 GTGGTCATTTGGAGGAAAGAAGG - Intronic
1071853427 10:89599021-89599043 TTGGTCAGGTTGAGGGAAGAAGG - Intronic
1072689694 10:97563911-97563933 CAGGTGAGTTTAAGGGAAGTAGG + Intronic
1073395268 10:103212130-103212152 CAGGTGAGTTTAAGGGAAGTAGG - Intergenic
1073773552 10:106761629-106761651 CTGCTGAATTTGGGAGAAGATGG - Exonic
1074153219 10:110777024-110777046 CTGGTGGCTTTGAGGCAATATGG - Intronic
1074156522 10:110804924-110804946 CAGGTGCTTTTGAGGGCAGAGGG + Intronic
1075186228 10:120260809-120260831 CTGGTGTTTTTCATGGGAGAGGG + Intergenic
1075859292 10:125661167-125661189 CGGGTGATGTGGAAGGAAGATGG + Intronic
1076230758 10:128818150-128818172 CTGGAGATTTGGAGAGGAGATGG - Intergenic
1076431343 10:130405030-130405052 CTGGTGCTTTTGGGGGAACATGG + Intergenic
1078725842 11:13930191-13930213 CTTGTGATTTGGAGTGAACAGGG + Intergenic
1079058531 11:17228221-17228243 CTGGGGTTTTTAAGGGAACATGG - Intronic
1080637195 11:34134435-34134457 CTGGTGTGTCTGAGGGAAGCTGG + Intronic
1082949606 11:58798429-58798451 CTGGGGATTTTTAAGAAAGAGGG - Intergenic
1083095417 11:60245674-60245696 CGGGTGACTGTGAGAGAAGAGGG - Intergenic
1085346567 11:75771884-75771906 CTGTTGAATTTGAGGGCAGGAGG - Intronic
1085821868 11:79802394-79802416 CTGGTGCTTTTGAGGGCTTAGGG + Intergenic
1086824312 11:91476149-91476171 GTGGTCATTTGGAGGTAAGAAGG - Intergenic
1086878060 11:92121581-92121603 CTGGTGAGTTTGAAAGAAGCTGG + Intergenic
1087530032 11:99368912-99368934 CTGGAGAATGTCAGGGAAGAGGG + Intronic
1087620002 11:100529637-100529659 GTGGTCATTTGGAGGAAAGAAGG - Intergenic
1089082399 11:115787914-115787936 CTGCTGACCTTGGGGGAAGAAGG + Intergenic
1089595034 11:119573174-119573196 CTGTTGATTTTGGGAGAACAAGG + Intergenic
1089749045 11:120637221-120637243 CGGGTGTTCTTGAGGGAAGCAGG + Intronic
1091088307 11:132745280-132745302 CTGGTGAGTTTCATGGAACATGG - Intronic
1091410430 12:235662-235684 CTAGCGATTTTTAGGGAACAAGG + Intronic
1091699391 12:2650235-2650257 CAGGAGATTATGAGGGAAGCAGG - Intronic
1091757208 12:3061827-3061849 GAGGTGATCTTTAGGGAAGAGGG - Intergenic
1092140006 12:6177427-6177449 CTGGTGATTTATTGGGTAGATGG - Intergenic
1092334176 12:7614434-7614456 CTGGTGAGGTTGAGGCAAAAAGG + Intergenic
1093122981 12:15295199-15295221 CTGCTGATTTTCAGGGACCAAGG - Intronic
1093824584 12:23668087-23668109 CTAGTGTTTATGAGGCAAGAGGG + Intronic
1093908478 12:24719468-24719490 CTGGAGACTGTGAGGGAAGAGGG - Intergenic
1095190457 12:39251791-39251813 CTGTTGATTTGGAGGTATGAGGG - Intergenic
1095260995 12:40099395-40099417 CAGGTGATTTTGGGTAAAGATGG + Intronic
1095277153 12:40299832-40299854 GTGGTGGTGGTGAGGGAAGAAGG + Intronic
1095543608 12:43340321-43340343 GTAGTGATATTGAGGGAGGATGG - Intergenic
1096096378 12:48938330-48938352 TTGGTGAGATTAAGGGAAGAAGG - Exonic
1096256791 12:50067259-50067281 ATGGTGATGATGGGGGAAGAAGG - Intronic
1097229185 12:57498766-57498788 CAGGCATTTTTGAGGGAAGATGG + Intronic
1097331657 12:58338317-58338339 CTGGTGATTTTGATAGAAGAGGG - Intergenic
1098050401 12:66446834-66446856 CTATTCATTTTGAAGGAAGATGG - Intronic
1099619668 12:84985629-84985651 TTGGTGATGTTGAAGGAAAATGG - Intergenic
1099931984 12:89085468-89085490 CTCGTGAGTTTGTGGGAAGAGGG + Intergenic
1100770008 12:97911280-97911302 CTGGTGATTTGGGGGAAAGGAGG + Intergenic
1101644772 12:106621009-106621031 ACGGTGATTTTTAGGGAACAAGG - Intronic
1102820159 12:115901793-115901815 CTGGGGATTTTGGAGGAGGACGG + Intergenic
1102996922 12:117358518-117358540 CTGGTGATTGTAAGGAAGGAAGG - Intronic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103027724 12:117587392-117587414 CTGCTGGTTTTGAAGGAGGAGGG + Intronic
