ID: 1144092667

View in Genome Browser
Species Human (GRCh38)
Location 17:11871962-11871984
Sequence CAGGTGGCCTGGAGGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 1, 2: 5, 3: 65, 4: 490}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144092667_1144092680 14 Left 1144092667 17:11871962-11871984 CCCACTGCCCTCCAGGCCACCTG 0: 1
1: 1
2: 5
3: 65
4: 490
Right 1144092680 17:11871999-11872021 CCTCTGAATGTAGTCCTCCATGG 0: 1
1: 0
2: 1
3: 9
4: 121
1144092667_1144092681 15 Left 1144092667 17:11871962-11871984 CCCACTGCCCTCCAGGCCACCTG 0: 1
1: 1
2: 5
3: 65
4: 490
Right 1144092681 17:11872000-11872022 CTCTGAATGTAGTCCTCCATGGG 0: 1
1: 0
2: 1
3: 9
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144092667 Original CRISPR CAGGTGGCCTGGAGGGCAGT GGG (reversed) Intronic
900157568 1:1209327-1209349 CAGGAGGCCTGGACAGCCGTGGG + Intergenic
900158463 1:1212676-1212698 GAAGTGCCCTGGAGGGCAGGGGG + Exonic
900177983 1:1299115-1299137 CATGTGGCCTGGGGAGCAGGTGG - Intronic
900490973 1:2949006-2949028 CAGGTGCCGGGGAGGGCAGACGG + Intergenic
900972127 1:5997470-5997492 CAGGTGGGCAGGTGTGCAGTGGG - Intronic
901039863 1:6357402-6357424 CACGGGGCCTGCAGGGCAGGCGG + Intronic
901216938 1:7560271-7560293 CAGGGGACCTGAAGGGCAGTGGG - Intronic
901849644 1:12007329-12007351 CACGTGGCCTGGAAGCCACTGGG + Intronic
901882372 1:12201875-12201897 CAGGAGGTGTGGATGGCAGTGGG + Intronic
902336272 1:15756707-15756729 CAGGTGGCCTGGGGTGCTGGAGG + Intronic
902388391 1:16088834-16088856 CAGGTGGGCAGGTGGGCAGCGGG + Intergenic
903070419 1:20724396-20724418 CAGAGGGGCTGGTGGGCAGTGGG - Exonic
903450902 1:23453009-23453031 CAGGAAGCCTGGCGGGCAGCAGG - Intronic
903547660 1:24136853-24136875 TAGGTGGCCTTGACTGCAGTCGG + Intronic
904285423 1:29450482-29450504 CAGGTGGCTTGCAGGGCTGTGGG - Intergenic
904297021 1:29526478-29526500 GTGGTGGCCTGGAGGGGAGAAGG - Intergenic
904492624 1:30870277-30870299 CAGGAGGCCAGGAGGCCAGATGG - Intronic
904565386 1:31425424-31425446 CAGGAGGCATGGGGGGCTGTGGG + Intronic
905273593 1:36802721-36802743 CAGCTTGCATGGAAGGCAGTGGG + Intronic
905537054 1:38730280-38730302 AAGGTGGATTGGAGGGCAGTGGG + Intergenic
906260121 1:44380621-44380643 CAGAGAGCCTGGAGGGCAGTGGG - Intergenic
906612346 1:47212234-47212256 CAGGTGGCCTGGGCAGGAGTAGG + Intergenic
906712767 1:47943892-47943914 CATGGGGCCTGGCAGGCAGTAGG - Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907962298 1:59295135-59295157 GTGGAGGTCTGGAGGGCAGTGGG + Intergenic
910361574 1:86417745-86417767 CAGGTGGAGTGGGGGCCAGTTGG - Intergenic
912455158 1:109792155-109792177 CAGGTGGGCTGGGGGGCTGGGGG + Intergenic
912456645 1:109802663-109802685 CAGCTGCCCTGGAGCCCAGTGGG + Intergenic
913346174 1:117813328-117813350 TGGTTGGCCTGGAAGGCAGTAGG + Intergenic
913585563 1:120272248-120272270 GAGGTGGGGAGGAGGGCAGTGGG - Intergenic
913622621 1:120626119-120626141 GAGGTGGGGAGGAGGGCAGTGGG + Intergenic
914567569 1:148884107-148884129 GAGGTGGGGAGGAGGGCAGTGGG - Intronic
914605253 1:149246138-149246160 GAGGTGGGGAGGAGGGCAGTGGG + Intergenic
915125198 1:153658884-153658906 CAGGTGCCCGGGAGGGAAGTTGG + Exonic
915874753 1:159600729-159600751 CAGGTGGCCTTGATGGCAGTGGG - Intergenic
916229920 1:162531492-162531514 CATCTGGGCTGGAGCGCAGTTGG - Intergenic
916389584 1:164316919-164316941 CAGGAGGCCTGGAAGGAAGAAGG + Intergenic
916466751 1:165080767-165080789 CATCTGGCATGGATGGCAGTAGG - Intergenic
916611086 1:166392402-166392424 CCAGTGGGCTGGATGGCAGTAGG + Intergenic
916731137 1:167567819-167567841 TAGCTGCCCTGGAGGGCTGTGGG + Intergenic
916867775 1:168878760-168878782 CACCTAGACTGGAGGGCAGTGGG - Intergenic
917500033 1:175577569-175577591 CAAGTGGCTTGGAGGGCTGGGGG + Intronic
917932549 1:179833141-179833163 CACCTGGGCTGGAGTGCAGTGGG - Intergenic
918439833 1:184555878-184555900 CAGATGGCCTGGAGGGCCAGTGG - Intronic
918713585 1:187762276-187762298 CACGTGGCCTGGAGGTTAGGAGG - Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919765723 1:201126174-201126196 CATGTGGGCTGGAGAGCAGTGGG + Intronic
919768680 1:201143454-201143476 CTGGTGGACTGGACGGCAGCAGG - Intronic
919849181 1:201660875-201660897 CAGGTGGCCAGGGTGGCAGGGGG + Intronic
920179825 1:204125780-204125802 GAGGAGGCCTGGAGGGGAGATGG + Intronic
921063958 1:211609652-211609674 CAGGGGGCATGGAGGGCCGCAGG - Intergenic
921221422 1:212976763-212976785 CAGATGGGCAGGAGGGCAGAGGG - Intronic
922797706 1:228349157-228349179 GAGGAGGCATGGAGGGCTGTGGG + Intronic
922807422 1:228397595-228397617 CAGGGAGCCTGCAGGGCAGGTGG - Intronic
923525490 1:234769435-234769457 CAGCTGGCCTGGGGGGCATGTGG - Intergenic
923546514 1:234927479-234927501 CAGGCTGGGTGGAGGGCAGTGGG - Intergenic
1062908930 10:1199622-1199644 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1063143607 10:3276579-3276601 GGTGTGGCCGGGAGGGCAGTTGG - Intergenic
1063201222 10:3786074-3786096 CTGGTGGCCCGGAGGACAGAGGG - Intergenic
1064340957 10:14484856-14484878 AAGGCAGCTTGGAGGGCAGTCGG - Intergenic
1064552587 10:16519698-16519720 CAGGTGGCCTGGGGGGCGACCGG - Intronic
