ID: 1144077164

View in Genome Browser
Species Human (GRCh38)
Location 17:11729727-11729749
Sequence GAGGGGGACAAGGATGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 426}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144077164_1144077177 23 Left 1144077164 17:11729727-11729749 CCAGCATCATCCTTGTCCCCCTC 0: 1
1: 0
2: 1
3: 49
4: 426
Right 1144077177 17:11729773-11729795 ATCCACATAGGTCTCACATGTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1144077164_1144077174 11 Left 1144077164 17:11729727-11729749 CCAGCATCATCCTTGTCCCCCTC 0: 1
1: 0
2: 1
3: 49
4: 426
Right 1144077174 17:11729761-11729783 GAGCCAGCTTCCATCCACATAGG 0: 1
1: 0
2: 3
3: 14
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144077164 Original CRISPR GAGGGGGACAAGGATGATGC TGG (reversed) Intronic
900087150 1:904154-904176 GAGGGGGACAAGGATGCACAAGG + Intergenic
900156515 1:1205391-1205413 CTGGGGGACAAGGGTGGTGCCGG + Exonic
900347140 1:2215242-2215264 GAGGGGGCCAAGGGTGGTGCCGG + Intergenic
900466863 1:2830017-2830039 CAGGGGGACCAGGAAGACGCTGG - Intergenic
900751325 1:4399715-4399737 GTGAGGGTCAGGGATGATGCAGG + Intergenic
902646926 1:17806045-17806067 GAGGAGGAAAAGGAGGAAGCAGG - Intronic
902764757 1:18606861-18606883 AAGAGGAACAAGGATGATGGTGG - Intergenic
902907164 1:19566815-19566837 CAGGGGGACAAGGAGGAAGCTGG + Intergenic
903736026 1:25530374-25530396 CGGGGGGACAAGGCTGAGGCTGG + Intergenic
903938563 1:26913364-26913386 GTGGGGGGCAAGGCTGAAGCAGG - Intronic
904037060 1:27564654-27564676 GAGGGGGACAGGGGAGATGTTGG + Intronic
905348984 1:37331536-37331558 GAGGGGGATGGGGAGGATGCAGG - Intergenic
905530586 1:38675559-38675581 GAGGGACACCAGGATGGTGCAGG - Intergenic
905734714 1:40317153-40317175 GAGGAGAACAAGGAGGCTGCGGG + Exonic
906710966 1:47929797-47929819 GAGGGAGATGAGGATGTTGCTGG - Intronic
907114444 1:51956644-51956666 GAAGGGGAAAAGGCTGATCCAGG - Intronic
907366361 1:53963953-53963975 AAGGGGGACAATGAAGATGGGGG - Intronic
907474831 1:54698677-54698699 GAGGGGGATAAGGGTGAGGCTGG + Intronic
911122420 1:94309663-94309685 GAGGGAGGGATGGATGATGCAGG + Intergenic
911370313 1:96988105-96988127 GAAGGGGATAAGAATGATGCTGG - Intergenic
911558204 1:99371455-99371477 AATGGGGAGAAGGATGAAGCAGG - Intergenic
912752404 1:112296388-112296410 GTAGGGGACATGGATGAAGCTGG + Intergenic
913328526 1:117648677-117648699 AAGGGGGACATGGATGAAGCTGG + Intergenic
914340393 1:146755225-146755247 GAGGGGGACAAGGGAGATGGAGG - Intergenic
914990351 1:152494613-152494635 GAGGGGGACAAAGATGGAGATGG - Intergenic
915057636 1:153149981-153150003 CAGGTGGACAAGGAGGAGGCAGG + Exonic
915583756 1:156831966-156831988 CAGGTGGTCAGGGATGATGCTGG - Intronic
915841727 1:159218538-159218560 GCAGGGGACAAGGATGAGACAGG + Intergenic
916156097 1:161850264-161850286 GAGAGGGAACAGGATGAGGCTGG - Intronic
917768494 1:178249946-178249968 GAGGGGCACCAGCCTGATGCCGG + Intronic
917816324 1:178713435-178713457 GAGAGGTACAAGGCTGATGGGGG - Intergenic
918175073 1:182036271-182036293 CAGGGGGACCAGGATGGTGTGGG + Intergenic
919813987 1:201426393-201426415 GGGAGGGACAAGGATGACACTGG - Intronic
919986690 1:202680681-202680703 GAGAGGGGCAAGGAAGAAGCTGG - Intronic
920196683 1:204232397-204232419 GAGAGGGTCAAGGATGTAGCTGG + Intronic
921478341 1:215635891-215635913 GAGGCTGACAAGAATCATGCAGG + Intronic
921515298 1:216084080-216084102 GAAGGGGAGAGGGATGATGGTGG - Intronic
922023411 1:221727812-221727834 GAGGGGGACATGGGTGATCAAGG - Intronic
922278313 1:224099892-224099914 AAGGGGGTCAGGGAGGATGCAGG + Intergenic
922315021 1:224434543-224434565 GAGGGGGAGAAGGAGGATCCGGG + Intronic
922747974 1:228057633-228057655 GAAGGGGACGAGGAGGAGGCAGG + Intronic
923030642 1:230246718-230246740 GAAGGGGACCAGGGTGATGTAGG - Intronic
923120066 1:230981612-230981634 AAGAGGTACAAGGATGATGTAGG - Intronic
923772290 1:236948104-236948126 GAGGGAGACAGGGAGAATGCAGG + Intergenic
924414806 1:243849189-243849211 GAGGTGGACAAGGAAGAGGCTGG + Intronic
1062916363 10:1243696-1243718 CATGGGGGCAAGGATGCTGCTGG - Intronic
1063502834 10:6570432-6570454 GAGGGAGAGAAGGAAAATGCAGG + Intronic
1064504684 10:16015772-16015794 GAAGGGGAGAAGGTTGAGGCAGG + Intergenic
1064706112 10:18074164-18074186 GAGGGAGAAAAGGAGGAGGCAGG + Intergenic
1065539086 10:26742942-26742964 GATGGGGACATGGATGAGGCTGG - Intronic
