ID: 1144085407

View in Genome Browser
Species Human (GRCh38)
Location 17:11803876-11803898
Sequence CTGAATCAGGAGAGAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 637}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144085400_1144085407 -3 Left 1144085400 17:11803856-11803878 CCTTTCCTGCCCCAACTTTTCTG 0: 1
1: 0
2: 4
3: 48
4: 541
Right 1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG 0: 1
1: 0
2: 2
3: 56
4: 637
1144085399_1144085407 5 Left 1144085399 17:11803848-11803870 CCACTAATCCTTTCCTGCCCCAA 0: 1
1: 0
2: 2
3: 29
4: 278
Right 1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG 0: 1
1: 0
2: 2
3: 56
4: 637
1144085397_1144085407 19 Left 1144085397 17:11803834-11803856 CCTCTCTCTTTCCTCCACTAATC 0: 1
1: 0
2: 2
3: 37
4: 467
Right 1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG 0: 1
1: 0
2: 2
3: 56
4: 637
1144085396_1144085407 23 Left 1144085396 17:11803830-11803852 CCTGCCTCTCTCTTTCCTCCACT 0: 1
1: 0
2: 12
3: 203
4: 1694
Right 1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG 0: 1
1: 0
2: 2
3: 56
4: 637
1144085398_1144085407 8 Left 1144085398 17:11803845-11803867 CCTCCACTAATCCTTTCCTGCCC 0: 1
1: 0
2: 1
3: 23
4: 314
Right 1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG 0: 1
1: 0
2: 2
3: 56
4: 637
1144085401_1144085407 -8 Left 1144085401 17:11803861-11803883 CCTGCCCCAACTTTTCTGAATCA 0: 1
1: 0
2: 5
3: 30
4: 363
Right 1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG 0: 1
1: 0
2: 2
3: 56
4: 637
1144085395_1144085407 28 Left 1144085395 17:11803825-11803847 CCATGCCTGCCTCTCTCTTTCCT 0: 1
1: 1
2: 48
3: 630
4: 4860
Right 1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG 0: 1
1: 0
2: 2
3: 56
4: 637

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144085407 Original CRISPR CTGAATCAGGAGAGAGAGGC TGG Intronic
900404809 1:2487863-2487885 CTGGTTGAGGAGAGAGGGGCAGG + Intronic
900653870 1:3745398-3745420 CTGAGTCGGGAGAGGGAGGCTGG - Intergenic
900703107 1:4060240-4060262 GGGAAACAGGAGAGAGAGGAAGG - Intergenic
900736066 1:4300261-4300283 CTGGCTCTGGGGAGAGAGGCTGG + Intergenic
900822036 1:4897209-4897231 CAGAAGCAGGAGGGAGAGGCGGG + Intergenic
900905792 1:5556457-5556479 CTGAATCCAGAGAGGAAGGCAGG - Intergenic
901421546 1:9154538-9154560 CTGACTCAGGAGGAAGAGGAAGG - Intergenic
901965971 1:12866662-12866684 CTTATTCAGGAGAGCGAGTCAGG + Intronic
901981365 1:13037042-13037064 CTTATTCAGGAGAGCGAGTCAGG + Intronic
902000720 1:13191887-13191909 CTTATTCAGGAGAGCGAGTCAGG - Intergenic
902019950 1:13337591-13337613 CTTATTCAGGAGAGCGAGTCAGG - Intergenic
902173736 1:14633729-14633751 CTGAATCCTCAGAGAGAGGATGG - Intronic
902192851 1:14775729-14775751 TTGAAGCAGGAGAAAGGGGCAGG + Intronic
902255433 1:15186088-15186110 CTCAGCCAGTAGAGAGAGGCGGG + Intronic
902609674 1:17589664-17589686 CCTAATCAGGAAGGAGAGGCTGG - Intronic
902833127 1:19030269-19030291 CTGGAGCAGGGGAGAGAGGAAGG + Intergenic
902908330 1:19576025-19576047 GTGACTCAGGAGACTGAGGCAGG - Intergenic
903314150 1:22487877-22487899 ATGAATCTGGAGAGGCAGGCAGG - Intronic
903692431 1:25183921-25183943 CTGGATCTGGGCAGAGAGGCAGG - Intergenic
903758912 1:25684198-25684220 CAGTATCGGGGGAGAGAGGCAGG - Intronic
903794954 1:25921773-25921795 CTGTCTCTGGAGAGAGGGGCGGG - Intergenic
904345617 1:29866901-29866923 ATCATTCAGGAGAGAGAGGATGG - Intergenic
904670492 1:32161256-32161278 TTGAGCCAGGGGAGAGAGGCAGG + Intronic
904692580 1:32304858-32304880 CTGAATTAGCCAAGAGAGGCTGG - Intronic
905030238 1:34877475-34877497 CTGAACCAGGAGAAAGAAGAGGG + Intronic
905587374 1:39131273-39131295 CTTACTCAGGAGATGGAGGCAGG - Intronic
905599317 1:39235394-39235416 CTGAGTCAGGAGAATCAGGCAGG + Intronic
905680721 1:39869199-39869221 CTGAAGCAGGAGAATCAGGCAGG - Intronic
906295720 1:44647869-44647891 CTCAATCAGGAAGCAGAGGCTGG - Intronic
906574054 1:46871712-46871734 GCGACTCAGGAGACAGAGGCAGG - Intergenic
907216795 1:52870760-52870782 CTGAGGCAGGAGAGTCAGGCAGG + Intronic
907243639 1:53093901-53093923 CAGGAGCAGGAGGGAGAGGCAGG - Intronic
907499512 1:54867950-54867972 CTGAACCAGGAGTCAGAAGCTGG + Intronic
907720820 1:56970595-56970617 ATGAAACAGGAGAGGCAGGCAGG + Intergenic
909029666 1:70524360-70524382 CTGAAGCAGGAAGGAGAAGCAGG - Intergenic
909087065 1:71180764-71180786 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
910002128 1:82353859-82353881 TGGAAGCAGGAGAGAGAGGGAGG + Intergenic
910038774 1:82822000-82822022 ATGAGCCTGGAGAGAGAGGCAGG + Intergenic
910754477 1:90672788-90672810 GTTACTCAGGAGATAGAGGCAGG - Intergenic
911062956 1:93763665-93763687 ATGAGTCTGGAGAGAGAGGTGGG - Intronic
911235541 1:95407983-95408005 TTGGATCAGGAGAGAGCGGGTGG + Intergenic
912431986 1:109632842-109632864 CTGGAGCAGGAGGGGGAGGCTGG + Intergenic
913125525 1:115784148-115784170 CTGAAAGAGCAGAGAGAGGAGGG + Intergenic
913331700 1:117672920-117672942 GTGAGACAGGATAGAGAGGCAGG + Intergenic
913333471 1:117686381-117686403 CTAAATCAGGATAGAGAAGAGGG + Intergenic
913346118 1:117812828-117812850 CTGCTTCAGGAGAGAGAGCAAGG - Intergenic
914439082 1:147687268-147687290 AGGAAGCAAGAGAGAGAGGCAGG - Intergenic
914664174 1:149819165-149819187 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
914671588 1:149874677-149874699 CTGAGGCAGGAGAATGAGGCAGG + Intronic
914777845 1:150754537-150754559 GTTACTCAGGAGAGTGAGGCAGG - Intronic
914890066 1:151613601-151613623 CTGCAGCAGGGGAGAGAGGGTGG - Intronic
914893990 1:151652090-151652112 CTGAGTCAGGAGAATCAGGCAGG + Intronic
915581003 1:156813432-156813454 CTGACTCAGGAGGCTGAGGCAGG + Intronic
915591195 1:156871600-156871622 CTAGATCAGGAAAGAGAGGGGGG - Intronic
916037191 1:160932758-160932780 CTGAGGCAGGAGAAAAAGGCAGG - Intergenic
916192915 1:162196636-162196658 CAGAAACAGGAAAGAGATGCTGG + Intronic
916291002 1:163166108-163166130 TAGAAGCAGGAGAGAAAGGCGGG + Intronic
916620424 1:166490520-166490542 CTAATTCAGGAGAGAGAAGATGG + Intergenic
916943701 1:169702602-169702624 GTGGATGAGCAGAGAGAGGCAGG - Intronic
916993493 1:170270112-170270134 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
917058692 1:171013007-171013029 CTGAAAGATGAGAGAGAGGAGGG - Intronic
917516479 1:175712697-175712719 CAGAAGCAAGAGAGAGAGGGTGG - Intronic
917665117 1:177218715-177218737 CTGACTTAGGGGAGAGAGGAAGG + Intronic
917834433 1:178930152-178930174 ATGAAGCAGCAGAGAGAGCCTGG + Intergenic
918022871 1:180711513-180711535 CTGAGGCAGGAGAATGAGGCAGG + Intronic