1065380348 10:25083875-25083897 CAGGTGGCCTGGGAGACAGCAGG - Intergenic
1065482984 10:26213352-26213374 AAGAAGGCCTGGAGGGCACTTGG - Intergenic
1065643180 10:27805644-27805666 CAGGCGCCCAGGAGGGCAGAAGG + Intergenic
1066287364 10:33981494-33981516 CAAGTGGCCAGGAAGGCAGCAGG - Intergenic
1066367763 10:34793277-34793299 CAAGGGAGCTGGAGGGCAGTAGG + Intronic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067118880 10:43456980-43457002 CAGGTGGCCTTGAGAGATGTGGG + Intronic
1067761969 10:49055191-49055213 CAGGGGGCCTGGAAGGATGTTGG - Intronic
1067802447 10:49368408-49368430 CAGCGGGCCTGCAGGGCAGTGGG - Intronic
1068513683 10:57998912-57998934 CAGTTAGGATGGAGGGCAGTGGG - Intergenic
1069614885 10:69800922-69800944 CTGGTGGCCTGAAGGGCATTTGG - Intergenic
1070140171 10:73732895-73732917 CTGGGGGCGTGGGGGGCAGTGGG - Intergenic
1070722727 10:78768024-78768046 CAGGTGGCCCTGTGGGCAGGAGG + Intergenic
1070772355 10:79089789-79089811 CAGGTGGCCTGAGGGGTAGGGGG - Intronic
1072615936 10:97048924-97048946 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1072735222 10:97874547-97874569 CAGGTGTCCTGGGTGGCAGCAGG + Intronic
1072822009 10:98567538-98567560 AAGCTGGCCTGGAGGGAAGCAGG + Intronic
1073352511 10:102830119-102830141 CAGGAGGCCAGGAGGGAGGTTGG - Intergenic
1075644345 10:124087711-124087733 GAGGGGGCCTGGAGGGCGGGGGG - Intronic
1075779703 10:125009298-125009320 CAGGTGGCCTGGGAGGCAGGAGG + Intronic
1075911113 10:126126581-126126603 AAGGTGGGCTGGAGTGCAATGGG + Intronic
1076164226 10:128268851-128268873 CAGGTGCGCTGGAAAGCAGTGGG + Intergenic
1076399922 10:130175837-130175859 CAGTGGGCCTGGGGTGCAGTGGG - Intronic
1076608761 10:131707203-131707225 CTGGTGGCTTGACGGGCAGTTGG - Intergenic
1076694364 10:132240049-132240071 CTGGTGGCCTGGAGAGCACGAGG + Intronic
1077031443 11:469742-469764 CCCGTGGACTGGAGGGCACTAGG - Intronic
1077185783 11:1234766-1234788 CAGGGGGCGGGGAGGGCAGGGGG + Intronic
1077350350 11:2090370-2090392 CAGGTGGCCAGCAGGACAGGGGG - Intergenic
1077486089 11:2839017-2839039 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1078084297 11:8224562-8224584 CAGGTGGGCAGGCGGGCAGATGG + Exonic
1078219066 11:9336220-9336242 CTGGTGCCCTGGAAGGCAGGTGG - Intergenic
1078443603 11:11387413-11387435 CAGTTGCCCAGGAGGGGAGTGGG + Intronic
1078556318 11:12329467-12329489 GAGGTGGCATGGTGGGAAGTGGG + Intronic
1080711069 11:34748551-34748573 CTAGTGGCCTGGAGGGCAGGAGG + Intergenic
1081703523 11:45166536-45166558 CAGGGGGCCTGGATGCCAGCAGG + Intronic
1081809109 11:45905384-45905406 CGGGTGGCCTGGAGGGAGGGTGG + Intronic
1081845569 11:46238267-46238289 GAGGGGGCCGGGAGGGCAGGAGG - Intergenic
1082015496 11:47483222-47483244 CACCTGGGCTGGAGTGCAGTGGG - Intronic
1082786777 11:57321745-57321767 CAGGTGGCTGGGAGGGGGGTGGG - Intronic
1083163887 11:60871840-60871862 CAGGTGCCCAGGATGCCAGTGGG + Intronic
1083629217 11:64087229-64087251 CAGGGGCCCAGGAGAGCAGTGGG - Intronic
1083675636 11:64323278-64323300 GAGGATGCCTGGAGGTCAGTGGG + Intergenic
1083893711 11:65609881-65609903 CAGGTGGCCTGGCCAGCAGCAGG - Intronic
1084170062 11:67396737-67396759 CAGGTGGCTGGAAGGGCAGGTGG + Intronic
1084424475 11:69077010-69077032 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424552 11:69077259-69077281 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424584 11:69077367-69077389 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084487985 11:69462250-69462272 CAGCTGGCTGGGAGGGCAGAGGG + Intergenic
1084545837 11:69814692-69814714 CAGGTTGTCTGCAGGGCAATGGG + Intronic
1085084111 11:73655481-73655503 CAGGTGGGCTAGAGGACAGAAGG + Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085390916 11:76181753-76181775 CGGGTGGCCTGGCGGGCAGGCGG + Intergenic
1088994641 11:114985853-114985875 CAGGTGCCCAGGAGGGCAGGAGG + Intergenic
1089305826 11:117525499-117525521 CACCCAGCCTGGAGGGCAGTGGG + Intronic
1089634039 11:119801004-119801026 CAGGGGGCCGGGAGGGCTGGTGG - Intergenic
1089834441 11:121357637-121357659 CAGGTGGTCGGGAGGGCAGGTGG + Intergenic
1090331921 11:125939262-125939284 CAGGTTGGGTGGAGGGCACTGGG + Intergenic
1090746407 11:129709194-129709216 CACGTAGGCTGGAGGACAGTGGG + Intergenic
1091345052 11:134846856-134846878 CAGGTGGCTTGGATGGGGGTGGG + Intergenic
1091714923 12:2770231-2770253 CTGCAGGCATGGAGGGCAGTGGG - Intergenic
1091744360 12:2981774-2981796 CAGGGGTGCTGGAGGGTAGTGGG + Intronic
1092088585 12:5785833-5785855 CTGCTGGCCTGGAGGGTAGATGG - Intronic
1092095842 12:5841311-5841333 CAGGTGGGGTGGAGGGGAATGGG - Intronic
1092625241 12:10319904-10319926 CACCTGGGCTGGAGTGCAGTGGG + Intergenic
1092928562 12:13294223-13294245 CAGTTGGCCTGTAGGAGAGTTGG - Intergenic
1095107285 12:38249842-38249864 CAGGTGGCAGTGAGGGCAGCAGG + Intergenic
1095809595 12:46357732-46357754 CAAGTGGCCTGGAAAGAAGTTGG - Intergenic
1097194574 12:57236413-57236435 CAGGTGGGCTGGAGGGGATACGG + Intronic
1097360866 12:58656473-58656495 GAGGTGGCCAAGATGGCAGTGGG + Intronic
1097907686 12:64937290-64937312 CAGGTGGCCTGGAGAACATAAGG - Intergenic
1098340443 12:69445327-69445349 CAGGTAGCCTGCAGTGCAGCAGG - Intergenic
