ID: 1144090180

View in Genome Browser
Species Human (GRCh38)
Location 17:11849371-11849393
Sequence GCCACTGGTGTGTTTTCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144090180_1144090186 28 Left 1144090180 17:11849371-11849393 CCTGCCGAAAACACACCAGTGGC 0: 1
1: 0
2: 1
3: 11
4: 128
Right 1144090186 17:11849422-11849444 ACTCCTCATACTTCTTCCCATGG 0: 1
1: 0
2: 1
3: 29
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144090180 Original CRISPR GCCACTGGTGTGTTTTCGGC AGG (reversed) Intronic
901296746 1:8166634-8166656 ACAGCTGGTGTGTTTTTGGCAGG + Intergenic
904687826 1:32273720-32273742 GTCACTGGAGGGTTTTCTGCTGG + Intronic
905975146 1:42168903-42168925 GCCACTGATGGGTTTTCAGAGGG - Intergenic
906197321 1:43936973-43936995 GTCTCTGGTGTCTTTTAGGCTGG - Exonic
906670289 1:47649273-47649295 GCCACTCGTGTTTTTTCTTCAGG - Intergenic
906698871 1:47843190-47843212 GCCACTGGAGGGTTTTAAGCCGG + Intronic
910581096 1:88825786-88825808 GCCACTGAAGAGTTTTCAGCAGG - Intronic
912654712 1:111476059-111476081 GACACTGGTGAGTTTACGACAGG + Exonic
912761063 1:112368020-112368042 GCCACTGGAGGGTTTTCTGTAGG - Intergenic
913148570 1:116017103-116017125 TACACTGGTGTGTTTTCACCTGG + Intronic
914006499 1:143736672-143736694 GCCTCTGGTGGGCTTTCTGCCGG + Intergenic
921430774 1:215063283-215063305 GCCACTGGCAGGTTTTCAGCTGG + Intronic
924801347 1:247331460-247331482 GCCACAGGAGGGTTTTCGGCCGG - Exonic
1063375699 10:5553070-5553092 GCCACTGCTGTGTGGTCGGTGGG + Intergenic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1065877651 10:30011214-30011236 GCCTCTGGTTTGGTTTCTGCTGG - Intergenic
1074922376 10:118029162-118029184 TCCAATGGTATGTTTTCAGCTGG - Intronic
1075193001 10:120328706-120328728 GCCACTGGTGTTTGGTTGGCTGG + Intergenic
1075798843 10:125139923-125139945 GCCACCGGTCTGCTTTCGGATGG - Intronic
1075940290 10:126385828-126385850 GCCACTGGGGAGTTTTAGACAGG + Intronic
1077461434 11:2712721-2712743 GCCACTGGTGTGGTTGCGGATGG - Intronic
1080379558 11:31754265-31754287 GCCACTGGCGTGTTCTGAGCGGG - Intronic
1082706525 11:56499467-56499489 AGCATTGGTGTGTTTTAGGCTGG + Intergenic
1083715463 11:64572705-64572727 GCCACTGGAGGGCTTTCAGCAGG - Exonic
1085113855 11:73912667-73912689 GCCACTGGAGAGTTTTAAGCAGG - Intronic
1103310875 12:120006826-120006848 GCCAGTGATATGTTTTTGGCAGG + Intronic
1113035114 13:106039638-106039660 GCCAGTTGTGTGTGTTAGGCTGG - Intergenic
1115527866 14:34299540-34299562 GCCACTGGAGGGTTTTAAGCAGG + Intronic
1116427177 14:44805568-44805590 GTCATTGGTGTGTTTTAAGCAGG + Intergenic
1118572546 14:67208013-67208035 GCCCCGGGTGTGTTGGCGGCAGG - Intronic