918403731 1:184191321-184191343 CTGAATCAGGGGAGAGGGTGGGG + Intergenic
918563866 1:185902626-185902648 ATGAATGAGGAGAAAGAGTCAGG + Intronic
920047935 1:203145732-203145754 CTGAAACTGGAGAGAGATGGTGG - Intronic
920055727 1:203189942-203189964 CTGGATCAGGAGCCAGAGGGTGG + Intergenic
920096779 1:203491708-203491730 ATGGATAGGGAGAGAGAGGCGGG - Intergenic
920235044 1:204497255-204497277 CTGAATCAAGAGAGAGGGAGGGG - Intergenic
920371512 1:205482113-205482135 CTGGACAAGGAAAGAGAGGCAGG - Intergenic
920378735 1:205523432-205523454 CTCCCTCAGGACAGAGAGGCAGG + Intronic
921238537 1:213153128-213153150 CTGAGTCAGGAGAGTCAGGCAGG + Intronic
921318334 1:213913439-213913461 GTGACTCAGGAGACTGAGGCAGG - Intergenic
922356291 1:224779521-224779543 CAGGAGCAGGAGAGAGAGGGTGG + Intergenic
922362983 1:224840013-224840035 CTGAATCAGAAGAGAGCGAAGGG + Intergenic
922575744 1:226659643-226659665 CTGAAGCTGGAGGGAGATGCAGG + Intronic
922814990 1:228442387-228442409 CTAAATCAGGAGACACAGACCGG + Intergenic
922872680 1:228915957-228915979 CTTACTCAGGAGACTGAGGCAGG + Intergenic
923109515 1:230879771-230879793 CTGATTGAGGAGGGGGAGGCTGG - Intergenic
923109528 1:230879808-230879830 CTGATTGAGGAGGGGGAGGCCGG - Intergenic
923129361 1:231061795-231061817 CGCAATGAGGAAAGAGAGGCTGG + Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923793178 1:237128273-237128295 CTGAGTCAGGAGAATCAGGCAGG + Intronic
924820359 1:247483918-247483940 CTAACTCAGGAGACTGAGGCAGG + Intergenic
1062876966 10:950632-950654 CTAAATAAAGAGAGAGACGCAGG - Intergenic
1064070884 10:12227155-12227177 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1064074955 10:12261312-12261334 ATGAATCAGGTGAGAGACGGAGG - Intergenic
1064464217 10:15563058-15563080 CAGAACCAAGAGAGAGAGGGTGG - Intronic
1064865700 10:19877184-19877206 TAGAATGAGGAGAGAGAGGGAGG + Intronic
1065624851 10:27619829-27619851 CTGGAGCAGGAGAGAGAGACGGG + Intergenic
1066442211 10:35449622-35449644 ATGATGCAGGAGAGAGAGGGTGG + Intronic
1067120221 10:43466087-43466109 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1067714234 10:48674223-48674245 TTGAAAAAAGAGAGAGAGGCTGG - Intergenic
1067970137 10:50960403-50960425 CTGAATCTGGAGGCAGAGACCGG + Intergenic
1068397511 10:56483203-56483225 CTGTTTCAGGATACAGAGGCAGG + Intergenic
1069167695 10:65183911-65183933 ATGAAACAGAATAGAGAGGCAGG + Intergenic
1069686979 10:70324696-70324718 CTGAATCTAGTGAGAGAAGCCGG + Intronic
1069716695 10:70525796-70525818 CTGCAGCTGGAGACAGAGGCAGG - Intronic
1070135308 10:73689083-73689105 CTGAAGCAGGAGAATCAGGCAGG - Intronic
1070393862 10:75994542-75994564 CGGGAGCAGGAGAGGGAGGCTGG + Intronic
1071435957 10:85648411-85648433 TGGAACCTGGAGAGAGAGGCTGG - Intronic
1072669818 10:97421078-97421100 CTGCATCAGAACAGAAAGGCAGG - Intronic
1073015616 10:100396799-100396821 CTGAATCAGGAGTAATGGGCAGG + Intergenic
1073420686 10:103421499-103421521 CTGATTCAGGAGGAGGAGGCTGG - Exonic
1073614446 10:104978899-104978921 GTGAACCAGGAGAGAGAAGGAGG - Intronic
1074496702 10:113985924-113985946 CAGAGGCAGGAGAGAGAGACAGG + Intergenic
1074734058 10:116409635-116409657 CTGGAACAGAAGAAAGAGGCAGG - Intergenic
1076039391 10:127230591-127230613 ATGAAACAGGATAGAGAGCCTGG - Intronic
1076188243 10:128465162-128465184 CTGAATCAAGAGATAGAAGCCGG - Intergenic
1077498515 11:2898267-2898289 CTGGGTCTGGAGAGAGAGGCAGG - Intronic
1077836926 11:5934113-5934135 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1077837661 11:5938452-5938474 GGGAAAAAGGAGAGAGAGGCGGG + Intronic
1078628703 11:12982272-12982294 GTGACCCAAGAGAGAGAGGCAGG + Intergenic
1078869958 11:15334184-15334206 TTAAATCAGGGGAGAGAGGCTGG - Intergenic
1079292044 11:19197020-19197042 CTGGATCAGGTGCCAGAGGCTGG + Intronic
1079328128 11:19511872-19511894 CTGGGTCAGGAGGGAAAGGCTGG - Intronic
1079684444 11:23339956-23339978 CTGTTTCAAGAGAGAGAGGAAGG - Intergenic
1080385064 11:31806063-31806085 CTGACCCCGGAGAGAGGGGCTGG - Intronic
1082076850 11:47981204-47981226 CAGGATCGGGGGAGAGAGGCGGG + Intronic
1082768642 11:57188247-57188269 TTGCTTCAGAAGAGAGAGGCAGG + Exonic
1083114831 11:60450792-60450814 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1083118749 11:60491024-60491046 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1083154446 11:60814577-60814599 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1083327212 11:61878842-61878864 CTGAGCCTGGGGAGAGAGGCAGG + Exonic
1083404831 11:62449390-62449412 CTGAAACCAGAGAGGGAGGCAGG + Intronic
1083503658 11:63134880-63134902 ATGAAGCTGGAGAGGGAGGCAGG - Intronic
1083516631 11:63265049-63265071 ATGAATCTAGAGAGGGAGGCAGG - Intronic
1083948692 11:65941566-65941588 CTGATGCAGGAGAGAGTGGGAGG + Intergenic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084370668 11:68740530-68740552 CTGAAACAGCAGAGAAAGGAAGG + Intronic
1084615622 11:70233985-70234007 GTGTAGCAGGAGAGAGAAGCAGG - Intergenic
1084645428 11:70454478-70454500 ATGATTCATGAGAGTGAGGCTGG - Intergenic
1085309014 11:75505302-75505324 CTGGATCCTGAGAGGGAGGCAGG - Intronic
1087307874 11:96505756-96505778 CTGCACCAGCAGAGAGGGGCAGG - Intronic
1087806902 11:102565247-102565269 CTGCTTCAGGAGAGAAAGACTGG - Intergenic
1088694463 11:112355033-112355055 GAGAGTCAGGGGAGAGAGGCTGG + Intergenic
1088742980 11:112781817-112781839 TTGAAGCTGGAGAGAGACGCAGG - Intergenic
1089200512 11:116722082-116722104 CTGGAGCAGGACACAGAGGCTGG - Intergenic
1089437419 11:118482084-118482106 CAGAATCAGGTGAGTGAGGAGGG + Exonic
1089701294 11:120245695-120245717 ATGAAGCAGGGCAGAGAGGCTGG + Intronic
1089742155 11:120591905-120591927 CTGAATCAGGGGAGAGATCTTGG + Intronic
1090911384 11:131122594-131122616 CTGAAGGGGGAGAGAGGGGCTGG + Intergenic
1091011123 11:132001572-132001594 AGGAAGCAGGAGAGAGAGGGTGG + Intronic
1091044434 11:132313059-132313081 CTTGATCAGAAAAGAGAGGCAGG - Intronic
1091169945 11:133511109-133511131 CAGAATCAGGTGAGAGAGAGTGG - Intronic
1091282686 11:134390976-134390998 CTGAAGCAGGAAGGAGGGGCGGG + Exonic
1092234779 12:6799883-6799905 CAGAAGCAAGAGAAAGAGGCAGG - Intronic
1092275886 12:7060728-7060750 CAGAACCAGGACAGGGAGGCTGG + Intronic
1092296190 12:7200789-7200811 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1094554251 12:31482688-31482710 CTGACTCAGGAGGCTGAGGCGGG - Intronic
1095243018 12:39883290-39883312 CTGAATCAGGAGAGTGATGGTGG - Intronic