1066347810 10:34606343-34606365 GAGGAGGAGAAAGATGAGGCTGG + Intronic
1067061426 10:43079854-43079876 GAGAAGGAAAAGGATGAAGCAGG - Intronic
1067473433 10:46551669-46551691 GTGGGGGACAATGAGGATGCAGG - Intronic
1069860585 10:71468775-71468797 GAGGGGTACAGGGACTATGCAGG - Intronic
1070300745 10:75202050-75202072 GAGGAGGACAACGATGAGTCAGG - Intergenic
1071149559 10:82618298-82618320 GAGAGGGACAGTGATGAGGCAGG + Intronic
1071296196 10:84221939-84221961 GAGGGGGACAAGGAGAAAGGAGG - Exonic
1071516817 10:86303472-86303494 GAGGGGCACAGGGAAGAAGCAGG + Intronic
1072027482 10:91476136-91476158 GAGGGAGAAACGGATGATACAGG + Intronic
1073036235 10:100566111-100566133 GAGGAGGAGGAGGAGGATGCTGG - Intergenic
1073388977 10:103156180-103156202 GAGGAGGACAAGGCTGAAGGTGG + Intronic
1073453307 10:103622173-103622195 GAGGGGGACAAGGGGGTTTCGGG - Intronic
1074349586 10:112723175-112723197 GAGGAGGACGATGATGATGGTGG - Intronic
1074783755 10:116820929-116820951 GAGAGGAGTAAGGATGATGCTGG - Intergenic
1075581684 10:123623565-123623587 GAGGAGGCCAATGATGATGATGG + Intergenic
1076288193 10:129321990-129322012 GAGGGAGACAAGAAGGAGGCCGG - Intergenic
1076567367 10:131407910-131407932 GAGGGAGAAAAGGAGGATGCAGG - Intergenic
1077279405 11:1735310-1735332 GATGAAGACGAGGATGATGCAGG + Exonic
1077306585 11:1871358-1871380 GAGCGGGACAAGGGTGCTGCCGG + Intronic
1077363053 11:2149327-2149349 GAGAGGGACAAAGCTGAGGCTGG + Exonic
1077541671 11:3149445-3149467 GATGGGGACAGGGAGGATGCTGG - Intronic
1077695523 11:4389473-4389495 GAGGGGAATAAAAATGATGCAGG - Intronic
1078390703 11:10933122-10933144 GAGGGGGGCGAGGATGATTGTGG + Intergenic
1079351729 11:19697604-19697626 GAGGGAGGCAAGGATGGGGCAGG + Intronic
1080661068 11:34296321-34296343 GAGGGAGACAAGGAGGAGGGTGG + Intronic
1081211548 11:40341216-40341238 GTAAGGGACAAGGATGAAGCTGG - Intronic
1081268010 11:41050587-41050609 AGTGGGGACAAGGATGAAGCTGG - Intronic
1082786193 11:57318355-57318377 GAGGGAGAGAAGGAAGATGGCGG + Intronic
1083196525 11:61091819-61091841 GAGGGGGAGAAGGAGGATCTAGG - Intergenic
1083626000 11:64072254-64072276 GATGGGTACAGGGGTGATGCCGG + Intronic
1083888028 11:65582158-65582180 GAGGGGGCCAGGGCTGCTGCAGG + Exonic
1084027916 11:66464361-66464383 GTAGGGGACATGGATGAAGCTGG + Intronic
1084357687 11:68650943-68650965 GAGGGGGACAGGGAAGGAGCAGG - Intergenic
1084892909 11:72245170-72245192 GAGGGGCCCAGGGATGATGCTGG + Intronic
1085644226 11:78212889-78212911 GAGGGGGAGGAGGATGCTTCGGG + Intronic
1085872386 11:80365913-80365935 GATGAGGACAAGGAAGATGATGG - Intergenic
1087260263 11:96002914-96002936 GATGGGGATAAGGAAGATGATGG + Intronic
1088367056 11:109050925-109050947 TGGAGGGACATGGATGATGCTGG + Intergenic
1088832801 11:113551868-113551890 GAGGTGGAGAAGGAGGGTGCAGG - Intergenic
1089165977 11:116476981-116477003 GAGGGGGAAACTGATGATACAGG + Intergenic
1089278829 11:117358328-117358350 GAGGGAGACAAGCATGCTGAGGG - Intronic
1090271543 11:125389504-125389526 GAGGGAGTGAAGGATGAAGCCGG - Intronic
1090726490 11:129531643-129531665 GAGTGGGAAAAGAATGATCCAGG - Intergenic
1091364360 11:135005254-135005276 GAGCGGGACACAGATGATGCAGG - Intergenic
1091603174 12:1930052-1930074 GAGGGGGAGAAGGAGGAGGAGGG + Intergenic
1093153514 12:15652275-15652297 GTGGCTGACAAGGATGAGGCAGG + Intronic
1093948718 12:25139544-25139566 GCAGGGGACATGGATGAAGCTGG + Intronic
1093992361 12:25604643-25604665 TATGGGGACATGGATGAAGCTGG - Intronic
1094159679 12:27377377-27377399 GAGAAGGTCAATGATGATGCTGG - Intronic
1094280907 12:28736790-28736812 TGCGGGGACATGGATGATGCTGG - Intergenic
1095093036 12:38124507-38124529 GAGGTGGACTAGGGTGAAGCAGG - Intergenic
1096019334 12:48309312-48309334 CAGTGGGACAAGTATGATGAAGG + Intergenic
1096556261 12:52405987-52406009 GATGGTGACAGGGGTGATGCAGG + Exonic
1096572749 12:52533185-52533207 GGGAGGGAAAAGGATGAAGCTGG - Intergenic
1096660158 12:53119146-53119168 GAGGCGGCCCAGGATGAAGCAGG - Exonic
1097592275 12:61588421-61588443 GAGGGAAACAAGGATGATTTGGG - Intergenic
1098133685 12:67378891-67378913 GAAGGGGAGAAAGATGAGGCTGG - Intergenic
1098164800 12:67683676-67683698 GAGGGGGATTAGGAAGATGTTGG + Intergenic
1099683749 12:85860111-85860133 AATGGGGACATGGATGAAGCTGG - Intergenic
1099684992 12:85873974-85873996 AAGTGGGAAAAGGATGATACTGG + Intergenic