1119545565 14:75469174-75469196 GGCACTGGCCTGTTTTCTGCAGG - Intronic
1121326280 14:93021650-93021672 GCCAGTGGTGTGTTTTCAGTGGG + Intronic
1122313098 14:100809704-100809726 GTCACAGGTGGGTTTTCGACGGG - Intergenic
1122446589 14:101774029-101774051 GCCACTGGGGTGTTTTGAGTAGG + Intronic
1126558836 15:50021344-50021366 GCTACTGGAGGGTTTTCAGCAGG - Intronic
1127611343 15:60640486-60640508 GCCACGGGAGGGTTTTAGGCAGG - Intronic
1128651925 15:69422670-69422692 GCCATTGTTGTGTGTTCGGGAGG + Intronic
1128682079 15:69659700-69659722 GCCACTGGAGGGTTTTAAGCAGG + Intergenic
1130898930 15:88192550-88192572 GCCATTGGAGGGTTTTAGGCAGG - Intronic
1132987047 16:2772746-2772768 GCCACTGGATGGTTTTCAGCAGG - Intronic
1134625513 16:15720026-15720048 GCCATTGGTGTGGGTTCAGCTGG - Intronic
1134655628 16:15946593-15946615 ACCACTGGTGGGTTTTAGGCAGG - Intergenic
1135612852 16:23883481-23883503 GCCACTGGAGAGTTTTAGGTAGG + Intronic
1135760194 16:25131713-25131735 GCCACTGTTAAGTTTTCGGGTGG - Intronic
1135969384 16:27061274-27061296 GCCACGGGAGAGTTTTCAGCAGG - Intergenic
1136084723 16:27876721-27876743 GCCACCAGTGTGTTTTGGACAGG - Intronic
1138379737 16:56591497-56591519 GCCACTGGTCTGTTTGGGGCTGG + Intergenic
1139114706 16:63935956-63935978 GACACTGGAGTGTTTTGAGCAGG - Intergenic
1142340358 16:89518065-89518087 CCCTCTGCTGTGGTTTCGGCGGG + Intronic
1142497343 17:313302-313324 GCCAGTGGAGTGTTTTGAGCAGG - Intronic
1142789829 17:2255449-2255471 GCCACTGAAGGGTTTTCAGCAGG + Intronic
1144090180 17:11849371-11849393 GCCACTGGTGTGTTTTCGGCAGG - Intronic
1146085944 17:29829785-29829807 GCCACTGAAGAGTTTTCAGCTGG - Intronic
1156459727 18:37314945-37314967 GCCAGAAGTGTGTTGTCGGCCGG + Intronic
1157081225 18:44527517-44527539 GCCATTGGAGTGTTTTAGGCAGG + Intergenic
1157126298 18:44959681-44959703 GCCACTGCTGTGTTCTCAGTGGG + Intronic
1158147677 18:54334391-54334413 GCCATTGGTGTGTTTTAAGCAGG - Intronic
1158389095 18:57029186-57029208 GCCATCCGTGTGTTTGCGGCAGG - Exonic
1158667575 18:59446647-59446669 GACACAGGTGGGTTTTCGGTTGG - Intronic
1159653855 18:71008519-71008541 GCCACTGGTGAGGTTTGGGGGGG + Intergenic
1163689482 19:18730805-18730827 GCCACTGGTGGCTTCTGGGCTGG - Intronic
1163698029 19:18773838-18773860 GCAACTGGTGGGTTTGTGGCCGG + Intronic
926019816 2:9485159-9485181 GACACTGGCGTGTTTCCAGCAGG - Intronic
932527351 2:72485134-72485156 TCCACTGGGGTGTTTTGAGCAGG - Intronic
932753440 2:74387818-74387840 GCCACTGGAGACTTTTAGGCAGG - Intronic
939028164 2:137039112-137039134 GCCACTGATGTATATTCAGCAGG - Intronic
942121233 2:172779627-172779649 GCCACTGGAGAGTTTTGAGCAGG + Intronic