1095311692 12:40705864-40705886 CAGGATCAAGAGAGAGTGGCGGG + Intronic
1096528715 12:52230166-52230188 CAGCCTCAGGGGAGAGAGGCAGG + Intergenic
1096589690 12:52649353-52649375 CTCAAGCAGGAGAGAGGGGCTGG - Intronic
1096656951 12:53097903-53097925 CTGTCTCAGGAGGGAGGGGCAGG + Exonic
1096738547 12:53675453-53675475 CTAAGGCAGAAGAGAGAGGCTGG - Intronic
1097350326 12:58541977-58541999 GTGACTCAGGAGACTGAGGCTGG + Intergenic
1097362205 12:58670566-58670588 CTGGATGAGGAGGCAGAGGCAGG + Intronic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1098905222 12:76155009-76155031 GTGATTCAGGAGGGTGAGGCAGG - Intergenic
1099433226 12:82613913-82613935 TTGAATGAGGAGAGAAAGGGAGG + Intergenic
1100257070 12:92895265-92895287 CTGAGGCAGGAGACTGAGGCGGG - Intronic
1100584197 12:95964281-95964303 CTGCATCAGGAGAGACCAGCAGG + Intronic
1100877750 12:98980796-98980818 CTGACTCAGAAGACAGAGACTGG - Intronic
1102168856 12:110826909-110826931 CTGGATCATGAAACAGAGGCCGG + Intergenic
1102418384 12:112784319-112784341 CTGAATAAGAGGGGAGAGGCTGG - Intronic
1102522225 12:113485529-113485551 CTGGCTCAGGGGAGAGAGGGCGG - Intergenic
1102590008 12:113949861-113949883 CTGACTTAGGAGGGAGAGACAGG - Intronic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1103199301 12:119073619-119073641 CTCAAAAAAGAGAGAGAGGCCGG - Intronic
1103317610 12:120069138-120069160 AAAAATCAAGAGAGAGAGGCTGG + Intronic
1103890881 12:124238281-124238303 CTGTAACAGGTGAGAGAGCCTGG + Intronic
1104305491 12:127607336-127607358 CTGAATCCGCAGGGAGAGTCTGG - Intergenic
1104928221 12:132324749-132324771 CTGAACCAGAATGGAGAGGCTGG - Intronic
1105527235 13:21187302-21187324 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
1105664916 13:22543291-22543313 TTGATTCAGGAGAGAGATGATGG - Intergenic
1108754647 13:53485207-53485229 CTGGAGCAGGAGCAAGAGGCAGG - Intergenic
1108950248 13:56083655-56083677 CTGTTTCAGGAGAGAAGGGCAGG - Intergenic
1109479433 13:62929487-62929509 CTGAAAGAGGAGAGAGAGCAAGG + Intergenic
1110231223 13:73169448-73169470 CTGAAGCATGAGAGAGAGATGGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110594221 13:77301105-77301127 CTGAAGGATGATAGAGAGGCTGG + Intronic
1111020020 13:82437329-82437351 GTGGATCAGGAGAGAGAGAGTGG - Intergenic
1111226984 13:85287718-85287740 GTGAGGCAGGAGAGAGAGGAGGG + Intergenic
1112172379 13:96987487-96987509 GTGAATCAGGAAGGGGAGGCTGG + Exonic
1112597993 13:100827160-100827182 CTCAATCTGGAGATCGAGGCAGG + Intergenic
1113165346 13:107434502-107434524 GTGATTCAGGAGAGGTAGGCTGG - Intronic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1113889924 13:113730393-113730415 CTGTGTCAGGATAGAGGGGCAGG - Intronic
1114248716 14:20938455-20938477 CAGAAGCAAGAGAGAGAGGGAGG - Intergenic
1114450093 14:22819683-22819705 CTGAGTCAGGGGAGAGGGGAAGG + Intronic
1114553471 14:23547765-23547787 TTGAATTAGTAGGGAGAGGCTGG - Intronic
1115547306 14:34475558-34475580 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1115703899 14:35978532-35978554 CTGAGGCAGGAGAAACAGGCAGG + Intergenic
1115841260 14:37473220-37473242 AGGAAGCAGGAGAAAGAGGCGGG - Intronic
1115994779 14:39184990-39185012 CTGTATTAGGAAAGACAGGCTGG + Intergenic
1116408978 14:44600912-44600934 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1117730591 14:58718321-58718343 CTGAACTGGGGGAGAGAGGCAGG - Intergenic
1117964134 14:61189524-61189546 CAGAAGCAAGAGAGAGAGGAAGG - Intronic
1118048641 14:62002605-62002627 CTGTCTCCGGGGAGAGAGGCAGG - Intronic
1118500882 14:66361597-66361619 GTGGATTAGGAGAGAGAGGAAGG - Intergenic
1118585877 14:67352679-67352701 CTAAATAAGGTAAGAGAGGCAGG + Intronic
1119254744 14:73185494-73185516 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1119416602 14:74474557-74474579 AGCAATCAGGAGGGAGAGGCAGG + Intergenic
1120144405 14:80963788-80963810 CTGACTCAGGGGAGAAGGGCAGG + Intronic
1120505933 14:85353369-85353391 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1120811791 14:88811561-88811583 CTGCCTCAGGAGACTGAGGCAGG - Intergenic
1120892724 14:89505371-89505393 CTGAGGCAGGAGAAACAGGCAGG - Intronic
1121552791 14:94814983-94815005 CAGAACCTGGAGAGAGAGACAGG - Intergenic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1122153721 14:99738133-99738155 CTGACCCAGGACAGAGGGGCAGG + Intronic
1122212150 14:100180385-100180407 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1122238058 14:100344179-100344201 CTGAGGCAGGAGAATGAGGCAGG - Intronic
1122297537 14:100713804-100713826 TGGAAGCAGGAGAGAGAGGACGG + Intergenic
1122381617 14:101310931-101310953 CTGAATCCGAAAAGAGAGTCAGG + Intergenic
1123098386 14:105777089-105777111 GTGAAGCTGGAGCGAGAGGCTGG - Intergenic
1123107556 14:105849769-105849791 GTGAAGCTGGAGCGAGAGGCTGG + Intergenic
1123786079 15:23674963-23674985 CAGAACCAGGAGAGAGAGGAAGG - Intergenic
1123831750 15:24146233-24146255 CTTCTTCAGGAGAGAGAGACAGG + Intergenic
1125459819 15:39895119-39895141 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1126836258 15:52669015-52669037 CTGAGGCAGGACAGTGAGGCAGG - Intronic
1126907465 15:53383525-53383547 CAGAAGCAAGAGAGAGAGGAGGG + Intergenic
1127338409 15:58013944-58013966 CTGAACCAAGAGAGAAAGCCAGG + Exonic
1127371762 15:58348135-58348157 CTGAATCTGGAGAGTGTGGAAGG - Intronic
1127905354 15:63372275-63372297 TGGCATCATGAGAGAGAGGCTGG - Intronic
1127996851 15:64158063-64158085 CTGTATCTTGAGAGAGTGGCTGG - Intronic
1128129186 15:65214489-65214511 CTGAATGAGGAGACCCAGGCAGG - Intergenic
1128614837 15:69100995-69101017 CTGATTCAGCTGGGAGAGGCAGG + Intergenic
1128648421 15:69393605-69393627 ATGGAGCAGGAGGGAGAGGCAGG - Intronic
1129093762 15:73181608-73181630 CAGGATCAGGAGAGTGAGGTGGG + Intronic
1129157862 15:73730001-73730023 CTGAATCTGGAGAGGGAGTTAGG + Intergenic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129521990 15:76191923-76191945 CTGAATCAGCGGCGAGGGGCCGG - Intronic
1129552664 15:76470354-76470376 CTGAATCTGGGGAAAGAGTCAGG + Intronic
1129896158 15:79107579-79107601 CTGAAACAGCTGAGAGAGGGTGG - Intergenic
1129927256 15:79375613-79375635 CAGAAGCAAGAGAGAGAGGGAGG + Intronic
1130428522 15:83823095-83823117 CTGAGGCAGGAGAATGAGGCAGG + Intronic
1130724598 15:86425767-86425789 CTGATTCAAGAGGGAGAGGTGGG + Intronic
1131191247 15:90318678-90318700 AAGAATCTGGAGAGACAGGCTGG - Intergenic
1131312560 15:91304207-91304229 CTGCAGGAGGAGAGAGAGGGGGG + Intergenic
1132248574 15:100316552-100316574 AGGAAGCAGGAGAGAGAGACAGG - Intronic