1099862577 12:88238746-88238768 AAGGTGACCTGGTGGGAAGTGGG + Intergenic
1101871694 12:108571175-108571197 CAGTTGGCCTGAGGGTCAGTTGG - Intergenic
1102701595 12:114844053-114844075 CAAGTAGGCTGGAGTGCAGTGGG + Intergenic
1102950427 12:117027379-117027401 CCGGGTGCCTGGAAGGCAGTGGG - Exonic
1103165131 12:118763880-118763902 CAGGTAGTCTGGAGGTCATTTGG + Intergenic
1104918808 12:132279911-132279933 CAGGAGACCTGGAGGACACTGGG - Intronic
1105344587 13:19561106-19561128 CTTGTGGCCTGGGAGGCAGTGGG + Intergenic
1105535451 13:21260467-21260489 CTTGTGGCCTGGGAGGCAGTGGG - Intergenic
1106788378 13:33129813-33129835 CAGGTGGCCTGGTGATCAGTGGG - Exonic
1106792329 13:33168374-33168396 CAGGTGGTCCGGTGGGCTGTTGG - Intronic
1107871718 13:44752714-44752736 CAGATGGCCTGGGGGATAGTAGG + Intergenic
1108461265 13:50669831-50669853 CAGGTGGGCTGGAGTGGTGTGGG - Intronic
1109452849 13:62540821-62540843 CTGGTGGCCAGGAGGGCAGGTGG - Intergenic
1112498605 13:99925153-99925175 CAGGGCACCTGGAGGGCTGTGGG - Intergenic
1113429494 13:110237139-110237161 CAGGTGGCCTGGGGCGCAGTGGG + Intronic
1114621966 14:24101473-24101495 CAGGTGTCCTGGAGGGGGGTTGG - Intronic
1115659266 14:35475628-35475650 CACCTGGGCTGGAGTGCAGTGGG + Intergenic
1119524456 14:75311046-75311068 CAGGCAGCCCGGGGGGCAGTGGG + Intergenic
1119662221 14:76460206-76460228 GAGGTCGCCTGGTGGGTAGTAGG - Intronic
1121120475 14:91372804-91372826 CAGGTGGCCAGAAAGGCAGGTGG + Intronic
1121283292 14:92714835-92714857 CAGGAGGCCTGGAGGGGGGGAGG - Intronic
1121378778 14:93441730-93441752 CAGGAGGCATGGAGGGCATATGG - Intronic
1121469174 14:94138743-94138765 CAGGAGGCCTGGAGGGTCTTCGG - Intergenic
1121525153 14:94614356-94614378 CAGGCTGGGTGGAGGGCAGTGGG + Exonic
1121560835 14:94874051-94874073 CAGGTGGCCTGGACCACAGAGGG - Intergenic
1122266488 14:100549232-100549254 CAGCTGGCTTGGAGGGGATTTGG - Intronic
1122328089 14:100894696-100894718 CAGGTGGCGTGAAGGGGAGATGG + Intergenic
1122824839 14:104364564-104364586 ATGGTGCCCTGGAGGGCACTTGG + Intergenic
1122965407 14:105121838-105121860 CAGGGAGTCTGGAGGGCGGTTGG + Intergenic
1123043248 14:105499181-105499203 CTGGTGGTCTGGAGGGGACTCGG + Intronic
1123840562 15:24243328-24243350 CGGGTGGCTTGGATGCCAGTGGG - Intergenic
1124404581 15:29382320-29382342 CAGGTGGCCAGGTGGCCCGTGGG - Intronic
1126065706 15:44824793-44824815 CAGGAGGCCTGTTGGGGAGTTGG + Intergenic
1126094129 15:45075774-45075796 CAGGAGGCCTGTTGGGGAGTTGG - Exonic
1126803563 15:52322391-52322413 TGGGAGGCATGGAGGGCAGTTGG + Intronic
1126980922 15:54241744-54241766 CAGGTGGCCATCAGCGCAGTAGG + Intronic
1128380312 15:67107465-67107487 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1128658355 15:69479061-69479083 CAGGTTTGCTGGAGGTCAGTGGG + Intergenic
1128701949 15:69811135-69811157 GAAGGGGCCTGGAGGGAAGTGGG - Intergenic
1129168374 15:73792617-73792639 AAGGTGGCCAGGGAGGCAGTTGG + Intergenic
1129332794 15:74836427-74836449 TGGGTGGCCTAGAGGGCACTGGG + Exonic
1129704504 15:77786626-77786648 CAGGCGGCATGGAGGGCGGCGGG - Intronic
1130936975 15:88478946-88478968 CACCTGGGCTGGAGTGCAGTAGG - Exonic
1130956271 15:88629463-88629485 CAGGTGGCATGGAGGCCAGGCGG - Intronic
1131063994 15:89421645-89421667 CCGGTGGCCTTGTGGGGAGTGGG + Intergenic
1131250666 15:90828122-90828144 CCGGGACCCTGGAGGGCAGTTGG - Intergenic
1132049705 15:98596836-98596858 CAGGACGACTGGAGGGCAGCAGG - Intergenic
1132202419 15:99964119-99964141 CTGGTGGCCAGGAGGGGAGGTGG - Intergenic
1132367012 15:101265042-101265064 AAGGCCGGCTGGAGGGCAGTGGG - Intergenic
1132403131 15:101526165-101526187 CTGGTGGCCTGGAGGCCTGGGGG - Intergenic
1132618247 16:852751-852773 CAGGGGGCATGGAGGGCTGTTGG + Intergenic
1133024226 16:2980685-2980707 TGCGAGGCCTGGAGGGCAGTGGG - Intergenic
1133197505 16:4181872-4181894 CAGCTGGCTTGCAGGGCAGAGGG + Intergenic
1133961402 16:10496616-10496638 CACCTGGGCTGGAGTGCAGTGGG - Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134044130 16:11088989-11089011 CAGGTGGCCTGGGGGGAAAGGGG - Intronic
1134375536 16:13669339-13669361 AAGGTGGTCAGGAGGGCAGATGG + Intergenic
1134604291 16:15558085-15558107 CAGGTGGCCCGAGGGTCAGTGGG + Intronic
1135209363 16:20510978-20511000 CACCTGGGCTGGAGTGCAGTGGG - Intergenic
1136235297 16:28910198-28910220 CAGGAGGGTAGGAGGGCAGTAGG - Intronic
1136248452 16:28988667-28988689 CTAGAGGGCTGGAGGGCAGTGGG - Intronic
1136632300 16:31496122-31496144 CACCTGGGCTGGAGTGCAGTGGG + Intronic
1136776603 16:32875175-32875197 GAGGTGGCTTGGAGGGCATTTGG + Intergenic
1136894012 16:33986338-33986360 GAGGTGGCTTGGAGGGCATTTGG - Intergenic
1137604036 16:49775429-49775451 GAGGTGGCCTGTGGGTCAGTGGG - Intronic
1137930639 16:52584072-52584094 CAGGTGGCTTGGAAAGCAGGAGG + Intergenic
1138088103 16:54152425-54152447 CAGGTGGCTTGGAGGAAAGTGGG - Intergenic
1138419948 16:56892623-56892645 CAGGGGGCCTGAAGTGCAGGCGG + Intronic
1138565984 16:57833229-57833251 CAGGATGCCAGGAGGGCAGAGGG + Intronic
1138576799 16:57912504-57912526 GACGGGGCCTGGAGGTCAGTGGG + Intronic
1139515839 16:67451909-67451931 CAGGTGGGCCAGTGGGCAGTGGG + Intronic