1099718799 12:86334428-86334450 GGGAGAGACATGGATGATGCTGG + Intronic
1101023990 12:100582876-100582898 GAGGGAGCCAAGGAATATGCAGG - Intronic
1101059842 12:100959331-100959353 GAGAGGAAAAATGATGATGCAGG - Intronic
1101241289 12:102842255-102842277 GAGGGAGAGGGGGATGATGCTGG + Intronic
1101606768 12:106252671-106252693 GAGGAGGAGGAGGATGATGGTGG + Intronic
1102064651 12:109963856-109963878 GAGGGAGATAAGGATCCTGCAGG - Intronic
1102101713 12:110283247-110283269 GACGGTGACAAGAATGATGACGG + Intronic
1102206472 12:111094358-111094380 GAGGGAGGCAAGGGTCATGCTGG + Intronic
1102255362 12:111411805-111411827 GTGGGGGACAAGGATGCACCAGG + Intronic
1102663506 12:114549775-114549797 GAGGGTGAGAAGGATGAAGATGG + Intergenic
1103934261 12:124467092-124467114 GAGGATGACGAGGATGATGAGGG - Intronic
1103934396 12:124467688-124467710 GAGGGTGATAAGGATGATGGAGG - Intronic
1103934399 12:124467706-124467728 GAGGGTGATGAGGATGATGAGGG - Intronic
1103934414 12:124467771-124467793 GATGAGGATAAGGATGATGAGGG - Intronic
1103934478 12:124468029-124468051 GAGGGTGATGAGGATGATGAGGG - Intronic
1103934481 12:124468047-124468069 GAGGAGGATGAGGATGATGAGGG - Intronic
1103934535 12:124468262-124468284 GAGGGTGATGAGGATGATGGGGG - Intronic
1103934545 12:124468304-124468326 GAGGGTGATGAGGATGATGAGGG - Intronic
1103934548 12:124468322-124468344 GAGGAGGATGAGGATGATGAGGG - Intronic
1103934648 12:124468729-124468751 GAGGGTGATGAGGATGATGGGGG - Intronic
1103934658 12:124468771-124468793 GAGGGTGATGAGGATGATGAGGG - Intronic
1104101977 12:125621291-125621313 GAGGCAGACAAGAATGATGAGGG + Intronic
1105841039 13:24253870-24253892 GAGGCAGACGAGGATGTTGCAGG + Intronic
1106617781 13:31346203-31346225 TATAGGGACAAGGATGAAGCTGG + Intergenic
1110569209 13:76986623-76986645 AAGAAGGACAAGGATGATGATGG + Intergenic
1112422861 13:99268805-99268827 CAGGGAAACAAGGATGTTGCTGG + Intronic
1112678644 13:101735573-101735595 GAGGGGGAAAAGGTGGATACAGG - Intronic
1113036682 13:106057444-106057466 GAGGGGGTCATGGAGGATGGTGG + Intergenic
1113245898 13:108395081-108395103 GAGGCGGGCGATGATGATGCTGG - Intergenic
1113795482 13:113055258-113055280 GAGGGGGTCATGTTTGATGCTGG + Intronic
1114542780 14:23474801-23474823 GAAGAGGCCAAGGATGCTGCTGG + Intronic
1116142421 14:41015692-41015714 CAGGGGGACATGGGTGAAGCTGG + Intergenic
1116652274 14:47608762-47608784 GAGGGGCACAGGGAAGAAGCAGG + Intronic
1116967056 14:51025875-51025897 GAAGAGGACACGGATGAGGCAGG - Intronic
1120833167 14:89016121-89016143 GAGGGTGACTAGGAAGATGGAGG + Intergenic
1121511245 14:94514854-94514876 GAGGTGGGCAAGGATTAGGCTGG + Intronic
1121674437 14:95740986-95741008 CAGGGGGACAAGGGTGTGGCGGG + Intergenic
1122082427 14:99274745-99274767 GAGGGGGAGAAGGAGGAGGAGGG - Intergenic
1123069670 14:105636317-105636339 GAGGGGCAGAGGGAGGATGCTGG - Intergenic
1123094694 14:105761357-105761379 GAGGGGCAGAGGGAGGATGCTGG - Intergenic
1125281073 15:38043199-38043221 CAGGGGGTCAAGGATGCTGGCGG + Intergenic
1125294706 15:38190235-38190257 GAGGGGGAAAATGGTGATGCAGG - Intergenic
1126221878 15:46223571-46223593 GACAGGGACATGGATGAAGCTGG - Intergenic
1127272718 15:57415693-57415715 GAGGGAGACAAGAGTGATGGAGG - Intronic
1128679236 15:69635807-69635829 AAGGAAGACAAAGATGATGCAGG - Intergenic
1128789702 15:70423913-70423935 GAGGGGCAAAAGGAAGATGAGGG - Intergenic
1129467088 15:75730301-75730323 GAAGGGGAGAAGGAGGATGGAGG + Intergenic
1129720139 15:77873419-77873441 GAAGGGGAGAAGGAGGATGGAGG - Intergenic
1130786271 15:87100154-87100176 CAGAGGGACATGGATGAAGCTGG + Intergenic
1130871224 15:87973812-87973834 GAGGGGGAGAGGGGCGATGCTGG - Intronic
1131620143 15:94059629-94059651 GAAGGGGATAAAGATGTTGCTGG - Intergenic
1131816735 15:96229379-96229401 TAAGGGGACAAGGATGGTGTGGG - Intergenic
1132732046 16:1367444-1367466 GAGGGGGCCACAGCTGATGCTGG - Intronic
1132767770 16:1543185-1543207 GAGGAGGAGAAGGAGGGTGCGGG - Intronic
1132868227 16:2104220-2104242 GAGGGGGATGAGGAAGATGAGGG + Intronic
1132989935 16:2787271-2787293 GAGGGGGTGAAGGATGAGGGAGG - Intronic
1133445972 16:5861400-5861422 GATTGGGACAAAGATGATGATGG + Intergenic
1139127795 16:64101165-64101187 GAGGGGAAAAAGGATGATGCTGG + Intergenic
1139215835 16:65123315-65123337 TAGGGGGACGGGGATGAGGCTGG + Intronic