1133854440 16:9536451-9536473 CTGAAACTGGAGAGGCAGGCAGG + Intergenic
1134145104 16:11754491-11754513 CTGAATCAACAGAGAGACGGAGG + Intronic
1134857995 16:17536784-17536806 CTGAATGAGAAGAGGGAGCCAGG + Intergenic
1135290196 16:21229716-21229738 CTAAATCAGGGTTGAGAGGCTGG + Intergenic
1135639852 16:24109995-24110017 CTGAGTCAGGAGAGTCAGGCAGG + Intronic
1135676695 16:24421185-24421207 CAGAAGCAAGAGAGCGAGGCTGG - Intergenic
1135682236 16:24467685-24467707 GCTAATCAGGAGAGTGAGGCAGG - Intergenic
1136004003 16:27315831-27315853 CTGAATCTGGAGGGAGACGCTGG + Intronic
1136155035 16:28376825-28376847 CTGAGACAGGAGAATGAGGCAGG - Intergenic
1136165026 16:28448056-28448078 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1136197939 16:28666924-28666946 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136208057 16:28738437-28738459 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136214286 16:28781101-28781123 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136259006 16:29060946-29060968 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1137486417 16:48895177-48895199 ATGAATCTGGAGAGGCAGGCAGG + Intergenic
1137493331 16:48951203-48951225 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1137767417 16:50988637-50988659 GTGAATAATGAGAGAGACGCAGG - Intergenic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1138657855 16:58501094-58501116 CTTCCTCAGGAGGGAGAGGCAGG + Intronic
1138853271 16:60656196-60656218 AGGAAACAGGAGAGAGAGGGAGG + Intergenic
1139431099 16:66911452-66911474 CTGAAGCTGGAGAGAGAGACTGG - Intronic
1140193196 16:72835605-72835627 CTGAAGCAGGTGGGAAAGGCGGG + Intronic
1140248980 16:73277891-73277913 CAGGAGCAAGAGAGAGAGGCAGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140664071 16:77212685-77212707 CCGAGTCAGGAGAGAGCGGGCGG + Intronic
1140993933 16:80242649-80242671 CTGAGTCAGGAGAGTCAGGCAGG - Intergenic
1141424363 16:83935676-83935698 CTGAAGCAAGAGAGCGGGGCTGG + Intronic
1141635987 16:85314154-85314176 CTGCCTCAGGGGAGGGAGGCTGG - Intergenic
1141850589 16:86642654-86642676 CTGAATGAGGTGTGAGGGGCAGG - Intergenic
1142110108 16:88326813-88326835 CTGAGTCAGGAAAGAGCGGGGGG - Intergenic
1142134158 16:88443989-88444011 CTGAAGCAGCAGGGGGAGGCAGG + Intergenic
1142332175 16:89462176-89462198 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1142506118 17:364352-364374 CTGAAGCAGGACAGAGAGAGGGG + Intronic
1142533456 17:598068-598090 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1142705411 17:1690508-1690530 CTGAGTCAGGAGAGTCAGGCAGG + Intergenic
1142913950 17:3118355-3118377 ATGAATAAAGAGACAGAGGCTGG + Intergenic
1143455782 17:7066792-7066814 CTGAAGCAGGAGAAAGAAACTGG + Intergenic
1143506639 17:7369598-7369620 CTGGATTAGGAGAGTGAGACTGG - Intergenic
1143536636 17:7544549-7544571 CTTACTCAGGAGACTGAGGCAGG - Intergenic
1143545121 17:7591029-7591051 CTGAACCAGGAGGGAGAACCTGG + Intronic
1143689503 17:8549795-8549817 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1143742417 17:8964450-8964472 ATGAATCAGGAGACTGAGGCTGG + Intronic
1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG + Intronic
1145684087 17:26637637-26637659 CTGAGGCAGGAGAGTCAGGCAGG - Intergenic
1145920408 17:28605154-28605176 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1145948835 17:28799717-28799739 CTTACTCAGGAGATTGAGGCAGG - Intronic
1146185856 17:30723734-30723756 CCCAATAAGAAGAGAGAGGCCGG + Intergenic
1146747462 17:35345230-35345252 CTGGGTAAGGAGAGTGAGGCAGG - Intergenic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1148022867 17:44565200-44565222 CTGAATCAGGAGATAGAGAGAGG + Intergenic
1148575323 17:48706471-48706493 ATGAAGCAACAGAGAGAGGCAGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148889707 17:50798876-50798898 CTGGATCAGGAGAGAGCAGGAGG + Intergenic
1149114907 17:53081551-53081573 ATGAAGCAGGAGAGGAAGGCAGG + Intergenic
1149217536 17:54375327-54375349 CTGAATCTGGAAAGAAAGGAAGG + Intergenic
1149790707 17:59474574-59474596 CTTACTCAGGAGACTGAGGCGGG - Intergenic
1150943342 17:69717469-69717491 TGGAAGCAGGAGAGAGAGGTGGG - Intergenic
1150974105 17:70064494-70064516 CTGAGGCAGGAGACTGAGGCAGG - Intronic
1151479286 17:74360937-74360959 CAGTAGCAGGAGAGAGGGGCGGG + Intronic
1152128989 17:78465037-78465059 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1152855141 17:82661386-82661408 CTACACCAGGGGAGAGAGGCCGG + Intronic
1153577706 18:6539335-6539357 CAGAGCCAGGAGAGAGAGGAGGG + Intronic
1153633910 18:7097956-7097978 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1153990738 18:10397210-10397232 CTGGATGAGGAAAGAGAGGCGGG + Intergenic
1154041381 18:10859526-10859548 GTGATGCAGGAGAGAGAGCCAGG - Intronic
1154052095 18:10970722-10970744 GTGAGTCAGGAGAAAGAGGAAGG + Intronic
1154267276 18:12890195-12890217 GTGACTCAGGAGACTGAGGCAGG + Intronic
1154396526 18:13995683-13995705 CTGAATCTGGAGGGAGAGCAGGG + Intergenic
1155116502 18:22773556-22773578 AGGAAGCAGGAGAGAGAGGAGGG - Intergenic
1155958592 18:31974950-31974972 TGGCATCAGGAGACAGAGGCTGG + Intergenic
1156139710 18:34091735-34091757 CTGATGCAGGAGAAAGAGGACGG + Intronic
1156184424 18:34645173-34645195 CAGAATCAGAATAGACAGGCTGG - Intronic
1156284507 18:35678084-35678106 CTGAGTCAGTAGAGAGAGACTGG + Intronic
1157048363 18:44130390-44130412 CTGAATCAGGAAACAGTGGGGGG + Intergenic
1157407902 18:47438816-47438838 CAGGAGCAGGAGAGTGAGGCAGG - Intergenic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157697171 18:49732170-49732192 CTGAATGATGAGAGTGAGGCTGG + Intergenic
1157976791 18:52337221-52337243 CAGAAACAGGAGAGAAATGCGGG - Intergenic
1158344883 18:56506281-56506303 CTGAAGTGAGAGAGAGAGGCTGG + Intergenic
1158509850 18:58080679-58080701 CTAAATAAGGAGCGAGAGGGTGG + Intronic
1158803123 18:60936803-60936825 CTGGAGCAGGAGGAAGAGGCAGG + Intergenic
1159340602 18:67127565-67127587 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
1160090615 18:75823359-75823381 ATGAAACAGGAGAGAGAACCAGG - Intergenic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1160719682 19:591716-591738 CTGGAGGAGGAGAGACAGGCGGG - Intronic
1160843804 19:1157883-1157905 CGGACTCAGGAGAGAGAGCTGGG - Intronic
1160843831 19:1158031-1158053 CGGACTCAGGAGAGAGAGACGGG - Intronic
1161239343 19:3213374-3213396 GTGAGGCAGGAGAGAGAGGGAGG + Intergenic
1162044529 19:7989700-7989722 CTGGAGCAGGAGAGAGATGCTGG + Intronic