1104272038 12:127290978-127291000 TTGGTGTGTTTGAGGGACGAAGG - Intergenic
1105274913 13:18911764-18911786 CTGGTGAGATTGTGGGGAGAAGG - Intergenic
1106033740 13:26025524-26025546 CTGGTGATGCAGAGGGAAGCAGG + Exonic
1106323656 13:28666766-28666788 GTGGTGATAGTGATGGAAGATGG + Intronic
1106436694 13:29729575-29729597 CTGATGTTTTTGGGGGCAGAGGG + Intergenic
1107174618 13:37386059-37386081 CTACTGAGTATGAGGGAAGAGGG - Intergenic
1108193184 13:47964283-47964305 CTAGTGATTTTCAGGGCACAGGG + Intronic
1109272703 13:60272238-60272260 GTGTGGATTTTGAGGGAAGCTGG - Intergenic
1110109818 13:71732277-71732299 TTGGTGATTTTTAGGCAAAAAGG - Intronic
1110860943 13:80343555-80343577 CTGGAGATTGTGAGGAAAGGGGG - Intergenic
1111436467 13:88216249-88216271 CTGGTGTTTTAGAGGGAGCATGG + Intergenic
1111800038 13:92969902-92969924 CTGGTGAACATGTGGGAAGAAGG + Intergenic
1111807954 13:93061614-93061636 CTGATGATTTTGAGGGAGAAGGG + Intergenic
1111910828 13:94310396-94310418 CTGGTCATTCTGAGGGAATTTGG + Intronic
1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG + Exonic
1112471434 13:99693349-99693371 CTGGTGATTTTAAGGGAAGGAGG - Intronic
1114251674 14:20967144-20967166 CTGGGAATGTTGGGGGAAGAAGG + Intergenic
1114933528 14:27505965-27505987 GTGGTCATTTGGAGGAAAGAAGG + Intergenic
1115105066 14:29750768-29750790 ATTGTAATTTTGAGGGAAAAAGG - Intronic
1116200781 14:41792692-41792714 ATAGTGATTTTTAGGGAACAAGG - Intronic
1117881600 14:60318121-60318143 CTGGTGCTGTTATGGGAAGATGG - Intergenic
1118055700 14:62077476-62077498 CTGGTGATTTTGAGCACACAGGG + Intronic
1118216386 14:63812366-63812388 ACAGTGATTTTCAGGGAAGAAGG - Intergenic
1118799678 14:69178083-69178105 CTAGTGCCTTTAAGGGAAGAAGG + Intergenic
1119053277 14:71391821-71391843 CAAGTGATTCTGAGGAAAGAAGG + Intronic
1119796674 14:77404464-77404486 ATGGTGAGTTTGAGTGGAGATGG + Intronic
1119924335 14:78478198-78478220 CTAGTGATTTGGGGGGAAAATGG + Intronic
1120242603 14:81966647-81966669 GTGAAGATTTTGAGGGTAGAGGG + Intergenic
1120397067 14:83981632-83981654 ATAGTGATTTTTAGGGAACAAGG + Intergenic
1120734787 14:88040841-88040863 CTGGTGATCTTGATGTAAGTTGG - Intergenic
1125005089 15:34807780-34807802 ACAGTGATTTTTAGGGAAGAAGG - Intergenic
1125492678 15:40159963-40159985 CTGATGATTCAGAGGAAAGAAGG + Intergenic
1127044548 15:55011856-55011878 CTGGAGATTTCTAGGGAAGAGGG - Intergenic
1127680819 15:61296184-61296206 CTAAAGATGTTGAGGGAAGAAGG - Intergenic
1128003053 15:64212008-64212030 CTTGTCATTGTGAAGGAAGAAGG + Intronic
1128299983 15:66560577-66560599 CTGGGAATTTTGAAGGAGGAAGG - Intronic
1128329929 15:66749015-66749037 CTGGTAATTTTGAACCAAGAAGG - Intronic
1128484126 15:68068395-68068417 CTGGTGATGTTTGTGGAAGAAGG + Intronic
1129792674 15:78351994-78352016 CTGGGGGTTTTGAGGGGAAATGG + Intergenic
1130760001 15:86809343-86809365 CAGGGGCTTTTGAGGGTAGAAGG - Intronic
1131283512 15:91039627-91039649 CTGGTCCATTTGAGGAAAGATGG - Intergenic
1131405537 15:92161270-92161292 CAGGTGATTCTGAGTGAAGGGGG - Intronic
1131443571 15:92476969-92476991 CTGGTGTTTCTGGGGGAGGATGG + Intronic
1131590044 15:93739416-93739438 GTGGTCATTTTGAGGAAAGAAGG + Intergenic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1135157775 16:20068347-20068369 CTGGTGTTTTTAAGGGAACTTGG + Intronic
1138606620 16:58094067-58094089 GAGGTGATTTTTGGGGAAGATGG - Intergenic
1139734165 16:68973034-68973056 CTGCTCATATTCAGGGAAGAAGG + Intronic
1141125578 16:81398326-81398348 CTGGTGATATTGAGGAAATGAGG - Intergenic