1140020064 16:71230326-71230348 CAGGTAGCCTGAAGGGCAGAAGG - Intronic
1141297180 16:82781018-82781040 GAGGTTGCCTGAAAGGCAGTGGG + Intronic
1141560870 16:84867064-84867086 GAGGTGGCTGGGAGGGCAGGAGG - Intronic
1142032044 16:87843478-87843500 AGGGTGGCCTGGAGGGCTGCAGG + Intronic
1142127729 16:88418540-88418562 GAGGTGGCCGGGGGGGCGGTGGG - Intergenic
1142267804 16:89072562-89072584 CAGGTGGCCAGGAGGTTGGTGGG - Intergenic
1142373968 16:89697430-89697452 CGAGTGGCCTGGACGGCAGGCGG + Exonic
1203079018 16_KI270728v1_random:1137284-1137306 GAGGTGGCTTGGAGGGCATTTGG + Intergenic
1142589724 17:997411-997433 CTGAGGGCCTGGACGGCAGTGGG + Intronic
1142780119 17:2175110-2175132 CAAGTGGCCAGCAGGGCACTGGG - Intronic
1142809495 17:2388648-2388670 CAGGGAGTCTGGAGGGGAGTGGG - Intronic
1143119165 17:4596602-4596624 CAGGGGACCTGGAGGGCTGTAGG + Intronic
1143627836 17:8121461-8121483 CAGGTGTTGGGGAGGGCAGTGGG - Exonic
1144092667 17:11871962-11871984 CAGGTGGCCTGGAGGGCAGTGGG - Intronic
1144378263 17:14667186-14667208 CAGGTGGACTGGAGGGAACGAGG + Intergenic
1144645667 17:16971979-16972001 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1144727535 17:17509391-17509413 GAGGTGGCCAGCAGGGCAGAGGG + Intronic
1144948705 17:18982686-18982708 CATGTGGCCTGGAGGCCTGGGGG - Intronic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145216631 17:21057415-21057437 CAGGTGGCCTTCAGGGAAATGGG + Intergenic
1146289926 17:31599547-31599569 CAGGAGCACAGGAGGGCAGTGGG + Intergenic
1146906538 17:36621747-36621769 CAGGTGGCATGGAGGGCAAGGGG + Intergenic
1147250677 17:39151223-39151245 CAGGAGGCCAGGAGAGCTGTGGG - Intronic
1147645213 17:42029144-42029166 GAGGTGGCCTGGAGGGCCCCTGG + Intronic
1147727207 17:42573458-42573480 CAGGTGAGCTGGAAGGCTGTAGG - Exonic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1148461495 17:47841293-47841315 CAGGTGACCTGGAAGGCCTTCGG + Exonic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1148908194 17:50924984-50925006 CAGGTGGCCAGGTGGCCAGCTGG - Intergenic
1149451176 17:56751256-56751278 GAGCTGGCCTGGAGGGCAGGAGG - Intergenic
1150387525 17:64773634-64773656 CATGTGGCCTGCAGGGGAGTTGG + Intergenic
1151375546 17:73686367-73686389 CTGGGGGCCTGTGGGGCAGTGGG - Intergenic
1152526069 17:80888966-80888988 CAAGAGGCCAGGAGGGCAGTGGG + Intronic
1152584329 17:81182261-81182283 GAGGTGGCCAGGAGGGCTTTGGG + Intergenic
1152590484 17:81209148-81209170 CAAGTGGCCTCAAAGGCAGTGGG + Intronic
1152692016 17:81722589-81722611 CAGGTGGCCTGCAGGGCCTGTGG - Intergenic
1152856032 17:82664837-82664859 CATGTGACCTGGAGGCCGGTGGG + Intronic
1153980280 18:10302884-10302906 CAGGTGGACTGGAGGGGGCTGGG - Intergenic
1154207486 18:12350050-12350072 CATCTGGGCTGGAGTGCAGTGGG + Intronic
1155336492 18:24770387-24770409 AAGGGGGCCAGGAGGGCAGGTGG - Intergenic
1156294505 18:35777420-35777442 GAGGTGGCCAGAAGGGCGGTGGG - Intergenic
1156665327 18:39398609-39398631 CACGCAGGCTGGAGGGCAGTGGG + Intergenic
1157203127 18:45676299-45676321 CAGGTGGCCCGGTGGGGAGGTGG + Intronic
1157700041 18:49756552-49756574 CTTGTGGCCTAGAGGGCACTGGG - Intergenic
1158321129 18:56265834-56265856 CAGGTGGGCTGGAAGAAAGTAGG + Intergenic
1158629094 18:59096460-59096482 CAGGTGCCCAGAAGTGCAGTGGG + Intergenic
1159424094 18:68261380-68261402 AAGGAGGCCTGGAGAGCAGCCGG - Intergenic
1160717136 19:581597-581619 CATGTGGGCAGGAGGGCAGACGG - Intronic
1160719873 19:592356-592378 TCGGTGGCCTGGGGGGCAGGTGG + Intronic
1160752550 19:741354-741376 CAGCTGGGCTGGAGGGCTGAGGG + Intronic
1160967841 19:1754342-1754364 CAGGTGGCCTGGCGGGCCGTAGG - Exonic
1160969730 19:1762256-1762278 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1161196187 19:2987890-2987912 CAGGTGGCCTGGGGGCTAGTGGG - Exonic
1161226388 19:3148489-3148511 CAGGAGGCCTGGCGTGGAGTTGG + Intronic
1161321403 19:3643349-3643371 AAGGTGGCGTGCAGGGCAGGAGG + Exonic
1161519761 19:4717290-4717312 CAGGTCCCCTCCAGGGCAGTGGG + Intronic
1161605628 19:5213285-5213307 CAGGAGCCATGGAGGGCTGTGGG - Intronic
1162081859 19:8222855-8222877 CAGGTGGCCATGAGGGTGGTGGG + Intronic
1162312717 19:9916599-9916621 CAGGAGGCCTGGAGCCCAGTTGG - Intronic
1162464099 19:10830389-10830411 CAGTTGGGGTGGAGGGCAGGGGG - Intronic
1162523807 19:11196529-11196551 GTGGTGGCTTGGTGGGCAGTGGG - Intronic
1162800012 19:13105074-13105096 CAGGTGCCCTGGTGGGAAGATGG + Exonic
1163289844 19:16372158-16372180 TATGTGGCCTTGAGGGCAGATGG + Intronic
1163360087 19:16840435-16840457 CTGGAGGCCTGGAGGCCAGGAGG - Intronic
1163584425 19:18156161-18156183 CACGGGGCCTGGCGGGCAGTGGG - Exonic
1165391610 19:35542332-35542354 CAGATCCCCTGGAGGGCTGTCGG + Exonic
1165798664 19:38534456-38534478 CAGATGGCCTGGAGGCCCATGGG + Intronic
1166118131 19:40667923-40667945 CAGGAGGCATGGTGGGCACTGGG + Exonic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
1166342460 19:42146937-42146959 GTGGTGGCCTGGACTGCAGTGGG - Intronic
1166858318 19:45794460-45794482 CACGTGGGCTGGAGTGCAATGGG + Intergenic
1166931336 19:46303465-46303487 CAGGGGGCCTGGGAGGCTGTAGG + Intronic
1168414187 19:56158567-56158589 CAGGTGGAAAGGAGGACAGTGGG + Exonic