1162602276 19:11677775-11677797 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1162615575 19:11798166-11798188 CTGCACCAGGAGGGAGAGGCAGG - Intronic
1162654274 19:12117026-12117048 TTGGACCAGGAGGGAGAGGCAGG - Intronic
1162689982 19:12421483-12421505 GTTACTCAGGAGACAGAGGCAGG + Intronic
1162972920 19:14191992-14192014 CCCAATAAGAAGAGAGAGGCCGG - Intronic
1163105257 19:15119510-15119532 CTGAACCTGGAGCGAGAGGTGGG + Exonic
1164231343 19:23290707-23290729 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1164301009 19:23963500-23963522 CTGAGGCAGGAGAACGAGGCAGG - Intergenic
1164697359 19:30255862-30255884 GTGACTCAGGAAAGAGAGGAAGG + Intronic
1165866578 19:38943038-38943060 CTGAAGGAGGAGAGGGAGCCGGG + Intronic
1166053418 19:40274668-40274690 CGGAAGCAGGTGAGAGAGCCGGG + Intronic
1166523988 19:43499536-43499558 CTGTCTCAGGAGAGAGGGCCTGG + Intronic
1166840068 19:45691936-45691958 CTGCCTGAGGAGAGAGAGGCGGG + Exonic
1166864864 19:45829691-45829713 CAGAATCAGGACAGAGAACCAGG + Intronic
1167038648 19:47009226-47009248 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1167045506 19:47046667-47046689 CGGAACCAGGAGAGGAAGGCTGG + Exonic
1167873958 19:52396320-52396342 CTGGATCTGGAGGTAGAGGCTGG + Intergenic
1168092545 19:54095541-54095563 CTGGATCAGGAAGGAGGGGCTGG + Exonic
925067212 2:937793-937815 CTGAGTCAGGAGAGAGTCACGGG + Intergenic
925073547 2:990491-990513 CTGTAATAGGAGAAAGAGGCAGG - Intronic
925368988 2:3329645-3329667 CTGATTCAGGGGAGCCAGGCTGG - Intronic
925554158 2:5110895-5110917 CTGAAGTAGGGGAGAGAGGAGGG + Intergenic
925600000 2:5598555-5598577 CTAAATAAGGAGAGAGAGGTGGG + Intergenic
926215697 2:10903756-10903778 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
926418151 2:12671144-12671166 CTGAATCAGGAGTGGGAGGATGG - Intergenic
926476671 2:13330539-13330561 CTGAATCAGGTCAGAGTGGCTGG - Intergenic
927136635 2:20101643-20101665 CTGAATCAGGAGACAGTAACGGG - Intergenic
927311755 2:21639451-21639473 CAGAAGCAAGAGAGAGAGGCGGG + Intergenic
927781568 2:25943422-25943444 CTGACTTAGCAGAGAGAGTCTGG - Intronic
928135186 2:28682599-28682621 CAGACTCAGGAGAGATAGACAGG - Intergenic
928683901 2:33728383-33728405 CTTTATAAGGAGAGAGAGTCGGG - Intergenic
928974292 2:37067658-37067680 CTGACTCAGGAGGGTGAGGCAGG + Intronic
929043849 2:37772112-37772134 CAGCTTCAGGACAGAGAGGCTGG - Intergenic
929427346 2:41856684-41856706 CAGACGCAGTAGAGAGAGGCAGG - Intergenic
929565394 2:42980656-42980678 TGGCATCAGGAGAGAGAGGGAGG + Intergenic
929862969 2:45694959-45694981 CTGAAGGAGAAGGGAGAGGCAGG - Intronic
930774969 2:55162447-55162469 GTGAGTCAGGAGACAGGGGCTGG - Intergenic
930919608 2:56736415-56736437 ATGAAGCTGGAGAGAGAGGATGG - Intergenic
930990700 2:57650618-57650640 CTGAAGCAGGAGGGTGATGCAGG + Intergenic
931215774 2:60242882-60242904 CTTAAAGAGGAGAGAGAGGCAGG - Intergenic
931576251 2:63721836-63721858 CTGAGTCAGGAGAATCAGGCAGG - Intronic
932123775 2:69125168-69125190 ATGAAGCAGGAGAGAGAGTGGGG + Intronic
932215441 2:69963146-69963168 CTGAATCAGGTGGAAGGGGCTGG - Intergenic
932253944 2:70267688-70267710 CTGAAGCAGGAGAATCAGGCAGG + Intronic
932355419 2:71064549-71064571 ATGAGGAAGGAGAGAGAGGCTGG - Intronic
933161106 2:79026140-79026162 CTGACACAGGAGAATGAGGCAGG - Exonic
935044567 2:99468672-99468694 CTGGATAAGGAGAGATTGGCAGG - Intronic
935213172 2:100955690-100955712 CTGAAGCAGCAGTGAGTGGCTGG + Intronic
935292864 2:101624831-101624853 CGGAATCTGGAGGGAGGGGCGGG - Intergenic
935644525 2:105323215-105323237 CTGGATGAGGAGGGAGAGCCTGG + Intronic
935699928 2:105802568-105802590 CGGAAGCAAGAGAGAGAGGAGGG + Intronic
936433220 2:112482101-112482123 CGGAATCACGGGACAGAGGCGGG + Intergenic
936960096 2:118063998-118064020 CTCAAGTAGGAGAAAGAGGCAGG + Intergenic
937039074 2:118807230-118807252 CTGAAGCTGGGCAGAGAGGCTGG + Intergenic
937217839 2:120323902-120323924 GTCAGTCAGGAGAGAGAGGTGGG - Intergenic
937356376 2:121200515-121200537 TTGAAGGAGGAGGGAGAGGCAGG + Intergenic
939318364 2:140582051-140582073 CTGAATCAGGTGAGAGAACATGG + Intronic
939517030 2:143182051-143182073 CTGAGACAGGAGACTGAGGCTGG - Intronic
939701933 2:145402780-145402802 ATGAAGCAGGAGAGATAAGCAGG - Intergenic
939735111 2:145834420-145834442 CTGAATGAGGTGAGTGGGGCTGG - Intergenic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
940298989 2:152159825-152159847 CTGAGGCAGGAGAATGAGGCAGG - Intronic
940635434 2:156292969-156292991 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
941260669 2:163292742-163292764 CTGAGTCAGGAGGGACAGGCTGG + Intergenic
941347469 2:164388219-164388241 ATGGATCAAGAGAGTGAGGCTGG - Intergenic
942428127 2:175880692-175880714 CTGAATCAGGGGAGAGTGATGGG + Intergenic
942648641 2:178143735-178143757 CTGATGCAGGAGATAGTGGCAGG + Intergenic
942891964 2:181001279-181001301 CTTAATCAGGAAAGAGAGGTGGG + Intronic
944143559 2:196482423-196482445 CTGAATCAGGAATGAGTGGGAGG + Intronic
944417449 2:199493008-199493030 ATGAAGTAGGAGAGAGGGGCAGG + Intergenic
946733747 2:222733883-222733905 CTGCAGCAGGAGAGTGAGTCTGG - Intergenic
946770591 2:223084875-223084897 CTGAATAATGAGAGAGAGCCAGG - Intronic
947411153 2:229841171-229841193 TTGAAAGAGGAGAGATAGGCAGG - Intronic
948141070 2:235671669-235671691 CTTAATGAGGAGAGCGAGTCTGG + Intronic
948274004 2:236694631-236694653 CTGACCCAGGTGAGTGAGGCAGG - Intergenic
948282958 2:236762577-236762599 CAGGATCCAGAGAGAGAGGCCGG + Intergenic
948524312 2:238560750-238560772 CTGAAACAGGTCAGAGGGGCAGG + Intergenic
948668085 2:239548743-239548765 CTGAGTCAGGTCTGAGAGGCGGG + Intergenic
1168736636 20:145698-145720 CTAGAGCAGGAGACAGAGGCTGG - Exonic
1169192554 20:3667389-3667411 CAGAATCAGGAGCGAGTGGAAGG - Intergenic
1169234038 20:3914425-3914447 GTGACTCAGGAGACTGAGGCAGG - Intronic
1169800455 20:9507595-9507617 CTGGACCAGGGGAGAGAGGCCGG + Intergenic
1170317895 20:15062202-15062224 CAGCCTCAGGAGAAAGAGGCTGG + Intronic
1170530024 20:17281818-17281840 GAGAATCAGGTGAGAGTGGCAGG - Intronic
1170823549 20:19774252-19774274 CTGAATCAGGAGAGAGCCCTGGG + Intergenic
1171249290 20:23636425-23636447 CTGCATCAGCTGATAGAGGCAGG + Intronic
1172258601 20:33541455-33541477 CTGAGTAAGGACAGAGAAGCCGG + Intronic
1172303485 20:33865613-33865635 CTCAGGCAGGAGAGTGAGGCTGG - Intergenic
1172728732 20:37068945-37068967 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1172982387 20:38953720-38953742 CTAAGTCAGGAGAGGGAGGAAGG - Intergenic
