ID: 1144080955

View in Genome Browser
Species Human (GRCh38)
Location 17:11763374-11763396
Sequence GTCCAACAGCACCACCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144080950_1144080955 29 Left 1144080950 17:11763322-11763344 CCAAAGAACTTGACGGACCATGA 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1144080955 17:11763374-11763396 GTCCAACAGCACCACCAGAATGG 0: 1
1: 0
2: 0
3: 9
4: 152
1144080951_1144080955 12 Left 1144080951 17:11763339-11763361 CCATGAGTCCACTGAAACTGAGT 0: 1
1: 0
2: 1
3: 17
4: 143
Right 1144080955 17:11763374-11763396 GTCCAACAGCACCACCAGAATGG 0: 1
1: 0
2: 0
3: 9
4: 152
1144080953_1144080955 4 Left 1144080953 17:11763347-11763369 CCACTGAAACTGAGTGGTTCCAT 0: 1
1: 0
2: 0
3: 16
4: 149
Right 1144080955 17:11763374-11763396 GTCCAACAGCACCACCAGAATGG 0: 1
1: 0
2: 0
3: 9
4: 152
1144080949_1144080955 30 Left 1144080949 17:11763321-11763343 CCCAAAGAACTTGACGGACCATG 0: 1
1: 0
2: 1
3: 0
4: 57
Right 1144080955 17:11763374-11763396 GTCCAACAGCACCACCAGAATGG 0: 1
1: 0
2: 0
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144080955 Original CRISPR GTCCAACAGCACCACCAGAA TGG Intronic
900186100 1:1333947-1333969 GGCCAGCAGCACCACCAGCCAGG - Exonic
900380966 1:2383690-2383712 GTCCAGCAGCACTAACAGATAGG - Intronic
900437394 1:2637686-2637708 GTCCAGCAGCACTAACAGGAAGG + Intronic
903376873 1:22872080-22872102 GTCCCTTAGCACCATCAGAAAGG - Intronic
904602739 1:31682893-31682915 TTCCAGCAACACCACCAGCATGG + Intronic
906574560 1:46876034-46876056 TTCCCATAGCACGACCAGAAGGG + Intergenic
907953210 1:59203938-59203960 GTCACACACCACCACCAGAGAGG + Intergenic
909868994 1:80714790-80714812 CTCCCACAGAACCTCCAGAAAGG - Intergenic
910008687 1:82433329-82433351 CTCCCACAGAACCTCCAGAAAGG - Intergenic
912872633 1:113323677-113323699 TTGTCACAGCACCACCAGAATGG - Intergenic
917744473 1:177994398-177994420 TTCCAACATCACCAGCAGATTGG + Intergenic
918524065 1:185446034-185446056 GTCCAACAGGATATCCAGAAGGG + Intergenic
920145971 1:203861433-203861455 GTCCTACAGCGCCACCTGGAGGG - Intergenic
920697125 1:208189436-208189458 GTCCAGCAGGCCCACCAGAAGGG + Intronic
921032662 1:211347289-211347311 GCCCAACAGCAGAACTAGAAAGG - Intronic
921496312 1:215846180-215846202 CACCACCAGCACCACCAAAAAGG - Intronic
924479374 1:244413867-244413889 ATCCAGCAGAGCCACCAGAAAGG + Intronic
1064810389 10:19191216-19191238 GTCCAACATCACCAACATTAGGG + Intronic
1065322718 10:24524155-24524177 GCACAACTGCACCAGCAGAAAGG + Intronic
1067550046 10:47227711-47227733 GTCTCACAGCACAGCCAGAAGGG + Intergenic
1068666094 10:59677599-59677621 GGCCAAAAGCACCAAAAGAAAGG + Intronic
1070676373 10:78414456-78414478 GTTCAACACCACCACAAGAAGGG - Intergenic
1072054404 10:91740251-91740273 TGCCAGCAGCACCAGCAGAATGG + Intergenic
1073713991 10:106081041-106081063 GTTCAAAAGAACTACCAGAACGG + Intergenic
1075275311 10:121087420-121087442 GTCCACCAGCCCCAGCAGCAGGG - Intergenic
1075787698 10:125061285-125061307 TGCCAACAGCGCCACCAGAGGGG - Intronic
1076423929 10:130354020-130354042 GTCCATCAGCACCCCCGGGATGG - Intergenic
1077800035 11:5528025-5528047 GACCACCAGCCCCACTAGAAGGG + Intronic