1141305068 16:82855157-82855179 CTGCTGACTCTTAGGGAAGAGGG - Intronic
1141362379 16:83407953-83407975 CTGGGAATGTTGTGGGAAGAGGG - Intronic
1141558855 16:84853673-84853695 CTGATGCTTTCCAGGGAAGATGG - Intronic
1141703484 16:85652807-85652829 CTGCTGATCTTGTGGGGAGACGG + Intronic
1143383166 17:6508844-6508866 CTGGCGGTTTCCAGGGAAGATGG - Intronic
1144071186 17:11672504-11672526 CTGGTGATTTTGAGGGAAGATGG - Intronic
1147705064 17:42420737-42420759 ATGGAGATTCTGAGAGAAGAGGG - Intronic
1148781299 17:50123564-50123586 TTGGTGGTTTTGAGGCAAGGTGG + Intronic
1149221026 17:54415299-54415321 CAGGTGAGTTTAAGGGAAGTAGG - Intergenic
1150122337 17:62614567-62614589 CAGGCGATCTTAAGGGAAGATGG + Intronic
1150687005 17:67328948-67328970 CTGGTGATTAGGAGGGGAGGTGG + Intergenic
1151320730 17:73350829-73350851 CAGGAGATTTGGAGGGAGGAGGG - Intronic
1151558125 17:74857168-74857190 CTGGGGAGTTTGAGGGAAGTAGG - Intronic
1151586016 17:75008978-75009000 GTGGTGATCAGGAGGGAAGAAGG - Intergenic
1151617584 17:75224425-75224447 CTGGACATTTTGTGAGAAGATGG + Intronic
1152175045 17:78782003-78782025 CAGGGGGTTTTGAGGGATGAGGG - Intronic
1153210404 18:2756480-2756502 CTGGTGTTTTTGTGGGGGGAAGG + Intronic
1154405930 18:14091316-14091338 CTGGTGATTTTGACAGGAAATGG - Intronic
1155060494 18:22223953-22223975 CTGGTGCTTCTGAGGGCAGGTGG - Intergenic
1157461085 18:47894604-47894626 CTGGTGATTTTGAGTTGAGCGGG - Intronic
1158848743 18:61472344-61472366 CCAGTAACTTTGAGGGAAGAAGG - Intronic
1159097130 18:63916468-63916490 TTGGTAATTCTGAGGGAAGTGGG + Intronic
1159328207 18:66951192-66951214 GTTGTTATTTTGAGGGCAGATGG + Intergenic
1159372548 18:67546852-67546874 ATGGAGACTTTGAGGGACGATGG - Intergenic
1159542780 18:69800539-69800561 CTGGTTATTTGGGGGGAAAAGGG + Intronic
1159825780 18:73208698-73208720 TTGGTGATTCTGTGGGAATATGG - Intronic
1160109219 18:76009516-76009538 CTGGTGAGGTTGAGGGGAAAAGG - Intergenic
1160910578 19:1472045-1472067 CAGGTTGTTTTGGGGGAAGAGGG + Exonic
1162262786 19:9546181-9546203 CGGGTGAGTTTAAGGGAAGTAGG - Intergenic
1163133362 19:15290790-15290812 CCTGTGTTTATGAGGGAAGAGGG - Intronic
1164712986 19:30372211-30372233 TTGGTCATTTTGAGGGAAAGGGG + Intronic
1165014907 19:32873785-32873807 CTGCTGATTTTGGGGAAAGAGGG + Intergenic
1165254884 19:34570385-34570407 CTGGTGAATTTGAGGTTAGACGG + Intergenic
1165830614 19:38728590-38728612 CTGGAGACTTCTAGGGAAGAAGG - Intronic
1166905253 19:46103828-46103850 CGGGTGAGTTTAAGGGAAGTAGG + Intergenic
1167017638 19:46851294-46851316 CTGGTGATTTGGAAGGCTGAGGG - Intergenic
1167495927 19:49818706-49818728 CTCCTGAGTTTGAGGGAGGAGGG + Intronic
1167669139 19:50839458-50839480 CTGGGGAGTCTGAGGGAGGAGGG + Intergenic
1168147844 19:54429742-54429764 CTCCTGAGTCTGAGGGAAGAGGG + Intronic
1168236063 19:55063709-55063731 CTGCTGAGTCTGAGGGAGGAGGG + Intronic
925038252 2:708837-708859 CTGGGGGATTTGAGGGGAGACGG + Intergenic
926902760 2:17773544-17773566 ATGGATATTTTGGGGGAAGAGGG + Intronic
928484807 2:31718809-31718831 CAGGTTATTTGGAGGAAAGAGGG - Intergenic
929280391 2:40072008-40072030 GTGGTGATTTGGAGGAAAGAGGG + Intergenic
929382160 2:41365778-41365800 GTGGTCATTTGGAGGAAAGAAGG - Intergenic
929547754 2:42866730-42866752 CTGGTGTTCTTGAGCGATGATGG - Intergenic
930456144 2:51609934-51609956 ATAGTAATTTTGAGGCAAGATGG + Intergenic
930814375 2:55577458-55577480 ATGGTTATTTTGAGGGTAAAAGG - Intronic
932177347 2:69614923-69614945 CTGGAGCTTTTGAGGGAGCACGG + Intronic
932342563 2:70975552-70975574 CAGGTGATTTTGAGGGAGAAGGG - Intronic