1173552732 20:43944550-43944572 CTGCAGGAGGAGGGAGAGGCTGG - Intronic
1174116063 20:48227074-48227096 CTTAAGCAGGAGATGGAGGCAGG - Intergenic
1174147573 20:48462904-48462926 TTGGAGCAGGACAGAGAGGCTGG - Intergenic
1174194080 20:48760631-48760653 CTGAGCCAGGAGAGGGAGGCTGG + Intronic
1174354792 20:49990493-49990515 CTGAAGGAGGAGAAAGATGCCGG + Intergenic
1174371448 20:50091511-50091533 CTGACTCAGGAGGCTGAGGCAGG - Intronic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175160766 20:57005915-57005937 CTGAGACTGGAAAGAGAGGCTGG - Intergenic
1175624365 20:60478167-60478189 CTGTGTCAGGAGAGAGAGAAAGG - Intergenic
1177196913 21:17912748-17912770 CTGGATCAGGGGTGGGAGGCAGG + Intronic
1178427059 21:32487278-32487300 CCCAAGCTGGAGAGAGAGGCTGG + Intronic
1180087866 21:45516135-45516157 CTGGAACTGGAAAGAGAGGCCGG + Exonic
1180233659 21:46443504-46443526 CTGGCTCAGGAGGGAGGGGCAGG - Intronic
1181296830 22:21847096-21847118 CTGAGGCAGGAGAAACAGGCAGG - Intronic
1181375918 22:22457868-22457890 TTGCATCAGGAGACAGAAGCTGG - Intergenic
1181441492 22:22938196-22938218 CTGAATGAGGAAAGAAAGGGAGG + Intergenic
1182043432 22:27256133-27256155 TGGAAGCAGGAGAGTGAGGCAGG - Intergenic
1182996294 22:34815959-34815981 CTGGAGCAGGAGAAAGAGACGGG + Intergenic
1183309395 22:37101282-37101304 CTGAAGCAGGAGACAGGGGCAGG + Intronic
1183346736 22:37312271-37312293 CAGAAACAGGAGGGAGAGACTGG - Intronic
1183583468 22:38738989-38739011 CTGAGACAGGAGAGGAAGGCAGG + Intronic
1184119157 22:42439104-42439126 CTGAGGCTGGAGAGAGACGCAGG + Intergenic
1184174350 22:42778865-42778887 CTGAGGCAGGAGACTGAGGCAGG - Intergenic
1184425326 22:44405912-44405934 AGGAATGAGGAGAGAGAGGTTGG - Intergenic
1184996176 22:48209262-48209284 CTGAGACAGGAGAGAAAGCCGGG - Intergenic
1185205663 22:49536591-49536613 CTGAATAGGGGGAGAGAGACCGG + Intronic
951823352 3:26839110-26839132 CTGATTCTGGTGAGACAGGCAGG + Intergenic
951845000 3:27075953-27075975 GTGACTCAGGAGACTGAGGCAGG + Intergenic
952142495 3:30495563-30495585 CTGAGTCAGGAAAGAGACACAGG + Intergenic
953062615 3:39439871-39439893 ATGAATCTGGAGAGGGAAGCAGG - Intergenic
953626923 3:44579350-44579372 CTGAATCAGGAGCGGGTGGGCGG - Intronic
953875157 3:46662453-46662475 GTGAGTCAAGAGAAAGAGGCTGG + Intergenic
954481496 3:50804638-50804660 CTGAAGCAGGAGAATCAGGCAGG + Intronic
955008616 3:54992951-54992973 CTGAAGCAGGAGGAAGAGGGAGG + Intronic
955207462 3:56909414-56909436 CTGATGCTGGGGAGAGAGGCAGG - Intronic
955358349 3:58250556-58250578 CAGAAACAGGAGGGAGAGGAAGG + Intronic
955674710 3:61435617-61435639 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
955875922 3:63490295-63490317 CTGAAAAAGGAGGCAGAGGCTGG + Intronic
956289673 3:67648289-67648311 CTGAAGCCAGAGAGAGAGGAAGG + Intronic
956460925 3:69471761-69471783 CTGAGTCAGAAGAGAGTGGATGG - Intronic
956613141 3:71144645-71144667 ATGAATCACAAGAGATAGGCTGG + Intronic
956775098 3:72558446-72558468 CAGGAGCAAGAGAGAGAGGCAGG - Intergenic
957320659 3:78625960-78625982 CTGAATGAAGAGGAAGAGGCTGG + Intronic
957522437 3:81336926-81336948 CTGAATGAGGTGAGATAGCCAGG + Intergenic
957560859 3:81818877-81818899 ATGATACTGGAGAGAGAGGCTGG - Intergenic
957561015 3:81820826-81820848 ATGAAGCAAGAGAGAGAGGGAGG + Intergenic
959820486 3:110729653-110729675 TTGAAGTAGGAGAGAGAGGTAGG + Intergenic
960650968 3:119949515-119949537 CTGAGTAAGGAGAGAAAGGTGGG + Intronic
960697916 3:120413888-120413910 CTGAGTCAGGAGAATCAGGCAGG - Intronic
961826397 3:129601466-129601488 CTCAAGCAGGAGCGAGAGGCTGG + Intronic
961987670 3:131154818-131154840 ATGAAGCTGGAGAGACAGGCAGG + Intronic
962027419 3:131563024-131563046 CTGAATCCAGAGACACAGGCAGG + Intronic
962230735 3:133663247-133663269 CTGAATTAGGAGAGAGAGAGTGG - Intergenic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
963286899 3:143442100-143442122 CTGAAATAGGAGAGGGAGACAGG + Intronic
963921226 3:150907956-150907978 CTGAAAGAGGAGAGAAAGGTGGG - Intronic
964039633 3:152243915-152243937 CTTACTCAGGAGACTGAGGCAGG - Intronic
965578182 3:170239625-170239647 CTGAATGATGAGAGACAGCCAGG - Intronic
965768323 3:172154592-172154614 CTGACTGAGGGCAGAGAGGCCGG + Intronic
966205125 3:177398319-177398341 CAGAAGCAGGAGAGAGGGGAGGG + Intergenic
966209846 3:177442023-177442045 CTGAAGATGGAGAGAGAGCCTGG + Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
967149736 3:186637584-186637606 CTGAGTGAGGAGGGAGAGGCAGG - Intronic
967293554 3:187944607-187944629 CTGAATGAGAAGTGAGAGGGCGG + Intergenic
967550739 3:190792386-190792408 GAGAAGCAGGAGAGAGAGGAAGG + Intergenic
967810982 3:193760765-193760787 CTCCATCAGGAGAGAGAGCTGGG - Intergenic
967951845 3:194847397-194847419 CTGTACCAGGAGAGAGTGGCTGG + Intergenic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
967959665 3:194910385-194910407 CCGGAGCAAGAGAGAGAGGCTGG + Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968384491 4:124339-124361 CTGAATGAGGCGAGAGTGACAGG - Intergenic
968919771 4:3516507-3516529 CTGAAGCAGGAGGCAGAGGATGG + Intronic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
969689911 4:8698699-8698721 CTGAGCCAGGAGGGACAGGCAGG - Intergenic
969954665 4:10876441-10876463 ATGGATGAGGAAAGAGAGGCCGG - Intergenic
969970054 4:11037609-11037631 TTGAATCAGAAGAGGGAAGCAGG + Intergenic
970306687 4:14739902-14739924 CTGAGATAGGAGGGAGAGGCAGG - Intergenic
971934687 4:33132511-33132533 CTGAAGCAGGAGACAGAGTTTGG + Intergenic
972149390 4:36069933-36069955 CAGAAGCAAGAGAGAGAGGGGGG - Intronic
972723483 4:41724266-41724288 CTGTATCAGGAGGCTGAGGCAGG + Intergenic
972847874 4:43011352-43011374 CTGGAGCAGGATAGAGAGGTTGG + Intronic
973673323 4:53239249-53239271 CTGAGTCAGGAGAGTCAGGCAGG + Intronic
973716949 4:53686200-53686222 CTAAGACAGGAGAGAGAAGCAGG + Intronic
974440832 4:61914807-61914829 TTGCATCAGGAGAAAAAGGCAGG + Intronic
974517032 4:62930030-62930052 CTGAAACAAGAGAGAGACACAGG - Intergenic
974849930 4:67392024-67392046 ATCAATCAAGAGAAAGAGGCAGG + Intergenic
976043293 4:80913506-80913528 GTGTTTGAGGAGAGAGAGGCAGG + Intronic
976149277 4:82077214-82077236 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
976523649 4:86059980-86060002 GGGAATCAGGGCAGAGAGGCAGG - Intronic
976633486 4:87263947-87263969 CAGTATCAGGAGGCAGAGGCAGG - Intergenic
976756628 4:88505336-88505358 GAGAATAAGGAGAGAGAGCCAGG - Intronic
976904161 4:90215858-90215880 ATGAAGCAGGAGAGAAGGGCAGG + Intronic
976909263 4:90280343-90280365 ATGAATGAAGAGAGAGAGGAAGG - Intronic