1078536672 11:12180395-12180417 GTGCAGCAGCACCAGAAGAAAGG - Intronic
1079812471 11:25012489-25012511 CTTCAGCAGCACCAGCAGAAGGG - Intronic
1081992729 11:47346481-47346503 CTCCAGCTGCCCCACCAGAAGGG - Intronic
1082099142 11:48157482-48157504 ATCCATCAGCATCACCAGGAGGG + Intronic
1083329934 11:61892726-61892748 TTCCATCAGAACCACCTGAAAGG + Intergenic
1083721854 11:64607420-64607442 GTCCAGCAGCACCACGGGCATGG - Exonic
1085420595 11:76355163-76355185 GGACATCAGCACCTCCAGAAAGG + Intronic
1085815036 11:79728158-79728180 GTAGCACAGCACCACCAGGAAGG - Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1090741677 11:129667567-129667589 GTACTACAGACCCACCAGAATGG + Intergenic
1092337111 12:7642855-7642877 TTCCCATAGCACAACCAGAAGGG + Intergenic
1104055232 12:125225008-125225030 ATCCCACACCTCCACCAGAAAGG - Intronic
1107495817 13:40924645-40924667 TTCCAAAACTACCACCAGAATGG + Intergenic
1108248937 13:48545599-48545621 TCCCAACATCACCACCAAAATGG + Intergenic
1112978435 13:105351099-105351121 GTCCAAAAGAAAAACCAGAACGG - Intergenic
1121228324 14:92338141-92338163 GTCCCACATCACTAACAGAAAGG - Intronic
1121735064 14:96212736-96212758 TTCCATCAGCACCCCCAGAAAGG + Intronic
1122648041 14:103207791-103207813 GCCCACCAGCACCAGCAGGACGG - Intergenic
1124555309 15:30719604-30719626 GTTCAACAGCATCACCAGCCAGG + Intronic
1124675952 15:31686090-31686112 GTTCAACAGCATCACCAGCCAGG - Intronic
1127190099 15:56520438-56520460 GTCTAACTGCCCCATCAGAAAGG + Intergenic
1127202891 15:56676473-56676495 GACCCACACCATCACCAGAAAGG + Intronic
1129122530 15:73409621-73409643 CTCCAACAGAACCACAGGAAAGG + Intergenic
1131968641 15:97871152-97871174 GTGCATCAGGTCCACCAGAAGGG - Intergenic
1136586206 16:31186944-31186966 GTCCAGAACCACCTCCAGAAAGG + Intronic
1136748092 16:32609825-32609847 GTTCATGAGCACCACCAGCAAGG + Intergenic
1137677455 16:50310863-50310885 GCCCAACGGCACCACCAGGTGGG + Exonic
1139371268 16:66470913-66470935 GTCCAAGGCCACCACCAGATAGG + Intronic
1203050229 16_KI270728v1_random:869032-869054 GTTCATGAGCACCACCAGCAAGG + Intergenic
1144080955 17:11763374-11763396 GTCCAACAGCACCACCAGAATGG + Intronic
1145263008 17:21365864-21365886 GCCCAGCAGCACAGCCAGAATGG - Intergenic
1146943774 17:36860713-36860735 GGCCAAGAGCACCAGCAGAAAGG + Intergenic
1147200637 17:38799397-38799419 GTCCAACTGCACCAGCACCACGG - Exonic
1147484522 17:40799692-40799714 TTCCAAGGGCACCACCAGCATGG + Exonic
1150450717 17:65265203-65265225 GTCCAACAAGACCAACAGTAAGG - Intergenic
1152342592 17:79733545-79733567 GTACTACAACACCACCAGCAAGG + Exonic
1152880342 17:82811143-82811165 GCCCACCATGACCACCAGAAAGG - Intronic
1153470112 18:5434666-5434688 TTACACCAGCACCACCACAAAGG - Intronic
1157643147 18:49238638-49238660 GTGCAACAGCACCACCAAGGGGG + Intronic
1160979538 19:1810670-1810692 CTCCCACAGCCCCACCAGCATGG - Exonic
925673785 2:6339241-6339263 GTCCCACAGGAGCTCCAGAAAGG + Intergenic
926935018 2:18078257-18078279 ATCCCACAGTACCAACAGAAAGG - Intronic
928129777 2:28641202-28641224 GTTCAACAGCTCCAACCGAAGGG + Intronic
930326212 2:49922168-49922190 GTCCAGCAGCACCACGGGTATGG - Exonic
930665285 2:54095378-54095400 GTCCAACAGCTCCTTGAGAACGG - Intronic