1139993895 16:70962181-70962203 GAGGGGGACAAGGGAGATGGAGG + Intronic
1140292049 16:73668600-73668622 TGGAGGGACATGGATGATGCTGG - Intergenic
1140668861 16:77254629-77254651 TGTGGGGACATGGATGATGCTGG - Intronic
1140898060 16:79342594-79342616 GATGGTGACAATGATGATGATGG - Intergenic
1140966016 16:79966648-79966670 GAGAGGGCCGAGGATGAGGCTGG - Intergenic
1141088361 16:81112587-81112609 GAGGAGGAGGAGGAGGATGCTGG + Intergenic
1142852155 17:2709510-2709532 GAGGGGGAGGAGGAGGAGGCTGG - Intronic
1143159101 17:4857388-4857410 GAGGGGGACAAGGATGGGCATGG + Intronic
1143183670 17:4998456-4998478 GTGGGGTACAAGGAGGATACTGG - Intronic
1143357839 17:6343861-6343883 GAGAGGGAGAGGGATGAAGCTGG - Intergenic
1143741278 17:8955725-8955747 GTGGGGAACAAGGAAGATGGAGG + Intronic
1144018916 17:11222767-11222789 GACGTGGACAAGGAGGATGGTGG - Intergenic
1144077164 17:11729727-11729749 GAGGGGGACAAGGATGATGCTGG - Intronic
1144677246 17:17169537-17169559 GAGGGAGAAACAGATGATGCAGG + Intronic
1144693906 17:17288268-17288290 GAGGGGGAGGAGGATGCTGAAGG + Intergenic
1144703850 17:17354800-17354822 GAGAGGGACAAGGAGTCTGCAGG + Intergenic
1145204557 17:20976063-20976085 GAGGGGGAAGAGGATGATGGAGG - Intergenic
1146959778 17:36964240-36964262 GAGGGGGAAATTGATGATGCAGG + Intronic
1147341761 17:39756530-39756552 GAGGGGAAGAAGGAGGGTGCAGG + Intergenic
1147965138 17:44190652-44190674 GAGGGGGCCAAGGAGGCTGAGGG - Exonic
1148028289 17:44603215-44603237 GAGGGGGATCTGGATGAGGCTGG + Intergenic
1148088907 17:45010830-45010852 GAGAGGAAGAAGGATGTTGCAGG + Intergenic
1148456332 17:47813406-47813428 GTGGGGGGCAAGGAAGGTGCAGG + Intronic
1149107080 17:52982588-52982610 GAGGGGGAGAAGGAGGAAGGGGG - Intergenic
1150095047 17:62366618-62366640 GAGGGGGAAATTGATGACGCAGG - Intergenic
1150437795 17:65167616-65167638 GATGGTGACAAGGAAGATGCTGG - Intronic
1150449147 17:65251378-65251400 GAGGGGGAAAATGAAGATCCAGG + Intergenic
1151599708 17:75098754-75098776 GAAGAGAAAAAGGATGATGCAGG + Intronic
1152030713 17:77841086-77841108 GAGGTGGACAGGGTGGATGCTGG - Intergenic
1153020225 18:622199-622221 GAAGGGGACAGTGAGGATGCTGG - Intronic
1153889672 18:9501240-9501262 GAGAGGTGCAAGGATGAGGCAGG - Intronic
1154396180 18:13991620-13991642 GAGGAGGACAAGGGAGAGGCTGG + Intergenic
1156422759 18:36973170-36973192 TATGGGGACATGGATGAAGCTGG + Intronic
1157064365 18:44330348-44330370 GGGAGGGACATGGATGAAGCTGG + Intergenic
1157612673 18:48968226-48968248 GAGAGGGTGAAGGAGGATGCAGG - Intergenic
1158008590 18:52702279-52702301 GAGAGGGACAAGGAGGTTGGTGG - Intronic
1158969805 18:62655996-62656018 GAGGGGGACAAAGGGGAAGCAGG + Intergenic
1160312697 18:77810705-77810727 GAGGGAGACAAGGCGGCTGCAGG - Intergenic
1160531419 18:79567177-79567199 CAGAGGGACGAGGATGAGGCCGG - Intergenic
1161250637 19:3278159-3278181 GAGGGGGACAGGGATGAAACAGG + Intronic
1162126072 19:8500079-8500101 GAGGGGGTCAAGGATGCTGGGGG - Intronic
1162186746 19:8911060-8911082 GATGGTGATGAGGATGATGCAGG - Intronic
1162186756 19:8911209-8911231 GATGGTGATGAGGATGATGCTGG - Intronic
1162252327 19:9456139-9456161 GCGGGGGACAAGCATTATACAGG - Intergenic
1162465345 19:10836182-10836204 GAGGGTGACCCGGATGATGGCGG - Exonic
1162731849 19:12722914-12722936 GAAGGTGACAAGGAGGGTGCTGG - Intronic
1162737195 19:12753325-12753347 GAAGGAGACAGGGATGAGGCTGG - Exonic
1163716075 19:18873024-18873046 CAGAGAGAGAAGGATGATGCAGG + Intronic
1165156055 19:33788807-33788829 GAGGGAGACGAGGATGAGGGAGG + Intergenic
1165355050 19:35299464-35299486 GAGGTGGACAAGGAGGAGGGTGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167191187 19:47991376-47991398 GAGAGGGACAAGGAAGAAGTGGG - Intronic
1167378551 19:49125535-49125557 GCGGGGGACAAGGAAGGGGCGGG - Intronic
925371608 2:3349515-3349537 GACGGGGATAAGGAGGACGCTGG + Intronic
925371630 2:3349596-3349618 GACGGGGACAGGGAGGACGCCGG + Intronic
925371656 2:3349696-3349718 GATGGGGACAGGGAGCATGCTGG + Intronic
925693354 2:6548343-6548365 GAGGGGGACCTGGAAGAAGCTGG + Intergenic
927640124 2:24840812-24840834 GAGGGGCTCAGGGATGAGGCTGG - Intronic
929753380 2:44740745-44740767 GAGAGGGACAAGGAAGTTGAGGG + Intronic
929841592 2:45470700-45470722 GAGTGAGAGCAGGATGATGCAGG - Intronic
930004272 2:46883412-46883434 GAGGAGCACCAGGATGGTGCTGG + Intergenic