942614414 2:177775433-177775455 GCCACTGGTGACTTTTCAGCTGG - Intronic
943752100 2:191520045-191520067 GCCACTGGAGTTTTTTAAGCAGG - Intergenic
948859208 2:240744827-240744849 GCCACGGGTGTGGATTTGGCAGG - Intronic
1168980407 20:1998752-1998774 ACCACTGGAGTGTTTTAAGCAGG - Intergenic
1171850756 20:30306417-30306439 GCCTCTGCTGTGTTTCCTGCTGG + Intergenic
1172914137 20:38431191-38431213 TCCCCTGGTGTGTTTTCTGTGGG - Intergenic
1173964108 20:47098802-47098824 GCCACTGAAGATTTTTCGGCTGG - Intronic
1174216260 20:48918919-48918941 GCCTCTGTTGGATTTTCGGCAGG + Intergenic
1174255703 20:49253270-49253292 ACCACTGGAGGGTTTTCAGCTGG + Intronic
1175366353 20:58458931-58458953 GCCCCTGGGGGGTTTTCAGCAGG + Intergenic
1175538046 20:59729130-59729152 GCCACTGGAGGGTTTGAGGCAGG + Intronic
1176875401 21:14121852-14121874 GCCTCTGGTGTGGTTGGGGCAGG - Intronic
1178287271 21:31336143-31336165 GCCACTGGGGAGCGTTCGGCCGG + Intronic
1180909207 22:19436968-19436990 GCCACCTTTGTGTTTTCAGCTGG + Intronic
1183721147 22:39562183-39562205 GCCATTTGTTTGTTTTCAGCCGG - Intergenic
1183721960 22:39567835-39567857 GCCACAGGTGGGTTTTAGGCAGG - Intergenic
1184449058 22:44572159-44572181 GCCACTGCTGTGGTTCCAGCCGG - Intergenic
949856553 3:8467169-8467191 GCCACTGGAGGGTTTTCAGTAGG - Intergenic
950896768 3:16459228-16459250 GCCACTACTGTGTTTTCTGAAGG + Intronic
953988368 3:47463398-47463420 CCCACTGGAGTGTTTTGAGCAGG - Intronic
955403662 3:58611394-58611416 GTCACTGGTGTGGCTTCAGCAGG + Intronic
965980052 3:174678677-174678699 GCCACTGGGGTGTTACCAGCTGG + Intronic
966545157 3:181138108-181138130 GCCACAGGTGTTTTCTTGGCTGG - Intergenic
968386472 4:143771-143793 GCCAGGGGTGTGTTTTCACCTGG - Intronic
970206368 4:13659407-13659429 GCCACTGCTGTGTTTACTGGGGG - Intergenic
971398611 4:26254217-26254239 GCCATTGGAGAGTTTTCAGCGGG - Intronic
973204528 4:47545352-47545374 GCTACTGGAGTGTTTTATGCAGG + Intronic
984315292 4:178122014-178122036 GCCTCTGGTGTTTTTTCTGGAGG - Intergenic
984835418 4:184015312-184015334 GCCACTGGTGAGTTTTCCTGGGG + Intronic
985586425 5:739860-739882 TCCACTGATTTGTTTTAGGCTGG - Intronic
985601014 5:832041-832063 TCCACTGATTTGTTTTAGGCTGG - Intronic
987354898 5:17054867-17054889 GCCACTGGTTGCTTTACGGCAGG + Intergenic
990553109 5:56903984-56904006 GCCACTGGAGGGTTTTAAGCAGG - Intergenic
993739303 5:91518061-91518083 GCCATTGGAGGGTTTTGGGCAGG + Intergenic
997379067 5:133422242-133422264 GCCACTGGTGGATTTTAAGCAGG + Intronic
997701055 5:135899686-135899708 GCCACTGGTGTTCCTTGGGCAGG + Intergenic
998660144 5:144227521-144227543 GCCATTGTTGGGTTTTCAGCAGG + Intronic