932966286 2:76479077-76479099 CTGCTGATGATGGGGGAAGAGGG + Intergenic
933555133 2:83822632-83822654 GTGGTCATTTGGAGGAAAGAAGG + Intergenic
934616427 2:95774189-95774211 CTTGTGATTATGAGGGAAGCTGG + Intergenic
934644466 2:96050371-96050393 CTTGTGATTATGAGGGAAGCTGG - Intergenic
934837882 2:97606461-97606483 CTTGTGATTATGAGGGAAGCTGG - Intergenic
935784262 2:106534568-106534590 CTGGTGAATTTGACAGAAGGGGG + Intergenic
936634164 2:114236332-114236354 TTAGTGAGTTTGAGGGAAGATGG - Intergenic
936650767 2:114423473-114423495 CTGGTGAACCTCAGGGAAGAAGG + Intergenic
937606712 2:123808886-123808908 GTGGTCATTTGGAGGAAAGAAGG - Intergenic
938102198 2:128504791-128504813 CTGTTGATTCTGTTGGAAGATGG + Intergenic
939320714 2:140617217-140617239 CTGGTAGTTTTGAGATAAGAGGG - Intronic
940206911 2:151213167-151213189 GTGGTGGTTTCCAGGGAAGAGGG + Intergenic
940975488 2:159938723-159938745 CTGGTAGTGTTGAGGGGAGAAGG - Exonic
941932154 2:170952984-170953006 GTTTTGATTGTGAGGGAAGAAGG + Intronic
941938351 2:171005443-171005465 CTGGTGGTTTTTGTGGAAGATGG - Intronic
942255521 2:174093205-174093227 TTGGGGATTTGGTGGGAAGATGG + Intronic
944560945 2:200937164-200937186 GTGGTGATTAAGAAGGAAGAGGG + Intronic
945846237 2:214948479-214948501 CAGGTGGTTTTGAGGGGAAATGG + Intronic
947263436 2:228251118-228251140 GTGGTCATTTGGAGGTAAGAAGG + Intergenic
947691539 2:232141457-232141479 CTGGTGGTTTTGAGGGGTGGAGG + Intronic
947946638 2:234109344-234109366 CGGGAGATTTTGAGGGCAGAGGG + Intergenic
948167510 2:235874385-235874407 CTGGTGATGTAGAAGGAAGTTGG + Intronic
1169501566 20:6165712-6165734 CTGGTCATGGTTAGGGAAGAGGG + Intergenic
1171177615 20:23064970-23064992 CTGCTGATTTCTAGGGTAGATGG + Intergenic
1172850106 20:37955623-37955645 CTGGAGAATTTGAGGGGACACGG + Intergenic
1173010644 20:39178580-39178602 CTGGTGGGTTTTAGGGAAGGTGG + Intergenic
1173137263 20:40449608-40449630 CTGGTGATTTGAAGTGAACAGGG - Intergenic
1173649936 20:44656805-44656827 GAGGTGATTTTGAGGGCATATGG + Intergenic
1173666124 20:44764250-44764272 TTGGTGAGTTTGTGGGAGGATGG - Intronic
1174273452 20:49386096-49386118 CAGGTGATCTTGAGCTAAGAAGG - Intronic
1174416609 20:50371565-50371587 CTGGTGAGTGTGGGGGAAGTAGG + Intergenic
1174684869 20:52445016-52445038 CAGGTGATGTTGTGGGAAGAGGG - Intergenic
1175092994 20:56520172-56520194 CTGGCCAGCTTGAGGGAAGAAGG + Intronic
1175476180 20:59276312-59276334 GTGGTGATTTTCTGGGAAGAAGG + Intergenic
1176210283 20:63916933-63916955 ATCGTGATTTTCAGGGAACAAGG - Intronic
1179330009 21:40390747-40390769 CTGGTGTTTTTGTAAGAAGAGGG - Intronic
1181096935 22:20511777-20511799 CTTGTGCTGTTGGGGGAAGAAGG - Intronic
1182320331 22:29474858-29474880 CTGGTTGTCTTGAGGGAAGGAGG - Intergenic
1183544531 22:38448538-38448560 CTGGGGATTTTCTGGGGAGAAGG + Intronic
1184384541 22:44166817-44166839 CAGCTGATTTTGAATGAAGAAGG - Intronic
1185310057 22:50149360-50149382 CTAGAGATGTGGAGGGAAGAAGG - Intronic
949155106 3:817336-817358 CTGGTGATTCTCAGGAAACAGGG + Intergenic
949602150 3:5611767-5611789 CTGGGGACTTTAAGGGAACATGG + Intergenic
950157307 3:10731510-10731532 ATGGTTATTTTTTGGGAAGAAGG + Intergenic
951089520 3:18556043-18556065 CAGGGGATTTGGAGGAAAGATGG - Intergenic
951258889 3:20482719-20482741 GTGGTCATTTGGAGGAAAGAAGG - Intergenic
951742532 3:25940234-25940256 CTGGTCACTTTGAGGGAATAAGG + Intergenic
951771778 3:26265744-26265766 GTGGTCATTTTGAAGGAATAGGG - Intergenic
952735010 3:36680777-36680799 CTGGTGAATCTGTGAGAAGAGGG - Intergenic