925167590 2:1727682-1727704 CAGGGGGTCTGGTGGGCAGGGGG - Intronic
925203862 2:1990501-1990523 CGGGTGCCATGGAGGGCAGTGGG + Intronic
925459426 2:4047487-4047509 CAGGAGGCCAGGCGGTCAGTGGG - Intergenic
929397664 2:41541955-41541977 CAGGTGGGGTGCATGGCAGTCGG - Intergenic
929861370 2:45680900-45680922 CTGGTGGCCTGGAACACAGTAGG - Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930186964 2:48420312-48420334 AAGGTGGCCTGGAGCCCAGCAGG + Intergenic
932030408 2:68177865-68177887 CATCTGGGCTGGAGTGCAGTGGG - Intronic
932475390 2:72002820-72002842 TAGGTGGCCAGGAGGGAAGCAGG - Intergenic
933047384 2:77556549-77556571 AAGGAGGGCTGTAGGGCAGTGGG - Intronic
934936425 2:98469167-98469189 CAGCTGGGGTGGAGAGCAGTGGG + Intronic
935469508 2:103440138-103440160 CACCTAGCCTGGAGTGCAGTGGG - Intergenic
935638908 2:105272256-105272278 CAGGTGTCTTGGAGGGCATTTGG - Intronic
936053958 2:109246719-109246741 CAGATGGACTGGGAGGCAGTGGG + Intronic
936061697 2:109299026-109299048 CAGGTGACCCAGAGGGCACTGGG - Intronic
938240266 2:129737934-129737956 CAGGAGGGCAGGAGGGCAGGAGG - Intergenic
941185617 2:162318497-162318519 CAGGTGGGCAGGCGGGCAGGTGG + Exonic
941463590 2:165799738-165799760 CAGTTGGGCTGGAGGGGATTTGG - Intergenic
942638831 2:178038753-178038775 CAGGTGGCCATGAGGGGAATGGG + Intronic
943430075 2:187788647-187788669 AAGGTGGGGTGGAGGGGAGTGGG + Intergenic
944147223 2:196518781-196518803 CAGGTGGGCAAGAGGGCAGCAGG - Intronic
944305363 2:198172870-198172892 CAGGTGTACTGGAAAGCAGTCGG + Intronic
945884013 2:215355504-215355526 AAGGTGGCCTGGAGAGAAGCAGG - Intergenic
946048768 2:216843289-216843311 CAGGGGGCCTGGAAGGAAGGGGG + Intergenic
946382428 2:219358323-219358345 CAGGGTGCCTGGTGGGCAGAGGG - Intergenic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
947911680 2:233804754-233804776 CAGGTGGCCAGGAGGGCAGCAGG + Intronic
948461721 2:238132895-238132917 CAGGGGGCCTGGATGCCAGGAGG - Exonic
948674919 2:239591617-239591639 CAGGAGGTGTGGACGGCAGTGGG + Intergenic
948915718 2:241034297-241034319 CAGGTGGCCAGGAGGTGAGTGGG - Intronic
948942528 2:241203509-241203531 CAGGTGGTCTGGGGGGCAGCGGG - Intronic
949075760 2:242056763-242056785 CAGGGGGACTGGAGGGCCGTGGG + Intergenic
1168792907 20:591977-591999 CAGGAGGCAGGGAGGCCAGTTGG - Intergenic
1171024537 20:21616950-21616972 CATGCTGCCTGGAGGGAAGTCGG - Intergenic
1171177322 20:23062309-23062331 CTGGTGGACTGAAGGGCAGCTGG + Intergenic
1171388340 20:24785447-24785469 GGGGTGGCCTGGGGGGTAGTAGG - Intergenic
1173229783 20:41185244-41185266 CAGGCTGCCTGGGGGGCAGGTGG - Intronic
1173253330 20:41375912-41375934 CAGGAGCCCTGGACAGCAGTGGG - Intergenic
1174193157 20:48754595-48754617 GAGGTGTCCTTGGGGGCAGTCGG - Intronic
1174893990 20:54429359-54429381 CATGAGACTTGGAGGGCAGTAGG - Intergenic
1175658944 20:60795655-60795677 GAGGTGGCAATGAGGGCAGTTGG - Intergenic
1175826948 20:61941695-61941717 CAGGAGGCACGGAGGGCAGAGGG - Intergenic
1176026087 20:62986349-62986371 CAGGTGGACTGGGGTGCAGGTGG + Intergenic
1176026092 20:62986365-62986387 CAGGTGGACTGGGGTACAGTGGG + Intergenic
1176026189 20:62986687-62986709 CAGGTGGGCAGGGGTGCAGTTGG + Intergenic
1176910351 21:14557915-14557937 CAGGTGGCCTGAAGGAAAGCAGG - Intronic
1178311857 21:31536351-31536373 CAGGTGCCATGGTGTGCAGTGGG - Intronic
1179106538 21:38405508-38405530 CAATTAGGCTGGAGGGCAGTTGG + Intronic
1179231260 21:39505845-39505867 GAGCTAGCCTGGGGGGCAGTAGG - Intronic
1179655522 21:42842086-42842108 CAGGTGACCGGGCGGGCTGTGGG + Intergenic
1179778915 21:43687143-43687165 GAGGTGCCCTGGAGAGCAGGCGG - Intronic
1179913637 21:44462863-44462885 CAGGTGGTCAGGAGGACAGCAGG - Intergenic
1179985618 21:44919107-44919129 CAGGTGACCGGGCGGGCTGTGGG - Intronic
1180174993 21:46083034-46083056 GAGGTGACCTGGGGGGCAGCCGG + Intergenic
1180796441 22:18608114-18608136 CAGGTGTCCTGGTGGTCAGCTGG - Exonic
1181097125 22:20513110-20513132 CACTTGGGCTGGAGTGCAGTTGG + Intronic
1181115961 22:20632679-20632701 ATGGTGGCCTGGAAGGCAGAGGG + Intergenic
1181225283 22:21387157-21387179 CAGGTGTCCTGGTGGTCAGCTGG + Exonic
1181253350 22:21547656-21547678 CAGGTGTCCTGGTGGTCAGCTGG - Exonic
1181323319 22:22025476-22025498 CCAGTGGCCAGGAGGGCAGGAGG - Intergenic
1181437617 22:22919648-22919670 AAAGTGGCCTGGAAGGCAGATGG + Intergenic
1182064648 22:27421605-27421627 ATGGTGGCCTGGACTGCAGTGGG - Intergenic
1182275936 22:29188653-29188675 CAGCTGCCCAGGAGGCCAGTGGG + Intergenic
1182356211 22:29723277-29723299 GGGGAGGCATGGAGGGCAGTTGG + Intronic
1182396044 22:30036578-30036600 GAGGTGCCTTGGAGGGCAGCAGG - Intergenic
1182718401 22:32378044-32378066 CAGGTGGCGGGGAGGGTTGTGGG + Intronic
1183744676 22:39685746-39685768 CCGGTGGCCTGGGGGGAGGTGGG - Exonic
1184072691 22:42155597-42155619 CAGGTGGCCTGAGGGGCAGCAGG + Intergenic
1184308337 22:43624424-43624446 GAGGAGGCCAGGAGGGCAGGAGG - Intronic
1184900778 22:47445229-47445251 CAGGTGGACAGGAGGACAGGTGG - Intergenic
1184900840 22:47445531-47445553 CAGGTGGACAGGAGGACAGGTGG - Intergenic
1184901587 22:47449730-47449752 CAGGTGGCTTCGAGTGCAGGTGG - Intergenic