977118727 4:93069001-93069023 CAGAAACAAGAGAGAGAGGAGGG + Intronic
977204969 4:94157381-94157403 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
978489849 4:109301709-109301731 CTGGCTCAGGTGTGAGAGGCTGG - Exonic
979277969 4:118835020-118835042 CTGAAAAAGAGGAGAGAGGCAGG + Intronic
979305604 4:119139547-119139569 CTGAATGAAGAGAGAGAGGTAGG + Intronic
980431524 4:132705340-132705362 TTAATTCAGGAGAGAGAGGATGG + Intergenic
980715183 4:136618160-136618182 ATGAATCGGGAGACACAGGCCGG - Intergenic
980716819 4:136638563-136638585 CTGAAGCAGGATAGGGAGGTGGG - Intergenic
980755332 4:137151114-137151136 CTGACTCAGGAGGGTGAGGCAGG - Intergenic
980876811 4:138670082-138670104 CTGAAGCAGAAGATTGAGGCAGG + Intergenic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
982216395 4:153086060-153086082 CTGTCTCAGGAGAGAGGAGCTGG + Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
982909487 4:161121136-161121158 CTGAAGCAGGGAAAAGAGGCTGG + Intergenic
983102189 4:163638414-163638436 CTGGAGCAAGAGAGAGAGGGAGG - Intronic
983686496 4:170415579-170415601 CATAATCAGGAGAAACAGGCAGG + Intergenic
984191123 4:176606935-176606957 GTGAAGATGGAGAGAGAGGCTGG + Intergenic
984382746 4:179015960-179015982 GTGAAGATGGAGAGAGAGGCTGG - Intergenic
984398992 4:179237728-179237750 CTGAATCAAGAGATAGTGACAGG + Intergenic
986050394 5:4084548-4084570 CAAAATCAGGAGGGAGAAGCTGG - Intergenic
986284431 5:6349022-6349044 CTGCATCAGGAGGCAGAGACTGG - Intergenic
986413210 5:7502456-7502478 GTGGACCAGGACAGAGAGGCAGG + Intronic
987012653 5:13782969-13782991 CTGGAACAGGGGACAGAGGCTGG + Intronic
987065763 5:14288328-14288350 CTGGGTGGGGAGAGAGAGGCTGG - Intronic
987268154 5:16277748-16277770 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
988119273 5:26940058-26940080 CTGAGGCAGGAGACTGAGGCAGG + Intronic
988407029 5:30836975-30836997 CTGATTCTGGGAAGAGAGGCTGG + Intergenic
989161740 5:38397849-38397871 CAGAAGCAGGTGAGAGAGGAGGG + Intronic
989166318 5:38436704-38436726 GTGAATCAGGCAAGAGAGGGTGG - Intronic
989239819 5:39190845-39190867 ATGAACCAGAAGTGAGAGGCTGG + Intronic
989374879 5:40750444-40750466 CCTACTCAGGAGACAGAGGCAGG + Intronic
990319159 5:54612791-54612813 CTGACTCAGGAGACAGTGACAGG + Intergenic
990978521 5:61580241-61580263 CTGCAGCTGCAGAGAGAGGCAGG + Intergenic
991247598 5:64524771-64524793 CTGAAGCAGGAGAGGGAGAGAGG - Intronic
992461133 5:76961335-76961357 CAGACTCAGGAGAGAGAAGTAGG - Intronic
994758112 5:103819333-103819355 CTGAGGCAGGAGAGGGAGACAGG + Intergenic
995759310 5:115546491-115546513 TTGAATTAGGTGAGAGAGACAGG - Intergenic
996216255 5:120870185-120870207 CAGAATCAGGAAAGAATGGCTGG - Intergenic
996528638 5:124503785-124503807 CTGAATCAGGATAGAGGAGTAGG - Intergenic
997875120 5:137538978-137539000 CTGAGGCAGGAGAATGAGGCAGG + Intronic
997989229 5:138530216-138530238 CTGAATAGGGAGAGTGAGGGTGG + Intronic
998090470 5:139364137-139364159 CTGAATCAGGAGGATGAGGGTGG + Intronic
998107662 5:139478558-139478580 CTGATTCAGGAGTGAGACCCAGG + Intronic
998147031 5:139734796-139734818 CTGGATCAGCAGAGGCAGGCAGG - Intergenic
999087239 5:148903782-148903804 ATGAGGCTGGAGAGAGAGGCAGG - Intergenic
1000203002 5:159030466-159030488 ATGAAGCACTAGAGAGAGGCAGG + Intronic
1000452804 5:161411217-161411239 CTGATTCAGAAGATAGAGACTGG + Intronic
1001499106 5:172214980-172215002 CCGAAATAGGAGAGACAGGCAGG + Intronic
1001534093 5:172486487-172486509 CTCAGGCAGAAGAGAGAGGCTGG - Intergenic
1002304044 5:178273076-178273098 CTAGAGCAGGAGAGAGCGGCCGG - Intronic
1002440033 5:179259449-179259471 ATGAATCAAGGGAGAGAGGAAGG + Intronic
1002440245 5:179260604-179260626 CTGCATCAGGAGGGAGGAGCAGG - Intronic
1002846281 6:948055-948077 CTCAAGCAGGTGAGAAAGGCAGG + Intergenic
1003510157 6:6772939-6772961 CAGGATCGGGAGAGAGAAGCCGG + Intergenic
1003529272 6:6924598-6924620 CAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1003756646 6:9128462-9128484 CAGGATCAAGAGAGAGAGGAGGG - Intergenic
1004154341 6:13154274-13154296 CTTACTCAGGAGGGTGAGGCAGG - Intronic
1004389047 6:15194685-15194707 CTCACTCAGGAGGGTGAGGCTGG - Intergenic
1004491609 6:16122567-16122589 CTGAACCAGGTGAGAGAAGAGGG - Intergenic
1004891552 6:20105694-20105716 CTGAACCAGGAGGCAGAGGCTGG + Intronic
1005085078 6:21997775-21997797 CTGAAGCAGGAGCGAGTGGGTGG + Intergenic
1006149194 6:31976943-31976965 CTGAGGCAGGAGAGTCAGGCAGG + Intronic
1006447044 6:34085425-34085447 GTGAGTCAGTAGAGAGAGGAAGG + Intronic
1006536409 6:34702594-34702616 AAGAATCATGAGACAGAGGCCGG + Intergenic
1006682629 6:35808088-35808110 CTGTATGATAAGAGAGAGGCCGG + Intronic
1007615516 6:43177617-43177639 ATTAAGAAGGAGAGAGAGGCCGG + Intronic
1007693722 6:43718715-43718737 CTGCATCAGGCGTGAGAGCCCGG + Intergenic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1008154406 6:47996169-47996191 CAGAATCAGGAGAGAGTGGCTGG + Intronic
1008377756 6:50810668-50810690 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1009966211 6:70581717-70581739 CTTACTCAGGAGACTGAGGCAGG - Intronic
1010025360 6:71209389-71209411 CTGAATCTAGAGAGACAGGAGGG + Intergenic
1010512999 6:76743761-76743783 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1011660325 6:89589181-89589203 CTGAAGCAGGAGCGAGGAGCTGG + Intronic
1012411488 6:98963056-98963078 GTGAATCTAGAGACAGAGGCAGG - Intergenic
1013659344 6:112278953-112278975 CTGAAGGAGGACAGAGAGGGAGG + Intergenic
1013795997 6:113889601-113889623 CTGGATAAGGAGAAAGATGCTGG + Intergenic
1015229187 6:130894264-130894286 CTGACTCAGGAGGCAGAGGTGGG - Intronic
1016235814 6:141864999-141865021 GTGAATCAGGAGGCTGAGGCAGG + Intergenic
1016858216 6:148693523-148693545 CTGAGTCAGGAGACTGAGGCAGG - Intergenic
1018528288 6:164736903-164736925 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1018795274 6:167180300-167180322 CAGACACAGGAGAGAAAGGCCGG - Intronic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1020115322 7:5473000-5473022 CTGCAGCAGGGGAGAGAGGATGG - Intronic
1022317935 7:29263125-29263147 CTGAGGCAGGAGAGTCAGGCAGG - Intronic
1022456103 7:30559659-30559681 ATGAGGCTGGAGAGAGAGGCAGG - Intergenic
1023183051 7:37504965-37504987 CTGAATCAGGAGGTTGAAGCTGG + Intergenic
1024364876 7:48509287-48509309 CTGGACCAGGAGACAGAGGCTGG - Intronic
1024478348 7:49838172-49838194 GTGAATTAGGAGGCAGAGGCAGG + Intronic
1024482129 7:49874829-49874851 CTGAATTAGGGAAGAGGGGCAGG - Intronic