932046597 2:68356568-68356590 GTCCAAGAGGACCAACAGGAAGG + Intergenic
934973935 2:98787160-98787182 GTTCAACAGAACCAACTGAAGGG + Intergenic
935564412 2:104590985-104591007 GTCCATAAGGCCCACCAGAAGGG - Intergenic
936796085 2:116205178-116205200 GTCCAACACCTTCAGCAGAATGG - Intergenic
940993910 2:160126521-160126543 CTGCAACTGCACCACCAGCACGG - Exonic
942322896 2:174751346-174751368 TTCCAGCAGCACCAACAGCAAGG - Intronic
945434516 2:209803344-209803366 GACCACCAGCACCTCCACAAGGG + Intronic
947484755 2:230537864-230537886 GTCCATCAGAACCACCTGAAGGG + Intronic
1169744260 20:8927688-8927710 GTCAAACAGCACAATTAGAAGGG + Intronic
1170593167 20:17786622-17786644 GTTCCATAGCACCAACAGAAAGG + Intergenic
1170891376 20:20378887-20378909 GTCCACCAGCACCACTGTAAGGG - Intergenic
1172947771 20:38702139-38702161 GTCCACCAGCCCCAGCAGATGGG - Intergenic
1173743867 20:45421488-45421510 GTCCAGCAGCAGCACCGGGAAGG - Exonic
1175222724 20:57426626-57426648 CTCCCACAGCACCCCCAGGAGGG + Intergenic
1176025037 20:62981510-62981532 GTCCAGCAGGAACCCCAGAAGGG - Intergenic
1178473253 21:32913882-32913904 GTCCAAGACCACCAACAGCACGG + Intergenic
1178824481 21:36004636-36004658 GTCCAGCATCAGCACTAGAAGGG + Intronic
1183166881 22:36154999-36155021 GTCCATCGGCACCTCCATAAGGG - Intronic
1183505244 22:38205120-38205142 CTCCAAGACCACCAGCAGAATGG - Intronic
1184501588 22:44878025-44878047 TTCCAACAGCTCCTCCAGAGGGG + Intergenic
950635318 3:14310264-14310286 GCCTAACATCCCCACCAGAATGG - Intergenic
952819474 3:37473467-37473489 TTCCCACAGCACCCCCAGGAGGG - Intronic
953823776 3:46232658-46232680 GTGCAACATCACATCCAGAATGG - Intronic
955571853 3:60315683-60315705 ATCCATCAGCAGCAGCAGAATGG - Intronic
958902674 3:99906221-99906243 GTACTACAGCCCTACCAGAAAGG - Intronic
961003189 3:123387875-123387897 GTCACACAGGAGCACCAGAAAGG + Intronic
961755834 3:129126912-129126934 GCCCACCTGCTCCACCAGAAAGG - Intronic
961866224 3:129955351-129955373 GTCCAACTGCAACAGCACAAGGG + Intergenic
962724660 3:138211712-138211734 GTCCAAGCACACCACTAGAAAGG - Intronic
965007257 3:163042479-163042501 GTCAACCAGCACCTACAGAATGG - Intergenic
967119949 3:186373962-186373984 GTGCAGCAGCTCCAACAGAAGGG - Intergenic
968576056 4:1366694-1366716 GACCAGCAGGACCACCAGAGAGG - Intronic
969300291 4:6293412-6293434 TTCCAACAGAACTCCCAGAAAGG + Intronic
970492223 4:16585954-16585976 GTCCAAAAACATCACCAGGATGG - Exonic
971689340 4:29812523-29812545 GCCTAACAGCACCATCAGCAGGG + Intergenic
982525880 4:156477352-156477374 GTTCAACATCACCCCAAGAAAGG + Intergenic
982671863 4:158330326-158330348 GTGCAACAGTACCATAAGAAAGG + Intronic
987648178 5:20703794-20703816 GTCCAAAAGCACCAGAAGGAGGG + Intergenic
988748151 5:34165092-34165114 GTCCAAAAGCACCAGAAGGAGGG - Intergenic
988906646 5:35797555-35797577 GCACAACAGCCCCACCAGAGAGG - Intronic
989625852 5:43428874-43428896 GCCCCACACCACCACCACAAAGG - Intergenic
991043389 5:62197882-62197904 GTCCAACAGAGCCACCTGTAGGG + Intergenic
991267043 5:64731863-64731885 GGCCAGCACCACAACCAGAAAGG - Intronic
993047854 5:82888739-82888761 TGCCACCAGCACCTCCAGAATGG - Intergenic
996767501 5:127049057-127049079 GTCCTACAGGACTACTAGAAGGG + Intronic