1185001838 22:48250975-48250997 CAGGTGTCCTGGAAGCCAGGAGG - Intergenic
1185065955 22:48631822-48631844 CAGGGGGCCTAGGGGGCAGCTGG + Intronic
1185289245 22:50015579-50015601 CAGGGGGCCTGGGGCGCGGTCGG - Intronic
950202412 3:11054700-11054722 CAGGAGGCCTGGAGCACTGTGGG + Intergenic
952960961 3:38588862-38588884 GAGGTGGGCTGGAGGGCAGCGGG + Intronic
953448582 3:42988137-42988159 CAGCTGGGCTGGAGGCCAGAAGG - Intronic
953455128 3:43034901-43034923 CAAGAGGCCGGGAGGACAGTAGG - Intronic
953535794 3:43775727-43775749 CAGCTGGCCTGGTGGGGAGGTGG + Intergenic
953909690 3:46885552-46885574 CAGCTTCCCTGGAGAGCAGTGGG - Intronic
954101048 3:48372875-48372897 CAGCGGGCTTGGGGGGCAGTGGG - Intronic
954331050 3:49890454-49890476 CATGTGGACTGTAGGGCAGGTGG + Intronic
954456207 3:50601109-50601131 CTGGTGACCTTGAGGGAAGTAGG - Intergenic
956009532 3:64816045-64816067 CAGATGGCCTGGGGAGCTGTGGG - Intergenic
956590383 3:70908333-70908355 CAGTTGACCTGGATGGAAGTGGG + Intergenic
956870388 3:73411470-73411492 AAGGTGGCAAGTAGGGCAGTGGG + Intronic
961123920 3:124398876-124398898 CAGGGGGCCAGGAGGGGAGGTGG + Intronic
961185601 3:124912438-124912460 CAAGAGGCATGGAGGGTAGTGGG + Intronic
961443389 3:126966087-126966109 CAGGTGGCTAGGAGGGGAGTGGG + Intergenic
961811910 3:129526914-129526936 CAGGTGGGCTGCAGGGAAGGGGG + Intergenic
962368502 3:134801920-134801942 AGGGAGGCCTGGAGGGCAGTGGG + Intronic
962464315 3:135642489-135642511 GATGTGGCCTGGAGCACAGTAGG + Intergenic
963247349 3:143075232-143075254 CAGCTGGACTGGGGGCCAGTAGG + Intergenic
963720721 3:148858894-148858916 CAAGTGGCCTCCAGTGCAGTTGG + Intronic
964584638 3:158283772-158283794 CAGGTTTTCTGGAGGGCAATTGG - Intronic
967148484 3:186626762-186626784 CATGTGGTCTGGAGGACAGAAGG - Intergenic
967914764 3:194570594-194570616 CAGTTGTCCTGGGGGTCAGTGGG - Intergenic
968133985 3:196208639-196208661 CAGGTGGCCTAGAAGGCAGGGGG - Intronic
968593983 4:1473077-1473099 CAGGTGGCAGGGTGGGCAGGTGG - Intergenic
968903555 4:3441972-3441994 GAGCTGGCCTGAGGGGCAGTGGG - Exonic
969146248 4:5126378-5126400 GGGCTGGCCTGCAGGGCAGTGGG - Intronic
969414538 4:7050039-7050061 CTGGTGGCCTGGGTGGCAGGTGG + Intronic
969610617 4:8225830-8225852 GAGGAGGCCTGGAAGCCAGTGGG + Intronic
971267850 4:25110736-25110758 CAGCTGGCCTGCAGGGCAGTGGG - Intergenic
971462978 4:26922684-26922706 CAGTTTTCCTGGAGGTCAGTGGG + Intronic
972318293 4:37948207-37948229 AAGGCGGACTGGAGGGCAGTGGG + Intronic
972750137 4:41980404-41980426 CAGCTGGGCTGGAGTGCAGTGGG + Intergenic
973816390 4:54623263-54623285 CAGGGGGCCAGGAAGGCAGGAGG - Intergenic
975660000 4:76679270-76679292 TAGCGTGCCTGGAGGGCAGTGGG - Intronic
976310537 4:83607483-83607505 GAGGTGGGGTGGAGGGAAGTGGG + Intergenic
977328500 4:95606916-95606938 CATGTGGCCTGGCTGGCCGTCGG - Intergenic
982220026 4:153116306-153116328 GAGGTGGGGTGGAGGGAAGTGGG - Intergenic
983464848 4:168074402-168074424 CAGGAGGCAGGGACGGCAGTGGG + Intergenic
983566728 4:169160992-169161014 CAGAAGGCTTGGAGGGCAGAGGG - Intronic
984583928 4:181541342-181541364 CACCTAGGCTGGAGGGCAGTGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985524403 5:394769-394791 CTGGTTGCGTGGAGGGCAGAGGG + Intronic
985650671 5:1105833-1105855 CAGCTGGTCTTCAGGGCAGTGGG - Intronic
985654042 5:1120757-1120779 CACGTGGGCTGCAGGGCAGGAGG + Intergenic
985819694 5:2151189-2151211 CAAGGGGCCTGGGTGGCAGTGGG - Intergenic
986591426 5:9374838-9374860 CAGTGAGCCTGGAGGGCAGGAGG - Intronic
986646120 5:9917678-9917700 CACGAGGCGTGCAGGGCAGTGGG - Intergenic
988507782 5:31838983-31839005 CAGATGATCTGGAGGGCAGGAGG - Intronic
989111235 5:37908153-37908175 CAGGTGATCTGGCGGGGAGTTGG + Intergenic
990540812 5:56770968-56770990 TAGGTGGCCCTGAGGCCAGTAGG + Intergenic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
992448154 5:76852173-76852195 CAAGTGGAGTGGAGGCCAGTGGG - Intronic
992561624 5:77958104-77958126 CGGGCGGCCGGGAGGGCAGTTGG + Intergenic
993011058 5:82483508-82483530 AAGATGGCCTGGAGTGCAGTGGG + Intergenic
993568067 5:89499996-89500018 CAGGTGTCCTGAAGAGTAGTCGG + Intergenic
994250919 5:97536128-97536150 AAGGTGGCCAAGTGGGCAGTAGG - Intergenic
997658070 5:135569892-135569914 CAGGTGGACAGGTGGACAGTAGG - Intergenic
998104066 5:139457208-139457230 CAGGTGGGGTGGAGAGTAGTGGG - Intronic
999610307 5:153362202-153362224 CATGTGGCCTAGGGGGCAGTGGG - Intergenic
1001214786 5:169845457-169845479 CAGGGTGCCTGGCGTGCAGTGGG + Intronic
1002070214 5:176674442-176674464 CGGGTGGCCTGGTGGGAACTGGG + Intergenic
1002337342 5:178489112-178489134 GAGATGGCATGGAGGTCAGTGGG + Intronic
1002421718 5:179152498-179152520 CAGGGAGCCTGGCGGGCAGCTGG + Intronic
1003005430 6:2376697-2376719 CAGGTAGCCTGGAGGGACGTGGG + Intergenic
1003029506 6:2589668-2589690 AAGGTGGCCTGAGGGGCAGGGGG - Intergenic
1003335073 6:5163323-5163345 AAGGTGGCGTGCAGTGCAGTGGG - Intronic
1004075986 6:12344654-12344676 GAGGTGGCCAGGAGGGTAGACGG - Intergenic
1004399013 6:15271235-15271257 CAGGAGGGCTTGAGGCCAGTGGG + Intronic
1004780546 6:18903704-18903726 CAGGTGGCTTAGAGGGCAAGAGG + Intergenic
1005871057 6:29974772-29974794 TAAGTGGCCTGGAGGGGAGTGGG + Intergenic