1025107026 7:56179830-56179852 CTGAGGCAGGAGAAAGTGGCAGG + Intergenic
1025171671 7:56763832-56763854 AAGAATCATGAGAGAGAGGGAGG + Intergenic
1025724590 7:64045288-64045310 CTGAATGAGGAAAGAGTGACAGG - Intronic
1025821789 7:64968969-64968991 CTGAGGCAGGAGAGTCAGGCAGG + Intergenic
1025998895 7:66545785-66545807 ATGTTTCAGGAGAAAGAGGCAGG - Intergenic
1026276258 7:68879672-68879694 TTGAAAGTGGAGAGAGAGGCAGG - Intergenic
1026797458 7:73375626-73375648 CTGAATCAGCAGAGAGGAGAAGG + Intergenic
1026868061 7:73835320-73835342 CTGAGTCAGGAGAGTCAGGCAGG - Intronic
1026991953 7:74591131-74591153 ATGTTTCAGGAGAAAGAGGCAGG - Intronic
1029871381 7:103696653-103696675 CAGAATTAGGAGTGAGAGGATGG - Intronic
1030067779 7:105673647-105673669 CTGGAGTTGGAGAGAGAGGCAGG + Intronic
1033778512 7:144641572-144641594 ATGAATGAGGAGAGGCAGGCAGG + Intronic
1034281681 7:149859125-149859147 ACTAAGCAGGAGAGAGAGGCAGG - Intronic
1034740674 7:153470849-153470871 CTGAAGTCAGAGAGAGAGGCAGG + Intergenic
1035265954 7:157690475-157690497 CTGGAAGAGGCGAGAGAGGCTGG - Intronic
1035458769 7:159026383-159026405 TTTAATGAGGAGAGAGGGGCAGG - Intergenic
1035476744 7:159149268-159149290 CAGAAGCAGAAGGGAGAGGCTGG - Intergenic
1036297096 8:7546338-7546360 CTGAACCGGAAGAGACAGGCAGG + Intergenic
1036325473 8:7774681-7774703 CTGAACCGGAAGAGACAGGCAGG - Intergenic
1036479308 8:9124098-9124120 CTGAATTAGGAAAGAGAGGAAGG + Intergenic
1038257233 8:25961472-25961494 CCTACTCAGGAGAGTGAGGCAGG - Intronic
1038269862 8:26066342-26066364 AGGCATCAGGAGAGAGAGGAAGG - Intergenic
1038964083 8:32551843-32551865 CTGAATCAGTATGAAGAGGCTGG - Intronic
1042837418 8:73091201-73091223 CTGCTGGAGGAGAGAGAGGCAGG - Intronic
1043519642 8:81030688-81030710 TTGAATCAGGAGGGAGAGCGAGG - Intronic
1043788727 8:84435730-84435752 AAGATTCAGGAAAGAGAGGCTGG - Intronic
1044622960 8:94208600-94208622 CTGAAGCTGAAGGGAGAGGCTGG - Intronic
1046669189 8:117038996-117039018 CTGAAACAGCAGAGAGATTCAGG + Intronic
1047306164 8:123654714-123654736 CAGAATCACGAGAGAGAGTGAGG + Intergenic
1047377722 8:124318484-124318506 CTTACTCAGGAGGCAGAGGCAGG - Intronic
1047407229 8:124595786-124595808 GTGAATCTGGAGAGTGTGGCAGG + Intronic
1047711117 8:127553440-127553462 CAGTAGCAAGAGAGAGAGGCAGG - Intergenic
1047991920 8:130295409-130295431 CTGAATCAAGACAGAGAGCTAGG + Intronic
1048146927 8:131854164-131854186 CAGAAGCAAGAGAGAGAGGGTGG - Intergenic
1048313355 8:133343400-133343422 CTGATTGAGTAGATAGAGGCTGG + Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1049640592 8:143713411-143713433 CTGAAGCAGGAGAGAGGAGAGGG + Intronic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1051262210 9:15275637-15275659 CTTCATCAGGAGATAGAGGAAGG + Intronic
1051276706 9:15405933-15405955 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1052652988 9:31326653-31326675 CTGAATCTGAAAAGAGAGTCAGG - Intergenic
1052824690 9:33166635-33166657 CTGATCCAGAAGAGGGAGGCTGG + Intronic
1053467854 9:38324132-38324154 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1055048328 9:71953999-71954021 CTGAGGCAGGAGACTGAGGCTGG + Intronic
1055287515 9:74745076-74745098 ATGTATTAGGAGAGAGAGACAGG + Intronic
1055439796 9:76326602-76326624 CTAAATCAGGAAATTGAGGCTGG - Intronic
1056097122 9:83266732-83266754 GTGAGTCAGGAGGGAGAGGGAGG - Intronic
1056336289 9:85573200-85573222 CTGAGGCAGGAGAGTCAGGCAGG - Intronic
1056800445 9:89687118-89687140 ATGAATATGCAGAGAGAGGCTGG - Intergenic
1056981999 9:91322426-91322448 CTGAAGCTGGGGAGAGAAGCAGG + Intronic
1057077067 9:92143503-92143525 CTGAGTCTTGAGAGAGAGGGGGG - Intergenic
1057716329 9:97498792-97498814 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1057777484 9:98022618-98022640 GTGACTCAGGAGACTGAGGCCGG - Intergenic
1058095375 9:100854331-100854353 TTTAATCAGGAGAGAGTGACAGG + Intergenic
1058357687 9:104103486-104103508 GTGATTCAGGAGAGAGAGATGGG + Intronic
1059252813 9:112902422-112902444 GTGAAGCAGGAGAGAGAAGCTGG - Intergenic
1059851401 9:118345206-118345228 GTGAAGCAGGAGAGAGAAGGAGG + Intergenic
1060788419 9:126468631-126468653 CTGAACCAGGCGAGGGACGCTGG - Intronic
1062499698 9:136847064-136847086 CTGGATCAGGACGGCGAGGCGGG + Exonic
1185650776 X:1646376-1646398 CTGCCTCAGGAAAGAGAAGCTGG - Intergenic
1185665157 X:1759824-1759846 CTAAGTCATGAGAGAAAGGCAGG + Intergenic
1185728042 X:2438554-2438576 CTGCCTCAGGAGGGTGAGGCAGG + Intronic
1185990079 X:4884112-4884134 CTGAGTCAGGAGAGACGGGAGGG - Intergenic
1186576048 X:10766795-10766817 CTGAGTCAGGAGGCTGAGGCGGG + Intronic
1187009759 X:15267299-15267321 CTGCCTCAGGAGGGAGAGGCAGG - Intronic
1187277440 X:17828321-17828343 AGGAATCAGGAGAGAGAGGGAGG - Intronic
1187502043 X:19846993-19847015 CTGAATCAGCTGTAAGAGGCAGG + Intronic
1190482989 X:50896339-50896361 CGGAGTCAAGAGAGAGAGACAGG + Intergenic
1191709982 X:64139444-64139466 CTGAAGGAGGAGAAAGAGCCAGG - Intergenic
1192218912 X:69183449-69183471 GTGAAGAAGAAGAGAGAGGCAGG - Intergenic
1192251994 X:69421491-69421513 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1193123519 X:77847720-77847742 CTTACTCAGGAGACGGAGGCAGG - Intronic
1193423010 X:81307377-81307399 CTGAATGAGGAGAAAGAGTAAGG - Intergenic
1194347823 X:92787395-92787417 TAGAAGCAAGAGAGAGAGGCAGG + Intergenic
1195723925 X:107894058-107894080 CTGAACCAGATGAGGGAGGCAGG - Intronic
1196617820 X:117787424-117787446 CTGAATCATCAGAAAGTGGCGGG + Intergenic
1197017439 X:121643539-121643561 GTGAATCTGGAGAGAGAATCAGG + Intergenic
1197030770 X:121811579-121811601 ATGAATCAGAATAGAGAGCCTGG - Intergenic
1197479219 X:126962264-126962286 CTGAATCTGGAAAGAAAGGAAGG - Intergenic
1197971370 X:132118707-132118729 CTGAGACAGGAGAGACAAGCAGG - Intronic
1198003213 X:132462223-132462245 GAGAAACAGGAGAGAGAGGGAGG - Intronic
1198847881 X:140932127-140932149 CTGAATGGAGACAGAGAGGCTGG - Intergenic
1199586284 X:149420235-149420257 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1199673531 X:150166018-150166040 CTCCATCAGGAGATGGAGGCAGG - Intergenic
1200248407 X:154538844-154538866 TTGAACCAGGAGGGAGAGACTGG + Intronic
1200656151 Y:5904031-5904053 TAGAAGCAAGAGAGAGAGGCAGG + Intergenic
1201236322 Y:11915449-11915471 CTGAATCAGGGCAAAGAGGAAGG - Intergenic
1201519063 Y:14852261-14852283 ATTACTCAGGAGAGCGAGGCAGG + Intergenic
1201583988 Y:15540534-15540556 GTGGATCAGGAGAGAGAGAGAGG + Intergenic
1201979765 Y:19893679-19893701 CTCAAGAAGGTGAGAGAGGCTGG - Intergenic