931416768 2:62088937-62088959 GAGGGGGAGAAGGGGGTTGCAGG + Intronic
931877270 2:66527645-66527667 GGGGGAGACAGGGATCATGCTGG + Intronic
932385291 2:71326773-71326795 TAGGGGGAAAATGATGAGGCAGG - Intronic
932492782 2:72132329-72132351 GACGGGGACCAAGGTGATGCGGG + Exonic
932496646 2:72148850-72148872 GAGGGGGAAAAGCAGGAGGCAGG + Intergenic
934948456 2:98559427-98559449 GAGGGCGACATGGATGATTAAGG - Intronic
935874301 2:107489045-107489067 GAGTGGGAAAAGGAAGATCCAGG + Intergenic
936531642 2:113280106-113280128 GAGGGGGGCAAGGAAGGTGCAGG + Intergenic
938102970 2:128511063-128511085 AAGGGGGAAAATGATGATGCAGG - Intergenic
938317822 2:130342148-130342170 GAGGGTGACAAGGAAGAAGGTGG - Exonic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938611873 2:132956533-132956555 GAGGGCGAAATCGATGATGCGGG - Intronic
939110227 2:137997866-137997888 CACAGGGACATGGATGATGCTGG + Intronic
940005724 2:149007969-149007991 GAGTTGGACAACGATGATGGAGG + Exonic
940133826 2:150413680-150413702 GTGGGGGAACAGGTTGATGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
944439336 2:199726802-199726824 GAGGGGCACCAAGCTGATGCTGG + Intergenic
944924136 2:204446154-204446176 TACAGGGACATGGATGATGCTGG - Intergenic
945268943 2:207919443-207919465 AAGGGGGATAAGGGTGGTGCAGG + Intronic
945969395 2:216221258-216221280 GAGGGGGACGTGGCTGAGGCAGG - Intergenic
947429237 2:230011133-230011155 GTGTGGGATAAGGATGATGATGG - Exonic
947481007 2:230499922-230499944 GAGGTGGGGAAGGCTGATGCTGG + Intronic
947941895 2:234064126-234064148 GAGGGGGAGAAGGAAGAGGGAGG - Intronic
948087672 2:235265139-235265161 TAGGGGGACAAGGATGGTTTTGG - Intergenic
949013762 2:241697677-241697699 GAGGGGGAGAGGGATGAATCGGG + Intergenic
1168819852 20:765499-765521 GAGGAAGGCAAAGATGATGCAGG + Exonic
1169889125 20:10433957-10433979 GGCGGGGACAAGGAGGAGGCTGG - Intronic
1170146896 20:13185423-13185445 GAGGGTGACAAGGAGGAAGAAGG - Intergenic
1172015217 20:31869414-31869436 GAGGGGGAAAAGGCTGATGGAGG - Intronic
1172197362 20:33101077-33101099 GAGGAGGAGGAGGAGGATGCTGG + Intronic
1172773911 20:37396509-37396531 GAGGGGGACAGGGAGGAGGGGGG - Intronic
1173521436 20:43703133-43703155 CAGGAGGAGAAGGAGGATGCTGG + Intronic
1173607683 20:44343346-44343368 GCGGGGGACACGGAAGAAGCTGG - Intronic
1173803692 20:45910910-45910932 GAGGGGGCCAAGAAGGAAGCAGG - Intronic
1174164727 20:48576667-48576689 GAGAGGGGCATGGGTGATGCTGG - Intergenic
1174258762 20:49278159-49278181 GAGGAGGAGAAGGAGGAGGCGGG + Exonic
1174287537 20:49483492-49483514 GAGGGGGAGAAGGAAGAGGAGGG - Intergenic
1174356022 20:49998365-49998387 GGAGGAGACAAGGATGATGCCGG + Intergenic
1175161707 20:57012716-57012738 GAAGGAGACAAGGAAGAGGCAGG + Intergenic
1175327174 20:58137869-58137891 GATGGGGACTAGGAGGATGGAGG - Intergenic
1175605883 20:60311895-60311917 GAAGGAGACAAGGACTATGCAGG + Intergenic
1175809606 20:61850868-61850890 GAGTGGGACAAGGAGGACACAGG + Intronic
1175984148 20:62755690-62755712 GAGGGAGAGAGGGATGATGGAGG - Intronic
1176228775 20:64019713-64019735 GAGGGGGTCAGGGAGGATGCCGG - Intronic
1177322129 21:19536146-19536168 GTAGGGGACATGGATGAAGCTGG - Intergenic
1177992542 21:28055739-28055761 GAAAGGGACAAGGATGAGACGGG - Intergenic
1179647075 21:42782569-42782591 GAGGGAGAGAAGGAGCATGCAGG - Intergenic
1180708218 22:17822603-17822625 GAGGGGGTCAGGGACGAGGCTGG - Intronic
1181084005 22:20430944-20430966 GATGGGGACAGGGGTGAGGCGGG - Intronic
1181185237 22:21098623-21098645 GAGGGCCACCAGGAAGATGCTGG + Intergenic
1181267160 22:21637041-21637063 GATGAGGACAAGGATGAGGATGG + Exonic
1182400793 22:30075827-30075849 GAAGGGGACAAAGATGAGGGAGG + Intergenic
1182918100 22:34054063-34054085 GAGGGGGAAAGGTATGATGGTGG - Intergenic
1182931456 22:34178253-34178275 GAGGGGGATAAGGAGGAGGAAGG - Intergenic
1183337921 22:37261216-37261238 GAGGGAGTCAAGAATGATGTTGG + Intergenic
1183346999 22:37313441-37313463 GAAGGGGACACGGGTGATGCTGG - Exonic
1183654890 22:39178925-39178947 GAGGGAGACATGGATGAATCAGG + Intergenic
1184054556 22:42035801-42035823 GAGGGGGAAATGGAGGATGTTGG - Intronic
949791709 3:7799852-7799874 GAGGGAGTCAAGGATGAGGCTGG - Intergenic
950715170 3:14842662-14842684 GAGAAGGACAAGGAAGCTGCTGG - Intronic
950934869 3:16828651-16828673 TAGAGCGACAAGGATGATTCAGG + Intronic
950975579 3:17239344-17239366 GAAGGAGAAAATGATGATGCAGG - Intronic