953486499 3:43302574-43302596 CTGGGGATATTGAGGAGAGAAGG + Intronic
953816440 3:46162346-46162368 GTGGTCATTTGGAGGAAAGAGGG + Intergenic
953889611 3:46742539-46742561 CTTGTGAAGTTGAGGGCAGATGG - Exonic
954456207 3:50601109-50601131 CTGGTGACCTTGAGGGAAGTAGG - Intergenic
955182401 3:56683888-56683910 CTGGGGAGTTTGAGGGGAGGAGG + Intergenic
955895450 3:63694763-63694785 CTGGTGATACTGAGGCAAAAAGG + Intergenic
956098536 3:65743351-65743373 TGGGTGATTTAGAAGGAAGATGG - Intronic
956251340 3:67237449-67237471 CATGTGATTCTGATGGAAGATGG - Intergenic
956850599 3:73224817-73224839 CTGGTCATTTTGAGGGTGGGAGG + Intergenic
958847673 3:99284852-99284874 CTGTTTATTTTGAAGGAAAAGGG + Intergenic
958940278 3:100304636-100304658 CTGGTGCTTGGGTGGGAAGAAGG - Intronic
959005281 3:101012708-101012730 ACAGTGATTTTCAGGGAAGAAGG - Intergenic
959157472 3:102684523-102684545 TATGTGATTTTCAGGGAAGATGG - Intergenic
959242121 3:103809251-103809273 GTGGTCATTTGGAGGAAAGAAGG - Intergenic
959578852 3:107963791-107963813 CTGGTGATTAGCAGGGGAGATGG + Intergenic
959825464 3:110789895-110789917 GTGGTCATTTGGAGGTAAGAAGG + Intergenic
959968763 3:112384885-112384907 CTGGTGTTTTTGAGAGATGAGGG - Intergenic
960754860 3:121000662-121000684 ATGGTCATTTGGAGGTAAGAAGG + Intronic
960975499 3:123169880-123169902 CTGGTGACAGTTAGGGAAGAGGG - Intronic
961075445 3:123977755-123977777 CTGAAAATTTTGAGGGAAGATGG - Intronic
961308241 3:125974761-125974783 CTGAAAATTTTGAGGGAAGATGG + Intronic
961315883 3:126035350-126035372 CTGGTGATGAGGAGGGAAGGAGG + Intronic
962241719 3:133755831-133755853 CTGCTGAGATTGAGGGAAGAGGG - Intronic
962809895 3:138950757-138950779 CTGGTGAGTGTGAGAGAAGTAGG - Exonic
963337190 3:143988638-143988660 CTTATGATTTTGAGGTAAGAGGG - Intronic
963737797 3:149039868-149039890 GTGGTGAATTTGAGGGGAAATGG - Intronic
964165284 3:153697259-153697281 CTGGCGATTTAGGGGGCAGAAGG + Intergenic
964506428 3:157405031-157405053 CTGGTGTCTGTGAGGGAAGTAGG - Intronic
965585479 3:170314186-170314208 CTGCTGATTTCTAGGGAAGGAGG + Intergenic
966092142 3:176152835-176152857 CTTATGATTTTGTGGGAATATGG - Intergenic
966774660 3:183533379-183533401 CTGGGGAGCCTGAGGGAAGAGGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969202158 4:5615027-5615049 CTGGTGAGTTTGTGGGAACATGG + Intronic
970101311 4:12525231-12525253 ATGGTCATTTGGAGGAAAGAAGG - Intergenic
971654392 4:29323751-29323773 CTGGGGAATGTGAGCGAAGAAGG + Intergenic
972488387 4:39563668-39563690 ATGGAGATTTTTATGGAAGAGGG - Intronic
973090284 4:46127071-46127093 CTGGTTATTTTGTGAGATGATGG - Intergenic
974806781 4:66890808-66890830 CCTCTGATTTAGAGGGAAGATGG + Intergenic
975521964 4:75311091-75311113 CTAGTGAAGTTGTGGGAAGAGGG + Intergenic
976077090 4:81312144-81312166 CTGAGGATTTGGAGGCAAGAAGG + Intergenic
976819971 4:89195161-89195183 CTGCTGATTTTTAGGCATGAAGG - Intergenic
977211835 4:94227187-94227209 CTGGTGTTTTTGAGGAAAGTGGG + Intronic
977791358 4:101107531-101107553 CTGGTGATGATGAGGGAAGAAGG - Intronic
977927678 4:102719358-102719380 ACGGCGATTTTCAGGGAAGAAGG - Intronic
979341498 4:119529843-119529865 CTGATGAGTTTGAAGGCAGAGGG + Intronic
979452619 4:120890602-120890624 CTGGTGAGGTTGTGGGAAAAAGG - Intronic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
981575302 4:146197866-146197888 CTGGTGATTTTGTGGGCAGTTGG + Intronic
981650019 4:147046767-147046789 CTGGTAAATTTGAGAGAACAAGG - Intergenic
981838007 4:149077914-149077936 CTGCTGTTTTTAAGGGAAAATGG - Intergenic
982371395 4:154637362-154637384 CTTGTGGTTCTGAGGAAAGAAGG + Intronic