1006042445 6:31267612-31267634 CAGGTGGGCTTGAGGGGAGTGGG - Intergenic
1006052033 6:31352701-31352723 CAGGTGGGCTTGAGGGGAGTGGG - Intronic
1006093949 6:31644379-31644401 CAGGGGGCAGGGAGGGCAGCTGG + Intronic
1006474989 6:34247751-34247773 CTGTTGGCCTGGGGGGCATTGGG + Exonic
1006519846 6:34564885-34564907 GAAGTGGCCTGGAGGGGAGAAGG + Intergenic
1007340155 6:41186169-41186191 CAGGAGGCCTGGAAGGAAGGGGG + Intergenic
1007345175 6:41223690-41223712 CAGGGGATTTGGAGGGCAGTGGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008481739 6:51993177-51993199 CAGGTGGCAGGGAGGTGAGTGGG + Intronic
1012794555 6:103742955-103742977 CAGGTGGTCTGCAGGGCATGAGG + Intergenic
1014048627 6:116925574-116925596 CAGGTTGACTGGATGGCAGAGGG - Exonic
1014781254 6:125567549-125567571 CAGGGGGCCTGGAGGGTATGTGG - Intergenic
1015540111 6:134305317-134305339 CAGGCTGGCTGGAGTGCAGTGGG - Intronic
1015697304 6:135995149-135995171 CAGAGGGCCTGGAGGCCTGTAGG - Intronic
1015935613 6:138404119-138404141 CAGGTGGCCCCGCGGGCAGTAGG - Intronic
1016371019 6:143374228-143374250 CTGGTGGCCTGCAGGACAGGTGG + Intergenic
1017592148 6:155989488-155989510 CAGGTGGCAGGCAGGGCAGCTGG - Intergenic
1017820605 6:158046385-158046407 CAGGGGGCCGGGAGGGCAGCGGG + Intronic
1017900311 6:158713906-158713928 CGGCTGGCCTGGAAGGTAGTGGG - Intronic
1019176446 6:170161681-170161703 CACCTGGGCTGGAGTGCAGTGGG + Intergenic
1019406148 7:885300-885322 CAGCAGGCGTGGAGGGCAGGAGG - Intronic
1019422148 7:955434-955456 GTGGTTGCCTGGAAGGCAGTGGG - Intronic
1019481484 7:1268914-1268936 CAGGTGTCAGGGAGGGAAGTGGG - Intergenic
1019740567 7:2670966-2670988 CAGGAGGCCAGGTGGGCAGCAGG + Intergenic
1019906730 7:4070501-4070523 CAGGTGCCCTGGGGCACAGTGGG + Intronic
1021687949 7:23205985-23206007 CCGCCGGCCTGGAGGGCCGTGGG - Intergenic
1022171836 7:27838865-27838887 CAGGTGACATGGGTGGCAGTTGG - Intronic
1022172666 7:27844760-27844782 CAGCTGGCATGCAGGGCAGTGGG - Intronic
1022471253 7:30682942-30682964 GAGGAGGCCTGGAGGGAAGCAGG + Intronic
1024237280 7:47408137-47408159 AGGGTGGCCTGGAGGCCATTGGG + Intronic
1024948262 7:54833466-54833488 CAGGTGGGATGGAGGGGGGTGGG + Intergenic
1024963776 7:55004494-55004516 CTGGTGGCTTGGAGGGACGTTGG + Intergenic
1025739723 7:64184575-64184597 CAGGTGGACTGCAGCGCAGTGGG + Intronic
1026001052 7:66558903-66558925 CAGGTGGACTGCAGCGCAGTGGG + Intergenic
1026019123 7:66694483-66694505 GGCGGGGCCTGGAGGGCAGTGGG + Intronic
1026815968 7:73512147-73512169 AAGGTGGACTGGAGGGCTGTGGG - Intronic
1026830567 7:73607551-73607573 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1028165882 7:87538191-87538213 CAGTTGGCCTGGAGGCTGGTTGG + Intronic
1028659560 7:93253721-93253743 CAGGTGGCATGGAGGGCAGTGGG + Intronic
1028855734 7:95590976-95590998 CACTTGGGCTGGAGTGCAGTGGG + Intronic
1029298198 7:99558426-99558448 GAGTTAGCATGGAGGGCAGTGGG + Intronic
1029438602 7:100575531-100575553 CAGGTGACATGCAGGGCAGGGGG + Intronic
1029438608 7:100575547-100575569 CAGGGGGCATGCAGGGCAGGGGG + Intronic
1031492662 7:122408463-122408485 CACTTGGGCTGGAGTGCAGTGGG + Intronic
1031919233 7:127588922-127588944 TTTGAGGCCTGGAGGGCAGTCGG - Intronic
1032552837 7:132801900-132801922 AACGTGACCTGGAGGGCAGGAGG + Intronic
1033366938 7:140678915-140678937 CAGGTGCCCTGGTGGGCTTTGGG - Intronic
1033502948 7:141972010-141972032 TAGGTGACCTGGATGCCAGTAGG - Intronic
1034447196 7:151119809-151119831 CACCTGGCCTGGAGGCCAGCAGG - Intronic
1034493572 7:151407384-151407406 CCGGTAGCCTGGTGGGCACTTGG - Intronic
1034571456 7:151959766-151959788 CTGGTGGCCAGGAGGGTACTGGG + Intronic
1035577935 8:719913-719935 CGGGTGGGCTGGAGGGCACCAGG - Intronic
1035637286 8:1156336-1156358 CTGGTGGCCCGGAGGAGAGTTGG + Intergenic
1037643721 8:20771636-20771658 CATGTGCCATGGAGTGCAGTGGG + Intergenic
1037712084 8:21362751-21362773 AAGGTGGCCTGCAGGGCCCTAGG - Intergenic
1038266679 8:26043736-26043758 TGGGTGGCCAGGAGGGCAGCAGG + Intronic
1038479249 8:27890516-27890538 TAGATGGCGTGGAGGGCAATGGG + Intronic
1041722952 8:60992878-60992900 GAGGTGGTCTGGAGGGCATTAGG + Intergenic
1045274573 8:100691471-100691493 CAGGCAGGCTGGAGTGCAGTGGG - Intronic
1046280556 8:112023949-112023971 TAGGAGGCCTGGAGTGGAGTAGG - Intergenic
1047189753 8:122667350-122667372 CAGGTGGCCAGGTGGGAAGAGGG - Intergenic
1048211929 8:132461593-132461615 CAGGCACCCTGGAAGGCAGTGGG - Intronic
1048467762 8:134681363-134681385 CAGGTGGTATGAAAGGCAGTGGG - Intronic
1048934195 8:139341804-139341826 CAGGTGGGCTGGAGGCTAGAGGG - Intergenic
1048946245 8:139450312-139450334 CAGGTGGCTTAAAGGGCAGTGGG + Intergenic
1049262479 8:141646921-141646943 CAGGTGCCCTGGAGGCCATGGGG - Intergenic
1049443480 8:142619608-142619630 CTGATGGCCTGGGGGCCAGTGGG + Intergenic
1049512509 8:143036325-143036347 CAGCTGGACGGGAGGGCAGCTGG + Intergenic
1049539670 8:143202516-143202538 CAGGAGGCCGGGAGGACAGCAGG - Intergenic
1049697703 8:143991626-143991648 GGGGTGGCCGGGAGGGCAGGGGG + Intronic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1050390526 9:5138567-5138589 CACCTGGCCTGTTGGGCAGTGGG + Intronic
