ID: 1144073815

View in Genome Browser
Species Human (GRCh38)
Location 17:11699442-11699464
Sequence TGGATTGGTCTACTATAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144073815_1144073818 7 Left 1144073815 17:11699442-11699464 CCTATCTATAGTAGACCAATCCA 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1144073818 17:11699472-11699494 TCAAACCATTGTGACTTAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144073815 Original CRISPR TGGATTGGTCTACTATAGAT AGG (reversed) Intronic
906543112 1:46603377-46603399 TGGATTGGGGTACTTTAGAAAGG - Intronic
912689821 1:111796380-111796402 TGGTCTGGTCTACCATTGATAGG - Intronic
913428838 1:118766335-118766357 TGGATTGGGATAGCATAGATAGG + Intergenic
918749289 1:188251980-188252002 TGGATTGTTCTAGTAGAGACGGG + Intergenic
919401642 1:197125918-197125940 TGGGTTGGTCTACAATTGACTGG - Intronic
1066772342 10:38856598-38856620 TGGAATGGACTGGTATAGATCGG + Intergenic
1071478719 10:86046601-86046623 TGAGTTGGTCTAATAAAGATTGG + Intronic
1073804386 10:107081167-107081189 TGGATTCTTCTAGTATAGGTAGG - Intronic
1080209911 11:29773702-29773724 TTGATTGGTCTTCTAGAGACAGG + Intergenic
1083321079 11:61847240-61847262 TTGATTTGTCTACTTTAAATGGG - Intronic
1083363258 11:62125925-62125947 TGGCTGGGGCTACTTTAGATTGG + Intronic
1086146248 11:83555393-83555415 TGGATTGGAGAACCATAGATTGG + Intronic
1093806323 12:23437406-23437428 TTGAATGGTCTACTCTAAATTGG - Intergenic
1096751916 12:53765148-53765170 TGGATTGGTCTACATCAGAATGG + Intergenic
1107577112 13:41737460-41737482 TGAATTTGTCTTTTATAGATAGG - Intronic
1107704593 13:43088255-43088277 AGTATTGGTCCACTAAAGATTGG + Intronic
1111007978 13:82275033-82275055 TGAATTGGTCAATTATAGATTGG + Intergenic
1115936656 14:38560093-38560115 TGAATTGTTCTACTAAAAATAGG + Intergenic
1116510027 14:45733635-45733657 TTATTCGGTCTACTATAGATGGG - Intergenic
1118035368 14:61860606-61860628 AGTATTGGTCTATAATAGATTGG + Intergenic
1120218266 14:81704226-81704248 GGGATGGGCCTACTTTAGATTGG - Intergenic
1121139308 14:91526960-91526982 TTGATTTGTCAAGTATAGATCGG - Intergenic
1122563769 14:102636450-102636472 TGTATTTGTTTACTAGAGATAGG + Intronic
1129636954 15:77330366-77330388 TGGTTTGGTGTAGAATAGATTGG - Intronic
1129960799 15:79682205-79682227 TGGAGAGGTCTGGTATAGATAGG + Intergenic
1131770860 15:95735976-95735998 GGGAAAGGTCTACTATAGATAGG + Intergenic
1132412266 15:101590941-101590963 TTGATTGATTTTCTATAGATTGG + Intergenic
1135878894 16:26232896-26232918 TGGATTTACCTACCATAGATAGG + Intergenic
1139066718 16:63324576-63324598 TAGAATGGTCTACAAAAGATTGG - Intergenic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1144465868 17:15496794-15496816 TGGATTTTTATTCTATAGATGGG + Intronic
1145335485 17:21908910-21908932 TGGAATGGTCTCATATAGAAGGG + Intergenic
1145713691 17:26999062-26999084 TGGGTAGTTCTACTATAGTTTGG + Intergenic
1146078922 17:29759623-29759645 TGAATTTGACTTCTATAGATAGG + Intronic
1203177052 17_KI270729v1_random:26629-26651 TGGAATGGAATACAATAGATGGG + Intergenic
1203177079 17_KI270729v1_random:26804-26826 TGGAATGGAATACAATAGATGGG + Intergenic
1203180362 17_KI270729v1_random:51849-51871 TGGATTGGAATACAATAGAAAGG + Intergenic
1156050203 18:32923612-32923634 TGCATTGGTGTACTATTGACTGG - Intergenic