982524140 4:156456365-156456387 CTGGTGAGGTTGAGGAAAAAAGG + Intergenic
982659591 4:158191216-158191238 ATGGTGATTATGTGGGAAGAAGG + Intergenic
982819147 4:159924789-159924811 CTGATGATTTTGAGCAAAGAAGG + Intergenic
983438400 4:167747976-167747998 TTTGTGATTTTCAGGGAAAACGG + Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
984725699 4:183018468-183018490 CTGATTATTTTGACAGAAGATGG + Intergenic
985489870 5:172894-172916 CAGGTGAATTTGAAGGAACAGGG + Exonic
985699337 5:1361110-1361132 CTAGGGGTTTTGAGGGCAGAGGG + Intergenic
986319045 5:6612930-6612952 CTGGTGATTTTGACTGGAGGGGG - Intronic
986800278 5:11252909-11252931 CTCTTGATTTAGAGGGGAGAAGG - Intronic
987262506 5:16217760-16217782 CATGTGATTTTGAGGGCAGATGG + Intergenic
988584628 5:32497774-32497796 TTAGTGCTTTTGGGGGAAGAAGG + Intergenic
988753435 5:34216822-34216844 CAGTTGATTTTGAAGTAAGAAGG - Intergenic
989161971 5:38399810-38399832 CTGCTCCTTTTGAGTGAAGATGG + Intronic
990373663 5:55147930-55147952 CTGGTGTTTCTTAGAGAAGATGG - Intronic
991354271 5:65751344-65751366 CTTGTGATGATGAGGGAAGATGG + Intronic
991741217 5:69677671-69677693 CAGTTGATTTTGAAGTAAGAAGG - Intergenic
991756401 5:69876771-69876793 CAGTTGATTTTGAAGTAAGAAGG + Intergenic
991792791 5:70257408-70257430 CAGTTGATTTTGAAGTAAGAAGG - Intergenic
991820677 5:70553744-70553766 CAGTTGATTTTGAAGTAAGAAGG - Intergenic
991835803 5:70752684-70752706 CAGTTGATTTTGAAGTAAGAAGG + Intergenic
991885241 5:71257716-71257738 CAGTTGATTTTGAAGTAAGAAGG - Intergenic
992371388 5:76147577-76147599 CTGGGGAATTTGAGAGTAGAGGG + Intronic
992495549 5:77289793-77289815 CCTGTGATCTTGTGGGAAGAGGG + Intronic
993204830 5:84865113-84865135 CTGGTGATGGAGAGGGGAGAGGG - Intergenic
995910743 5:117183615-117183637 CTGGTGTTTTGGAGGGATGTGGG + Intergenic
996273304 5:121635119-121635141 TGGGTGATTATGGGGGAAGATGG + Intergenic
996410834 5:123156875-123156897 CGAGGGATTTTGAGAGAAGAAGG - Intronic
996663279 5:126028325-126028347 GTGGTCATTTGGAGGAAAGAAGG - Intergenic
996725285 5:126668919-126668941 CAGGTGAGTTTAAGGGAAGTAGG + Intergenic
997529121 5:134571359-134571381 CTGGAGGTTTTAAGGGGAGAAGG + Intronic
998167439 5:139852198-139852220 CTGGTGCTCCCGAGGGAAGAAGG + Intronic
998870208 5:146544238-146544260 CTTGAGATTTTGAAGGTAGAAGG + Intergenic
998907760 5:146924771-146924793 CTTGTGATTTTTAGTAAAGAGGG - Intronic
999179538 5:149659428-149659450 CAGGTGATTCTGATGGAAGCAGG - Intergenic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
999892615 5:155995126-155995148 CAGGTGATTTTCAGGTAACAGGG - Intronic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1001881837 5:175251257-175251279 CGGGGGATTTTAAGGGAACAAGG + Intergenic
1001961216 5:175881146-175881168 GTGGGGATGGTGAGGGAAGAGGG + Exonic
1002939836 6:1706242-1706264 CTGATGATTCTGAGGGGAGGTGG + Intronic
1003300954 6:4882570-4882592 CTGGTTCTTTTGGGAGAAGAAGG + Intronic
1004708244 6:18144684-18144706 CTGGTAATTTTGAGGAAAAGAGG + Intronic
1005061502 6:21780934-21780956 CTGGTAGTTGTAAGGGAAGACGG - Intergenic
1005551604 6:26923644-26923666 CAGTTGATTTTGAAGTAAGAAGG - Intergenic
1006600259 6:35220685-35220707 TTGGTGATTTGAAGGGAAGGGGG - Intronic
1006670799 6:35728703-35728725 CTAGTGGTTTTGAGGGGAGGGGG - Intergenic
1006885515 6:37378654-37378676 CAGGTGATCTTTAGGGAAGTTGG + Intronic
1007187019 6:39980551-39980573 CTGCTGATAGTGAGGGGAGACGG + Intergenic
1007354086 6:41297767-41297789 ATGGTGATTTTCAGGGAACAAGG - Intergenic
1008026325 6:46640218-46640240 CTGTAGATTTTGAGGGAGAAGGG - Intronic