1002159958 5:177309221-177309243 GCCACTGGTGGGTTTTCAGCAGG + Intronic
1003823980 6:9931908-9931930 GGCACAGATGTGTTCTCGGCTGG - Intronic
1005379092 6:25215807-25215829 GGCAGTGGTGTGGTCTCGGCTGG - Intergenic
1009879824 6:69553108-69553130 GTGACTGGTGGGTTTTTGGCAGG - Intergenic
1009885573 6:69620229-69620251 GCCACAGGTGTGTCTTCTACAGG + Intergenic
1013793416 6:113859454-113859476 GCTACAGTTGTGTTTTCGGGGGG + Intronic
1014675254 6:124356563-124356585 GCCATTTGTGTGTTTTTTGCAGG + Intronic
1016737426 6:147494454-147494476 GCCACTGGAGGGTTTTGAGCAGG - Intergenic
1021843634 7:24743552-24743574 GCCAGTGGAGGGTTTTGGGCAGG - Intronic
1021877819 7:25064856-25064878 GCCACTGGAGTGTTCCCAGCAGG + Intergenic
1023020265 7:36005777-36005799 GCCACTGCTATGTTTTAAGCAGG - Intergenic
1024679093 7:51664995-51665017 GGCAATGATGTGTTTTCAGCGGG + Intergenic
1028574326 7:92329967-92329989 GCCACTGAAGGGTTTTCAGCAGG - Intronic
1029728996 7:102426959-102426981 GCCACAGGTGTGTGTTGGGTGGG + Intergenic
1035556301 8:569552-569574 GCCACGGGTGTGGATGCGGCAGG - Intergenic
1035979025 8:4348063-4348085 GCCACTGGTTTGTTTTTGCCTGG - Intronic
1038142183 8:24858115-24858137 GCCACTGGAGAGTTTTAAGCAGG - Intergenic
1039795196 8:40906932-40906954 GCCACTGCTGTGCTTAGGGCTGG + Intergenic
1042857906 8:73285934-73285956 GCAACTGGTGTGCGTACGGCAGG - Intergenic
1049395481 8:142398254-142398276 GCTAGGGGTGTGTTTTGGGCAGG - Intronic
1049395503 8:142398323-142398345 GCTAGGGGTGTGTTTTGGGCAGG - Intronic
1049740815 8:144240052-144240074 CCCACTGGTGCGTTTTGGGATGG + Intronic
1050889430 9:10805287-10805309 GCAACTGGTGAGTTTCTGGCAGG + Intergenic
1054738260 9:68778724-68778746 GCCACTGGAGGGTTTTAAGCAGG - Intronic
1055291434 9:74786022-74786044 GCCATTGGCCTGTTTTCAGCTGG - Exonic
1060244751 9:121935536-121935558 GCCACTGAAGTGTTTTTAGCAGG + Intronic
1060800004 9:126537984-126538006 GCCAGTAGTGGGTTTTCAGCAGG + Intergenic
1062368524 9:136224112-136224134 GACCCTGGTGTGCTTCCGGCAGG - Exonic
1062547772 9:137071293-137071315 GCCTCTGCTGTGTTTCCAGCTGG + Intergenic
1185488811 X:503745-503767 GCCACTGCTGTGCTTGCTGCTGG + Intergenic
1192807666 X:74524474-74524496 GCCAATGGTGTGGTGTCTGCTGG + Exonic
1195349272 X:103981470-103981492 GCTTCTGGTGTGTTTTCAGATGG - Intergenic
1195352441 X:104008004-104008026 GCCTGTGGTGTGTTTTCAGACGG + Intergenic
1195358171 X:104057369-104057391 GCTTCTGGTGTGTTTTCAGATGG + Intergenic
1195394225 X:104393763-104393785 GCCATTGGTGGGTTTTAAGCAGG + Intergenic
1198727070 X:139689453-139689475 GCCACTGGAGTGTTGTAAGCAGG - Intronic
1200842486 Y:7796798-7796820 GCCACTGCTGTGTTTTCTGAAGG + Intergenic