1156980712 18:43285322-43285344 TCGGTTGGTGTACAATAGATAGG - Intergenic
1157117406 18:44875002-44875024 TGTATTGGTTTGCTACAGATGGG + Intronic
1159172208 18:64785605-64785627 TGGCTTGGGCTTCTTTAGATAGG - Intergenic
1159989525 18:74887352-74887374 TTGTTTGGGGTACTATAGATGGG + Intronic
1166623255 19:44324558-44324580 TTGATTGGTCTGCTATCTATTGG + Intergenic
1167022632 19:46889484-46889506 TTGATTGGTTTACTAAAGAACGG - Intergenic
1167141407 19:47653386-47653408 TGAATTGGTACACTTTAGATGGG - Intronic
928388259 2:30888097-30888119 TGGATTGGACTCCACTAGATGGG + Intergenic
932658979 2:73635771-73635793 TGGATTGGTTTTCTATACTTTGG - Intergenic
943442171 2:187938691-187938713 TGGATTTTTCTAGTTTAGATAGG - Intergenic
946988159 2:225297991-225298013 TGGATTTTTATACTATAGATTGG + Intergenic
948568253 2:238900028-238900050 TGGAATAGTTTAATATAGATGGG + Intronic
949276163 3:2284343-2284365 TTGATATGTATACTATAGATTGG - Intronic
949616061 3:5754980-5755002 AGTATTGGTCTGCTATAAATTGG + Intergenic
956500858 3:69883576-69883598 TGGATTGGTGGGCTACAGATTGG + Intronic
958782082 3:98554819-98554841 TGGATTGGTCTAAAACAGGTAGG + Intronic
959674827 3:109022695-109022717 TGGATTGGTTGACTCTACATAGG - Intronic
960797063 3:121498632-121498654 AGGATTGGACTACTATTGATTGG - Exonic
966763716 3:183439654-183439676 TGAATCAGTCTACTATTGATGGG - Intergenic
974138295 4:57848777-57848799 TGGATTTTTATACTCTAGATTGG + Intergenic
984463675 4:180070240-180070262 TGGATCGGTATGCTATAGAGAGG + Intergenic
989487371 5:42007805-42007827 GGGATTAGTCTACTATATGTTGG - Intergenic
1002210849 5:177598556-177598578 TGGAGTGGTCCCCTTTAGATGGG + Intergenic
1005407683 6:25507943-25507965 TGTATTGGTTTATGATAGATTGG - Intronic
1009504776 6:64463122-64463144 TGGATTTTTTTACTAGAGATGGG + Intronic
1018903247 6:168061608-168061630 TGGAGTGGAATTCTATAGATGGG - Intronic
1018999165 6:168733874-168733896 TGGATTAGTCTCCTAGAGAAAGG + Intergenic
1020855071 7:13409966-13409988 AGGATAGGTTTTCTATAGATGGG + Intergenic
1028448585 7:90954107-90954129 TGCAATGGTATACTATAAATTGG - Intronic
1029009949 7:97249282-97249304 TTGATTGGTCTACTGTAAATGGG + Intergenic
1031132755 7:117851691-117851713 TGGTTTGGTGGACTGTAGATAGG - Intronic
1032930050 7:136655879-136655901 TGGATTCGTCTAGTATATAAAGG - Intergenic
1041871932 8:62644616-62644638 TGGAAAGGACAACTATAGATTGG + Intronic
1042522616 8:69729905-69729927 TGTATTGGTCTACTTTACAGTGG - Intronic
1044366508 8:91353570-91353592 TGGATTGCTCTTGCATAGATAGG - Intronic
1046645290 8:116779175-116779197 TGAATTGGTATACTTTAAATGGG + Intronic
1048380532 8:133861337-133861359 TGGATTGTTTTAGTAGAGATGGG - Intergenic
1051416540 9:16846736-16846758 TGGATTGGTCTAAAATAATTTGG - Intronic
1051924656 9:22309301-22309323 TGGATTAGCTTACTATTGATAGG + Intergenic
1203726985 Un_GL000216v2:57900-57922 TGGATTGGACTACAATGGAACGG - Intergenic
1203680464 Un_KI270756v1:59764-59786 TGGAATGGACTGGTATAGATCGG - Intergenic
1189055920 X:37699643-37699665 TGGATTGGTATACTGAAGACAGG + Intronic
1192814830 X:74579458-74579480 TGGATTCATGTACTACAGATAGG + Intergenic
1198540448 X:137633162-137633184 TGGATCAGTATACCATAGATTGG + Intergenic
1201106225 Y:10765387-10765409 TGGAGTGGACTACAATAGAATGG - Intergenic
1201207155 Y:11643357-11643379 TGGAATGGTCTCGAATAGATTGG + Intergenic