1008143384 6:47859029-47859051 TTATTCATTTTGAGGGAAGAAGG + Intergenic
1008181659 6:48338609-48338631 TAGGTTATTTTGAGGAAAGAAGG - Intergenic
1009289637 6:61867505-61867527 GTGGTCATTTGGAGGGAAGGCGG + Intronic
1009643860 6:66372465-66372487 GTGGTCATTTGGAGGAAAGAGGG + Intergenic
1009922506 6:70079658-70079680 TTGGTGATCTTGAAGGAAGCTGG + Intronic
1010898480 6:81396126-81396148 CTGTTGTTTTGGAGGGAATAAGG - Intergenic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1014325924 6:119993199-119993221 CTGGTGTTTTCTAGGGAATAAGG + Intergenic
1014383531 6:120774088-120774110 CAGGTGATTTTGAGGCATGTGGG + Intergenic
1014437821 6:121439775-121439797 CTGCTTATTTTGGGGGCAGAGGG - Intronic
1014594248 6:123313339-123313361 ATAGTCATTTTAAGGGAAGATGG + Intronic
1014661155 6:124174010-124174032 CTGGCCATTTTGAGGCAAGAAGG + Intronic
1014778513 6:125537435-125537457 CTGGTGCTGTGGAGTGAAGAAGG - Intergenic
1015503315 6:133954800-133954822 ATACTGATTTTGAGGGCAGAGGG - Intronic
1019165631 6:170095877-170095899 TTGGGGATTGTGAGGGAACAAGG + Intergenic
1019353778 7:568535-568557 CTGATGATGTTGAGTGAAGCCGG - Intronic
1019887478 7:3918115-3918137 CTGTTGAGTTTGAGGTGAGAGGG - Intronic
1020382137 7:7558047-7558069 GTGGTCATTTGGAGGAAAGAAGG - Intergenic
1020816641 7:12913719-12913741 CTAGGGATTTTGAGGGAATGAGG + Intergenic
1021066965 7:16187716-16187738 TTGGTAATTTTGAGGGAATATGG + Intronic
1021425757 7:20497047-20497069 ATGGTCATTTGGAGGAAAGAAGG - Intergenic
1021689796 7:23221010-23221032 ATGGGGATTTTGAGAGAAGATGG - Intergenic
1023044392 7:36198643-36198665 CTTTCGATTTTCAGGGAAGAAGG - Intronic
1023090014 7:36608827-36608849 CTGGACACTTTGAGAGAAGAGGG - Intronic
1023367159 7:39475425-39475447 GAGGGGCTTTTGAGGGAAGATGG + Intronic
1026480262 7:70772660-70772682 CAGGTGATTTTGAAGGGGGAGGG - Intronic
1027440612 7:78215543-78215565 GTGATGATTTTTTGGGAAGAAGG + Intronic
1027724840 7:81791036-81791058 CTGGGAATCTTCAGGGAAGAGGG - Intergenic
1031723457 7:125206819-125206841 CTGGTGATTAGGCAGGAAGATGG + Intergenic
1032498178 7:132378550-132378572 CTGGTAGTTTTTAGGGAATAAGG - Intronic
1032529740 7:132610244-132610266 CTGGGGAATTTCTGGGAAGATGG + Intronic
1032543166 7:132721148-132721170 CTGGTGATTCAGAAGGAAGCAGG - Intronic
1033612920 7:142983559-142983581 GTGGTCATTTGGAGGAAAGAAGG + Intergenic
1033711600 7:143951675-143951697 GTGGAGTTTTTGAGGGGAGAGGG + Intergenic
1034778796 7:153858141-153858163 CTTGTCATTTTGAAGAAAGAAGG - Intergenic
1036735884 8:11316081-11316103 CTGTTCATTTTGGGAGAAGAGGG + Intronic
1036769233 8:11567237-11567259 CTGGAGATCTTGAAGGATGAGGG + Intergenic
1037517998 8:19652938-19652960 CTGGAAAATTTGAGGGTAGAGGG - Intronic
1037889729 8:22617528-22617550 CTGTTGCTTCTGAGGGATGATGG + Exonic
1038491929 8:27977628-27977650 CTGGGGGTTTTTAGGGAGGAAGG - Intronic
1038495356 8:27998181-27998203 CTCATAATTTTGAGGGGAGAGGG - Intergenic
1045164345 8:99586602-99586624 GTGGTGGTTTTGTGGGGAGAGGG + Intronic
1045672852 8:104575715-104575737 GTGGTCATTTGGAGGGAAAAAGG - Intronic
1046922320 8:119745195-119745217 CTGGTCTTTTTGGGGGGAGAAGG + Intronic
1046942752 8:119946899-119946921 CTGGAGAGGGTGAGGGAAGAAGG - Intronic
1047631015 8:126708583-126708605 TTGGGGATTGAGAGGGAAGATGG - Intergenic
1047648838 8:126898403-126898425 CTGGTGATTTTAGGAGAAAAGGG - Intergenic
1048773134 8:137916972-137916994 CTGGTGTTTTTGAGGGATTTGGG - Intergenic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1049522846 8:143103207-143103229 CAGGTGATTACGAGGGGAGAGGG - Intergenic