951708582 3:25567936-25567958 GAGGGGGAAAGGGGTCATGCAGG - Intronic
951823573 3:26842133-26842155 TACGGGGACATGGATGAAGCTGG - Intergenic
952420722 3:33128840-33128862 GAGGGAGCCAAGGATCATGTGGG + Intronic
952714319 3:36463809-36463831 GGGAGGGACATGGATGAAGCTGG - Intronic
953142535 3:40242288-40242310 GAGGAGGATAATGATGATGATGG - Intronic
953457814 3:43056483-43056505 GAGGGGCACAAGGATGTCACGGG + Exonic
953576499 3:44116944-44116966 GAAGGGGACAAAGCTGATGATGG + Intergenic
954286329 3:49622048-49622070 GAGGGGGAAATGGATGATGAAGG + Intronic
955566947 3:60257624-60257646 GAGGAGGACAAGGAAGGTGGAGG + Intronic
955912190 3:63868648-63868670 GGGGAGGACATGGATGCTGCTGG + Intronic
956104456 3:65802348-65802370 GGGGGAGACAAGGAAGATGGAGG + Intronic
956887059 3:73570773-73570795 GAGGAGGAGAAGGAGGATGAAGG + Intronic
957568343 3:81913428-81913450 CAGGAGGACAAGGATGAAGAGGG + Intergenic
958258189 3:91348898-91348920 GAGAGGGAAGAGGATGATGATGG - Intergenic
959203330 3:103275902-103275924 TGCGGGGACAAGGATGAAGCTGG - Intergenic
959576249 3:107937666-107937688 GATAGGGACATGGATGAAGCTGG + Intergenic
959843400 3:111004435-111004457 GGCAGGGACATGGATGATGCTGG + Intergenic
960879809 3:122332847-122332869 GATGGGCACTAGGAGGATGCAGG - Intronic
960949314 3:122988798-122988820 GAGGAGGACAAGGCTGATTGAGG - Intronic
961168288 3:124778656-124778678 ATGGGGGACAAGGAGGATGGGGG + Intronic
961345539 3:126260957-126260979 GAGGGGGAGAAGGAAGAGGAGGG - Intergenic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
961590742 3:127978869-127978891 AAGGGGCATAAGGATGTTGCTGG + Intronic
964100804 3:152986091-152986113 GTAGGGGACATGGATGAAGCTGG + Intergenic
964448494 3:156786361-156786383 GAGGTGGACAAGGTTGATGAAGG + Intergenic
966219502 3:177536274-177536296 TAGGAGGACAAAGATGAGGCTGG - Intergenic
966908524 3:184544619-184544641 GAGGGGGAGAAGGAGGAGGAGGG - Intronic
967245795 3:187485104-187485126 GATGGGGACAGGCATGCTGCAGG + Intergenic
967379398 3:188840836-188840858 GAGGTGGAAAAGAATGTTGCTGG - Intronic
968152547 3:196348654-196348676 TAGGGGGATAGGGATGATGAGGG - Exonic
968590056 4:1453499-1453521 GATGGTGACAATGATGATGGTGG - Intergenic
968613501 4:1567440-1567462 GCGGGGGACAGGGCTGCTGCAGG - Intergenic
968645749 4:1739818-1739840 GATGGGGACAAGGATGGCGAGGG - Intronic
968645758 4:1739842-1739864 GATGGGGACAAGGATGGCGAGGG - Intronic
968889363 4:3359356-3359378 GAGGGGGAGAAGGAGGAGGTGGG - Intronic
969349609 4:6590816-6590838 GATAGGGACAAGGATGAGGAGGG - Intronic
969881658 4:10179208-10179230 GAGGGGGAAAAGGTAGAGGCTGG + Intergenic
969967766 4:11014524-11014546 GATGGGGCCAAGGATGATGGTGG + Intergenic
970386606 4:15562984-15563006 TAGGCAGACAAGGAAGATGCAGG + Intronic
971185406 4:24371075-24371097 GTGGGGGACATAGATGAAGCTGG - Intergenic
974643950 4:64669385-64669407 GGTGGGGACATGGATGAAGCTGG + Intergenic
976100816 4:81561201-81561223 GGGAGGGACATGGATGAAGCTGG - Intronic
976862103 4:89677786-89677808 TACAGGGACAAGGATGAAGCTGG + Intergenic
977776187 4:100921995-100922017 GTAGGGGACATGGATGAAGCTGG + Intergenic
979282824 4:118886547-118886569 GCAGGGGACATGGATGAAGCTGG - Intronic
979417838 4:120465029-120465051 TGCAGGGACAAGGATGATGCTGG + Intergenic
979491483 4:121332952-121332974 GAGGATGACAAGGATGAAGGTGG + Exonic
979494625 4:121369821-121369843 GGGGTGGACAGGGCTGATGCAGG + Intronic
979532843 4:121787438-121787460 GAGTGGGAAAAGGATGAAGATGG - Intergenic
979762868 4:124428256-124428278 GAGGGTGACAATGCTGATGATGG + Intergenic
981587735 4:146322514-146322536 TAGGGGGACATGGATGAAGCTGG - Intronic
981840791 4:149109277-149109299 TATGGGGACATGGATGAAGCCGG - Intergenic
981968960 4:150641050-150641072 GATGGGGACAGGAATGATGATGG - Intronic
982644929 4:158011309-158011331 GAGGGGCACAGGAATGATGCAGG - Intergenic
982663703 4:158234772-158234794 GAGATGGAGAAGGACGATGCAGG + Intronic
982769379 4:159381915-159381937 GAGGAGGAGGAGGATGAGGCAGG + Intergenic
982826292 4:160007823-160007845 TGGAGGGACAAGGATGAAGCTGG + Intergenic
982966515 4:161915285-161915307 GAGGGGGAGGGGGATGATGGGGG - Intronic
983134067 4:164057968-164057990 TATGGGGACATGGATGAAGCTGG + Intronic
983501433 4:168504104-168504126 AAGGAGGACAAAGATGAGGCAGG - Intronic
984185431 4:176537627-176537649 GAGGGGGACAATGACCATACAGG + Intergenic