998743294 5:145229154-145229176 GTCCCACAGCCCCACAAGAAAGG + Intergenic
1002605900 5:180382546-180382568 GGCCAACACCACAACTAGAAGGG + Intergenic
1005545728 6:26868194-26868216 GTCCAAAAGCACCAGAAGGAGGG - Intergenic
1006517088 6:34551139-34551161 GTCTGCCAGCACCAGCAGAAAGG - Intronic
1007477281 6:42127253-42127275 GTGCAACACCACCACCAACAAGG - Intronic
1009016440 6:57908970-57908992 GTCCAAAAGCACCAGAAGGAGGG - Intergenic
1009935587 6:70231043-70231065 GTGCAGCAGAACCACCAGGAGGG + Intronic
1012065832 6:94551048-94551070 GTCCAACACCAAAACAAGAAAGG + Intergenic
1012397777 6:98819633-98819655 TTCCAACAGCACCACCATCATGG + Intergenic
1013814877 6:114085602-114085624 GTCCCACAAAACCATCAGAATGG + Intronic
1019876020 7:3811614-3811636 GGCCAACAGCAGCAGCAGAGAGG - Intronic
1019932588 7:4233826-4233848 CTCCCCCAGCACCACCAGCAAGG + Intronic
1022221632 7:28319680-28319702 GTCCAAAGGCAGCACCAGAAGGG + Intronic
1023610108 7:41964401-41964423 GTCCATGAGCACCACCAACATGG - Exonic
1026233617 7:68507283-68507305 TTCCAACAGCCTCACCAGACAGG - Intergenic
1029632882 7:101764186-101764208 GTCCAACAGCCTCACCAGGGAGG + Intergenic
1030119160 7:106089639-106089661 GTCCAAAACCACCACCCTAACGG + Intergenic
1030925311 7:115445367-115445389 TTTCAGCAGCACCACCAGCAGGG + Intergenic
1031148826 7:118028937-118028959 TTCTAACAGCACCACAAGAGGGG - Intergenic
1033514519 7:142092952-142092974 GTCCATCAGCTCCACAATAAAGG - Intronic
1036038182 8:5043037-5043059 GTCCCCCATCACCCCCAGAAGGG - Intergenic
1039389088 8:37162761-37162783 GGCCACCAGTACCATCAGAATGG + Intergenic
1040555445 8:48473965-48473987 GTCCTTCACCATCACCAGAAGGG - Intergenic
1042524341 8:69748871-69748893 CTACAACAGCATCACCACAAAGG - Intronic
1043880078 8:85532070-85532092 GTCCAAGAGAACTGCCAGAAGGG - Intergenic
1047360753 8:124166691-124166713 CCCCAACAGCCCCACCAGGATGG - Intergenic
1048801085 8:138194246-138194268 GTCCAACAGCCCCTCCCCAAAGG + Intronic
1051871637 9:21744587-21744609 GTGCACCAGCATCACCTGAAAGG - Intergenic
1052892021 9:33710236-33710258 GTACTACAGACCCACCAGAATGG + Intergenic
1054843884 9:69772029-69772051 GCCCAATAGCAACCCCAGAACGG + Intergenic
1055428369 9:76218608-76218630 GACCTACAGCACCAGAAGAATGG - Intronic
1059527529 9:115006385-115006407 GTCCACCGGCACCGCCTGAAAGG - Intergenic
1061837565 9:133339591-133339613 GTCCATCACCACAACCAGAATGG - Exonic
1062610744 9:137372351-137372373 CTCCCACAGCACCCCCAGAGTGG - Intronic
1062642904 9:137530418-137530440 CTCCAAAAGCACCAGAAGAAGGG - Intronic
1186206025 X:7201575-7201597 CTCCCACAGCACAAGCAGAAAGG - Intergenic
1186394019 X:9189637-9189659 GTCAAACAGCATCCCCAGACAGG - Intergenic
1189588562 X:42487687-42487709 GTCCTAGAGAACCACCAGGAGGG + Intergenic
1194303351 X:92213716-92213738 GTCCAAGAGCTCCAGAAGAATGG - Intronic
1195643308 X:107201504-107201526 GTCCAACAGCAATAACGGAATGG + Intronic
1196010421 X:110881021-110881043 GTGCAACAGCAGCACCACCAAGG - Intergenic
1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG + Intergenic
1199047093 X:143187492-143187514 GTCACAATGCACCACCAGAATGG - Intergenic
1199116826 X:144002238-144002260 GTCAAAAAACACCACCAGGATGG + Intergenic