1049867034 8:144946015-144946037 CTGCTGATAGTGAGGGCAGATGG + Exonic
1050391160 9:5145999-5146021 GTGGTCATTTGGAGGAAAGAAGG + Intronic
1051054032 9:12962362-12962384 CTGATGATTTTGAGGGATCCAGG - Intergenic
1051515053 9:17921263-17921285 CTGGTGCTGTTGAAAGAAGAGGG - Intergenic
1051671584 9:19516009-19516031 TTGGTGAATTTGAGGAGAGATGG - Exonic
1051807241 9:21008614-21008636 CTGGTGGTTAAGAAGGAAGAAGG - Intronic
1051822170 9:21181135-21181157 ATGGGGATTCTCAGGGAAGAGGG - Intergenic
1051825224 9:21211733-21211755 ATGGGGATTCTCAGGGAAGAGGG - Intronic
1052125949 9:24774608-24774630 ATAGTGATTTTCAGGGAACAAGG - Intergenic
1053163278 9:35828414-35828436 CAGATGTCTTTGAGGGAAGAGGG + Intronic
1053405314 9:37870138-37870160 CTGCTGGTTTTGAAGGAAGAAGG - Intronic
1053542787 9:38992719-38992741 GTGGTCATTTGGAGGGAAGAAGG + Intergenic
1053807235 9:41816236-41816258 GTGGTCATTTGGAGGGAAGAAGG + Intergenic
1053826701 9:42032366-42032388 CTGTGGATTTTAAGTGAAGATGG - Intronic
1054603858 9:67155057-67155079 CTGTGGATTTTAAGTGAAGATGG + Intergenic
1054623357 9:67371191-67371213 GTGGTCATTTGGAGGGAAGAAGG - Intergenic
1055341453 9:75288462-75288484 GTGGTCATTTGGAGGAAAGAAGG + Intergenic
1055693835 9:78861544-78861566 CAGGTGATTTTTGGGGAGGAAGG - Intergenic
1056515404 9:87344820-87344842 CTGGTGATTTTGAGTTTTGATGG + Intergenic
1059071040 9:111136206-111136228 ATGGTAATTTTGGGGGAAAAAGG - Intergenic
1059134772 9:111794845-111794867 AGGGTGATTTTGAGGGCTGAGGG - Intronic
1059712214 9:116879003-116879025 CTGGTGATCTGGATGGCAGAGGG + Intronic
1060333782 9:122702442-122702464 ATGGTGGTTTCCAGGGAAGAGGG + Intergenic
1060336719 9:122730639-122730661 ATGGTTGTTTGGAGGGAAGAAGG - Intergenic
1062296786 9:135834902-135834924 CTGGTGACCGCGAGGGAAGATGG - Intronic
1062531181 9:137001131-137001153 CTGGTTCCTTTTAGGGAAGATGG - Intergenic
1062668940 9:137694979-137695001 CTGGTGAGTGTGAGGTCAGAGGG - Intronic
1186046144 X:5538442-5538464 CTGCAGATTCTGAGAGAAGAGGG - Intergenic
1187758012 X:22547275-22547297 GTGCTGATTTGGAGGGGAGAAGG + Intergenic
1190523973 X:51310200-51310222 GTGGTCATTTGGAGGAAAGAAGG + Intergenic
1191642560 X:63443070-63443092 GTGGTCATTTGGAGGAAAGAAGG - Intergenic
1191884900 X:65878257-65878279 GTTGTGGTTTTGAGGGAAAAGGG - Intergenic
1192011593 X:67278656-67278678 GTGGTCATTTGGAGGAAAGAAGG - Intergenic
1192057707 X:67788994-67789016 CTTGTGATTTAGAAGGAAGCTGG + Intergenic
1192261455 X:69508147-69508169 CTGGGTCTTTTGTGGGAAGAAGG + Intronic
1193817819 X:86125430-86125452 TTGGAGATTTCCAGGGAAGAGGG + Intergenic
1193823670 X:86196030-86196052 ATGGTCATTTGGAGGAAAGAAGG - Intronic
1194716996 X:97298047-97298069 CTTGTGATTTTGAGGGCTTAGGG + Intronic
1194793160 X:98176349-98176371 ATAGTGGTTTTGAGGGAAAAAGG - Intergenic
1194824418 X:98543795-98543817 ATAGTGATTTTGAGCAAAGAGGG + Intergenic
1195104689 X:101592952-101592974 GTGGTCATTTGGAGGAAAGAAGG + Intergenic
1195215586 X:102698257-102698279 CTGGTGAGTTTGAAGCAAGTAGG - Intergenic
1196475522 X:116080193-116080215 ATGCTGAGTTTGAGGGAACATGG + Intergenic
1197625914 X:128802418-128802440 CTTGTGATTTTGGGGGAATATGG - Intergenic
1198052847 X:132965135-132965157 CTGGAGAATTTGAAGGAAGCAGG + Intergenic
1198824257 X:140682775-140682797 ATAGTGATTTTTAGGGAACAAGG + Intergenic
1199738274 X:150706165-150706187 CTGGTGACTTTATAGGAAGACGG - Intronic
1199819107 X:151427136-151427158 CAGGTGATTTTGGAGGACGAAGG + Intergenic
1200573936 Y:4865920-4865942 TTGGTGTTTCTGTGGGAAGAAGG - Intergenic
1201229177 Y:11846413-11846435 GTGGTCATTTGGAGGAAAGAAGG - Intergenic