984902091 4:184594527-184594549 GAGGAGGAGAAGGAAGATGAGGG + Intergenic
985516293 5:346646-346668 CTGGGGGCCAAGGATGAAGCCGG - Intronic
985900190 5:2782759-2782781 GAGGGTGATGAGGATGATGTTGG - Intergenic
985904232 5:2820562-2820584 GAGGTGGACAATGATGCTGCTGG - Intergenic
985969556 5:3364274-3364296 AAGGGAGGGAAGGATGATGCAGG + Intergenic
986315583 5:6584350-6584372 GAAGGGGAAAAGGAAGAGGCAGG + Intergenic
986582208 5:9277661-9277683 TACAGGGACATGGATGATGCTGG + Intronic
986912777 5:12577153-12577175 GTAGGGGACATGGATGAAGCTGG + Intergenic
987920377 5:24272662-24272684 GAGGGGGACAAGGTGGATGGAGG - Intergenic
990689132 5:58343155-58343177 GAGGGGAAAACTGATGATGCAGG + Intergenic
991926671 5:71712405-71712427 GGCGGGGACATGGATGAAGCTGG - Intergenic
992090625 5:73312877-73312899 GAGGGGGAGGAGGAGGAGGCAGG - Intergenic
992146834 5:73859080-73859102 GAGGAGGGCAAGGATGAGCCAGG - Intronic
993598527 5:89890146-89890168 GAGAGGGACAAGGGAAATGCAGG + Intergenic
993675509 5:90811284-90811306 GTGGAGGAGAAGGATGATACTGG + Exonic
993727937 5:91389772-91389794 TATGGGGACATGGATGATGCTGG + Intergenic
994703510 5:103168615-103168637 GTGGGGGACAATCATAATGCGGG - Intronic
996070606 5:119126989-119127011 GATGGGGACAAAGATGAAGCAGG - Intronic
996397152 5:123024832-123024854 AAGGGAGACAAGGATGGTCCAGG + Intronic
998404034 5:141863536-141863558 GTGGAGGACGAGGATGAGGCCGG - Exonic
999231488 5:150064744-150064766 GAGGGGATCAAGGAGGATGGAGG + Intronic
999545273 5:152622500-152622522 AAGGGTGACCAGGATGATGATGG - Intergenic
1000983864 5:167845977-167845999 GATGGGGTGAAGGATGAGGCTGG - Intronic
1001850351 5:174958645-174958667 TATGGGGACATGGATGAAGCTGG + Intergenic
1003668841 6:8136665-8136687 GGAGGGGAGAAGGATGATGGGGG - Intergenic
1004549421 6:16632257-16632279 TAGGGTGACAAGGCTGATTCAGG - Intronic
1004803955 6:19181719-19181741 GAGTGTGACAAGGATGATCATGG + Intergenic
1004894493 6:20134143-20134165 GAGAGGGAAATGGATGAGGCTGG - Intronic
1007922635 6:45624617-45624639 TAGGAAGACAAGAATGATGCAGG - Intronic
1008519816 6:52352300-52352322 GAGGAGGACAACGATGACACTGG + Intergenic
1008759169 6:54833473-54833495 GAGGGGGAAAAGGAGGAGGAGGG + Intergenic
1008889580 6:56472189-56472211 GAGGGATACAAGCTTGATGCTGG + Exonic
1008997065 6:57671810-57671832 GAGAGGGAAGAGGATGATGATGG + Intergenic
1009185583 6:60571146-60571168 GAGAGGGAAGAGGATGATGATGG + Intergenic
1010326594 6:74570642-74570664 GAGGAGGACAGGAATGAAGCAGG + Intergenic
1010942860 6:81939617-81939639 CAGCGGGACAAGGATGACACAGG - Intergenic
1011082421 6:83504021-83504043 GTTGGGGACAAGGATGGTGTTGG + Intergenic
1011945211 6:92891366-92891388 GGGAGGGAGAAGGATGATGCAGG + Intergenic
1012183855 6:96189251-96189273 GAGAGGGACAAGCATGGTGATGG + Intronic
1013172090 6:107645935-107645957 GAGGGTGAGAAGCATGAGGCTGG + Intronic
1013288169 6:108698266-108698288 GAGGGGGACAGGGCTGACCCTGG - Intergenic
1013331782 6:109109834-109109856 TACAGGGACATGGATGATGCTGG - Intronic
1013625132 6:111929299-111929321 GTGGGGAACATGGATGAAGCTGG - Intergenic
1013904828 6:115203080-115203102 TAGGAGAACAATGATGATGCAGG + Intergenic
1015587436 6:134789982-134790004 GAGGGGTACAAACCTGATGCTGG - Intergenic
1015630032 6:135222972-135222994 GAGGAAGACAATGATGATGTCGG - Intergenic
1015657114 6:135531476-135531498 GAGAGAGTCAAGGATGATTCTGG - Intergenic
1017106380 6:150892611-150892633 GAGGGGGACAAGTATGGGGCGGG - Intronic
1018567568 6:165171039-165171061 GAGGAGGAGAAGGAGGATGAAGG + Intergenic
1018611130 6:165648938-165648960 GATGGGGACAAGGATGGGGATGG - Intronic
1018633463 6:165840241-165840263 GAGGGAGATAAGGATGGAGCTGG - Intronic
1018960991 6:168448429-168448451 GATGGGGAGAAGGATGAGGATGG + Intronic
1018961055 6:168448636-168448658 GATGGGGAGGAGGATGGTGCTGG + Intronic
1018996537 6:168714632-168714654 GATGGGGAGAAGGAGGATGATGG + Intergenic
1019361399 7:605987-606009 GAGGGAAACAAGGGTGATGCTGG - Intronic
1021310972 7:19095315-19095337 GGGGGAAACAAGGATAATGCTGG + Intronic
1023047377 7:36222381-36222403 GAGGAGGACAAGGAAGAGGAGGG + Intronic
1023531075 7:41155007-41155029 CAGGGGGACATGGATGAAGCTGG - Intergenic
1024585623 7:50839403-50839425 GAGAAGAACAAGGATGAAGCAGG + Intergenic
1027143509 7:75677706-75677728 GAGAGGGATAAAGATGAAGCTGG - Intronic