1051019548 9:12525729-12525751 CTGGTGACCAGGAGGGCAGGTGG - Intergenic
1051911222 9:22155061-22155083 CAGGTGGACTGCAGCGCAGTGGG + Intergenic
1052892412 9:33715510-33715532 CATGTAGGCTGGAGGACAGTGGG - Intergenic
1053314601 9:37040929-37040951 CAGCTGGCGTGGAGGGGAGAGGG + Intergenic
1053576513 9:39360509-39360531 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1053841023 9:42188434-42188456 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054098081 9:60919200-60919222 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1054119482 9:61194830-61194852 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054588272 9:66987732-66987754 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1055986303 9:82058926-82058948 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056585040 9:87922207-87922229 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1056611839 9:88130733-88130755 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1057160869 9:92887257-92887279 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1057714392 9:97479452-97479474 CCCCTGGGCTGGAGGGCAGTTGG + Intronic
1057873208 9:98733479-98733501 GAGGTGGCCTGCTTGGCAGTGGG - Exonic
1058671212 9:107361996-107362018 CAGGTGGCCTGAGGGGGCGTGGG - Intergenic
1059395077 9:114029008-114029030 CAGGTGGTGAGAAGGGCAGTGGG - Intronic
1060319022 9:122538140-122538162 CAGGGGGACTGGGGGGCTGTTGG - Intergenic
1060716113 9:125930780-125930802 AGGATGGGCTGGAGGGCAGTAGG - Intronic
1060820399 9:126658415-126658437 CAGGCGGCAGGGAGGGCAGGGGG - Intronic
1061074408 9:128332447-128332469 CAGGAGCCCTGAGGGGCAGTGGG - Intronic
1061119095 9:128632321-128632343 CAGGTACCCGGGAGGGCTGTGGG + Exonic
1061137289 9:128742192-128742214 CATGGGCCCTGGAGGCCAGTGGG - Intronic
1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG + Intronic
1061601273 9:131671761-131671783 CAGGTGCCCTGGAGAGTTGTGGG + Intronic
1061802113 9:133118382-133118404 CAGGTGGGCTGGAGTGAAGAGGG - Intronic
1062030779 9:134360984-134361006 CAGGAGGCCTGGAGAGCTTTTGG + Intronic
1062245345 9:135563211-135563233 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245423 9:135563507-135563529 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245426 9:135563515-135563537 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245429 9:135563523-135563545 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062326812 9:136016493-136016515 CAGGGAGCATGGAGGGCAGGCGG - Intronic
1062328320 9:136023324-136023346 CAGGTGCCCTGGCGGGCTGCAGG - Intronic
1062380732 9:136285428-136285450 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380735 9:136285436-136285458 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380738 9:136285444-136285466 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1062380741 9:136285452-136285474 CAGGTGGGCAGGCGGGCAGGTGG + Intronic
1062380747 9:136285468-136285490 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380750 9:136285476-136285498 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380753 9:136285484-136285506 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062545735 9:137063094-137063116 CAGGTGGACTGCAGCGCAGTGGG - Exonic
1062555984 9:137113684-137113706 CAGGTGGCTGGGAGGACAGGTGG + Intronic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1186376413 X:9006799-9006821 GAGGTGGGATGGAGGGAAGTGGG - Intergenic
1186924816 X:14321971-14321993 CAGTTGACCTGGAGGGGAGAAGG - Intergenic
1189222249 X:39382491-39382513 AAGATGGCCTGGAGGGAAGGGGG - Intergenic
1189381423 X:40505208-40505230 GTGGGGGCCTGGAGGGCTGTGGG + Intergenic
1190039522 X:47058602-47058624 CCAATGGCCTGGAGGGCAGCTGG + Exonic
1190255849 X:48761799-48761821 CTGGCAGCCTGGAGGGCAGATGG - Exonic
1190263377 X:48813747-48813769 GAGGTGGCCTGTAAGGCATTGGG + Intronic
1192368246 X:70492944-70492966 CAGGTGGTCTGAAGGGAGGTGGG - Intronic
1192473858 X:71422361-71422383 CACCTGGGCTGGAGTGCAGTGGG + Intronic
1193127934 X:77889410-77889432 CAGGCTGGCTGGAGTGCAGTGGG + Intronic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1195211158 X:102652955-102652977 CAGGTGGCTTTGAGACCAGTGGG + Intronic
1196337228 X:114551481-114551503 CAGTTTGCCTGGAGGGCAAATGG - Intergenic
1196950522 X:120871795-120871817 CAGGTTGCCTGGAGGCCACATGG - Intergenic
1197061504 X:122186674-122186696 CATGTGGCCTGGCATGCAGTAGG - Intergenic
1197783622 X:130179545-130179567 CAGGAGGAATGGAGGTCAGTAGG - Intronic
1198296829 X:135295580-135295602 CAGGTCGCCTGGAGAGCTGGTGG - Intronic
1198805586 X:140491093-140491115 CTGGAGCCCTGGAGGCCAGTGGG + Intergenic
1199991463 X:152989843-152989865 CACGTGGCCTGGGTGCCAGTGGG + Exonic
1200000788 X:153058846-153058868 CATGTGGCCTGGGGGCCAGTGGG - Intronic
1200103258 X:153698865-153698887 GAGGTGGCTTGGAGGGCATTTGG - Intergenic
1201347781 Y:13004079-13004101 CAGGTGGCCTGCAGGTCACAAGG + Intergenic
1202109356 Y:21405166-21405188 GCGGTGGCTTGGAGGGGAGTGGG + Intergenic
1202373802 Y:24215409-24215431 CAGGGGGCCTAAGGGGCAGTAGG - Intergenic
1202496979 Y:25454711-25454733 CAGGGGGCCTAAGGGGCAGTAGG + Intergenic