1027807974 7:82853804-82853826 GAGGGAGTCAAGGATGAAGGAGG - Intronic
1028673902 7:93436048-93436070 CAGGGGCACAAGGATCATGGTGG + Exonic
1029493533 7:100885019-100885041 GAGGAGGAGAAGGAGGAGGCCGG + Exonic
1031307831 7:120155254-120155276 GCAGGGGACATGGATGAAGCTGG + Intergenic
1031755682 7:125638891-125638913 GAGGGTAAGAGGGATGATGCTGG - Intergenic
1033661385 7:143405483-143405505 GAGGGGGACAAGGTAGATAGTGG + Intronic
1034476738 7:151289030-151289052 GAGGGAAACATTGATGATGCTGG + Intergenic
1034855973 7:154547696-154547718 TAGGGGGACAAAGAGGATCCAGG - Intronic
1035202402 7:157276079-157276101 GAGGGGGGCGAGGGTGCTGCAGG - Intergenic
1036128427 8:6085307-6085329 GAGAGGGGCAATGATGATGATGG - Intergenic
1036761597 8:11513287-11513309 CAGGGGTACAAGGCTGATGCTGG + Intronic
1037030154 8:14094431-14094453 TGCGGGGACATGGATGATGCTGG - Intronic
1037135436 8:15454321-15454343 GAGGGGCATAAGGCTGAAGCAGG - Intronic
1039088763 8:33806028-33806050 GAGTGGGACAAGGAGGAAGAGGG - Intergenic
1039718462 8:40136220-40136242 GGGAGGGACATGGATGAAGCTGG + Intergenic
1040510111 8:48085699-48085721 GAGGGTTACAAGGATGCTGCTGG - Intergenic
1040966668 8:53088734-53088756 GAGGGGCACAAGAGTGATGGAGG - Intergenic
1041842507 8:62288536-62288558 TATGGGGACATGGATGAAGCTGG - Intronic
1042199626 8:66268876-66268898 CAGGGGCACAAGGATATTGCTGG - Intergenic
1042359376 8:67865261-67865283 GAGTGGGACAAGGAGGGTTCTGG + Intergenic
1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG + Exonic
1043182991 8:77108541-77108563 TATGGGGACATGGATGAAGCTGG + Intergenic
1043923723 8:86013338-86013360 GGGGGTGACAGGGATGATGGGGG - Intronic
1044184941 8:89239920-89239942 GAGGGGGAAAAGGAAGAAACAGG - Intergenic
1044611888 8:94099662-94099684 GAGGGGGAGATGAATGATGCAGG + Intergenic
1045479043 8:102577989-102578011 GAGAGGGACAAAGAGGATCCTGG + Intergenic
1048177544 8:132166429-132166451 GAGGGGGTACAGGAAGATGCTGG - Intronic
1048587181 8:135785143-135785165 GCAGGGGACATGGATGAAGCTGG - Intergenic
1049611033 8:143555443-143555465 GAGTTGGGCAAGGAGGATGCAGG - Intronic
1049925232 9:401049-401071 GATGGTGACAATGATGATGGTGG - Intronic
1050043414 9:1519280-1519302 GAGAGGGAGCAGGAGGATGCTGG + Intergenic
1052430856 9:28365186-28365208 GAGTGGGAGAGGGATGATGGCGG + Intronic
1055006410 9:71512340-71512362 TATGGGGACATGGATGAAGCTGG - Intergenic
1056690699 9:88806548-88806570 GAGGAGGAGGAGGCTGATGCGGG + Intergenic
1056795273 9:89654913-89654935 GAGGGGGCCAAGGAGGATCTTGG - Intergenic
1057191847 9:93092772-93092794 CATGGGGACAAGGATGGGGCAGG + Intergenic
1057290655 9:93804740-93804762 CAGGGGGACATGGATGAAGCTGG + Intergenic
1058320380 9:103622595-103622617 GAGGGGGAGAAGAAAGATGAGGG - Intergenic
1058795372 9:108492647-108492669 TGGGGGGACATGGATGAAGCTGG - Intergenic
1059183242 9:112240071-112240093 GAGGGGTAGAAGGATGAAGTAGG + Intronic
1060325906 9:122615393-122615415 GAGGACCACCAGGATGATGCAGG - Exonic
1061227635 9:129289969-129289991 GAGGGGGCCAAGGGAGAAGCTGG + Intergenic
1202629874 M:7791-7813 GATGAGGACTAGGATGATGGCGG - Intergenic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1185532919 X:835993-836015 CAGGGGGACATGGATGAAGCTGG - Intergenic
1185830102 X:3293293-3293315 GAGGAGGAGGAGGATGAGGCAGG + Intergenic
1186775304 X:12858593-12858615 TATGGGGACATGGATGAAGCTGG - Intergenic
1187551331 X:20308877-20308899 GAGGAGGAAAAGGATGAAGATGG - Intergenic
1190755944 X:53402286-53402308 AAGGGGGACAAGGGAGATGGAGG - Intronic
1191777221 X:64828109-64828131 GATGAGGACATGGATGAAGCTGG - Intergenic
1191912171 X:66162899-66162921 GAAGGGGACAGGTATGATGGGGG - Intronic
1193184483 X:78495990-78496012 GAGGGAAACAAGCATGAGGCAGG + Intergenic
1193308727 X:79979893-79979915 GGGGGGGACATGGATGGAGCTGG - Intergenic
1195220533 X:102742095-102742117 GAGATGGACAAGAATGATGAGGG - Intronic
1196416305 X:115475422-115475444 AAGCGGGAAATGGATGATGCAGG - Intergenic
1197347497 X:125342102-125342124 GGGGGGGACATGGATGAAGCTGG - Intergenic
1197960518 X:132000521-132000543 GATGGGGAAAGGGATGAGGCAGG + Intergenic
1198297361 X:135300872-135300894 GAGGGAGGGAAGGATGAGGCAGG + Intronic
1198519500 X:137438431-137438453 GAGGAGGACAAGGGGGGTGCGGG + Intergenic
1199173300 X:144757025-144757047 GAGGGGCACCAACATGATGCTGG + Intergenic
1200115719 X:153768920-153768942 TGGGGGGACAAGGACGAGGCTGG - Intronic