ID: 1144092775

View in Genome Browser
Species Human (GRCh38)
Location 17:11872628-11872650
Sequence CAGCGAAGGTGGGCCGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 622
Summary {0: 1, 1: 0, 2: 8, 3: 56, 4: 557}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144092769_1144092775 6 Left 1144092769 17:11872599-11872621 CCACTTGAGGAGATTAGGCTCAT 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1144092775 17:11872628-11872650 CAGCGAAGGTGGGCCGGGCGCGG 0: 1
1: 0
2: 8
3: 56
4: 557
1144092766_1144092775 12 Left 1144092766 17:11872593-11872615 CCCAGTCCACTTGAGGAGATTAG 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1144092775 17:11872628-11872650 CAGCGAAGGTGGGCCGGGCGCGG 0: 1
1: 0
2: 8
3: 56
4: 557
1144092764_1144092775 25 Left 1144092764 17:11872580-11872602 CCTTTGGCAAGTTCCCAGTCCAC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1144092775 17:11872628-11872650 CAGCGAAGGTGGGCCGGGCGCGG 0: 1
1: 0
2: 8
3: 56
4: 557
1144092767_1144092775 11 Left 1144092767 17:11872594-11872616 CCAGTCCACTTGAGGAGATTAGG 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1144092775 17:11872628-11872650 CAGCGAAGGTGGGCCGGGCGCGG 0: 1
1: 0
2: 8
3: 56
4: 557

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144092775 Original CRISPR CAGCGAAGGTGGGCCGGGCG CGG Intronic
900088658 1:909941-909963 GACCGAGGGTGGGCCCGGCGCGG + Intergenic
900121092 1:1049052-1049074 CAGCTCAGGTGGGCGGGGAGGGG + Exonic
900121108 1:1049087-1049109 CAGCTCAGGTGGGCGGGGAGGGG + Intronic
900427859 1:2588618-2588640 CAGCAAAGGTGGGTCGAGGGAGG + Exonic
900716114 1:4145472-4145494 CAGCTCAGGTGGGCGGGGCCTGG - Intergenic
900934142 1:5754724-5754746 AAGACAAGGTGGGCCGGGCACGG - Intergenic
900991894 1:6101955-6101977 CAGCCAGGGTGGCCCCGGCGGGG - Exonic
900992549 1:6104621-6104643 CAGGGAGGGTGGGCTGGGGGGGG - Exonic
901082018 1:6588907-6588929 CTCCGCAGGTGGGCCTGGCGGGG - Exonic
901504229 1:9674387-9674409 ATACGAAGGTTGGCCGGGCGCGG + Intronic
902196011 1:14798722-14798744 AAAAGAAAGTGGGCCGGGCGTGG - Intronic
902413669 1:16226681-16226703 CAGAGATGGTGGGCAGGGCTGGG + Intergenic
902598219 1:17523377-17523399 TAGCAATGGTGGGCCGGGCGCGG - Intergenic
902631026 1:17704759-17704781 GAGAGCAGGGGGGCCGGGCGCGG - Intergenic
902920514 1:19663981-19664003 CAGAGAAAGTGGGCCCAGCGAGG - Intergenic
903163584 1:21506230-21506252 AAGCTAAGTTAGGCCGGGCGTGG - Intergenic
903335022 1:22618969-22618991 CAGAGATGGTGGGCAGGGCGGGG - Intergenic
903907459 1:26696670-26696692 CAGCGGCGGCGGGCCCGGCGCGG + Exonic
904431062 1:30464685-30464707 AAGTGAAGATGGGCCGGGTGTGG + Intergenic
904486968 1:30831521-30831543 AAGAGAATGTGGGCCGGGTGCGG + Intergenic
904853326 1:33475956-33475978 GAGAGAAAGAGGGCCGGGCGCGG - Intronic
906280319 1:44548907-44548929 CAGCTATGATTGGCCGGGCGTGG + Intronic
908339719 1:63164224-63164246 CAGGTAAGGTTGGCCGGGCACGG - Intergenic
910885748 1:91961865-91961887 CAGCCAAGGTTGGCCGGGCGCGG + Intronic
911671770 1:100615721-100615743 AAGTGAAAGTGGGCCAGGCGCGG - Intergenic
912371688 1:109178672-109178694 CAGTGGAGGTGGGCCGGGTGTGG + Intronic
912860353 1:113208579-113208601 CTGCTATGGTTGGCCGGGCGTGG - Intergenic
915333891 1:155129606-155129628 CAGCCAAGCTGGGCCCAGCGTGG + Intronic
915442686 1:155955406-155955428 GGGAGAAGGTCGGCCGGGCGCGG - Intronic
915512081 1:156391989-156392011 CAGCGAAGCAGGGAAGGGCGTGG - Intergenic
915650916 1:157310351-157310373 CAGCGAAGGTAGCCCTGGCTCGG + Intergenic
915908818 1:159899755-159899777 AAGCACTGGTGGGCCGGGCGCGG - Intronic
917512293 1:175678543-175678565 CAGGGGAGGTGGGCAGGGCAGGG - Intronic
917826551 1:178827683-178827705 CAGAGAGTATGGGCCGGGCGCGG - Intronic
917956983 1:180109406-180109428 CAGAGAAAGTGGGCCGAGCGCGG - Intronic
919587036 1:199451571-199451593 AAGCTAAGGTAGGCGGGGCGCGG + Intergenic
920144606 1:203848146-203848168 TAGCAAAGGTTGGCCGGGCATGG - Intronic
921232771 1:213089750-213089772 CAGCAAAATGGGGCCGGGCGCGG - Intronic
921381249 1:214526799-214526821 GAGAGCAGGTGGGCCGGGCGCGG + Intronic
921562452 1:216675068-216675090 AAGGGAAGGTGGGCCGGGCACGG + Intronic
923597121 1:235369216-235369238 AAGCCAAAGTCGGCCGGGCGTGG + Intronic
924078499 1:240366839-240366861 CAGGGATAGAGGGCCGGGCGCGG - Intronic
924156289 1:241180082-241180104 CACAGAAAGTGGGCCGGGCGCGG + Intronic
924522689 1:244818914-244818936 CAGCTTATGTGGGCCAGGCGTGG + Intergenic
1063054449 10:2489237-2489259 AAGAGAAGGAGGGCCGGGCACGG + Intergenic
1063120426 10:3101959-3101981 AACTGAAGTTGGGCCGGGCGCGG + Intronic
1063563521 10:7150890-7150912 CAGGGAAGGTGTGGCGGGCGGGG + Intergenic
1064178934 10:13099003-13099025 CAGTGCAGGAGGGCCAGGCGCGG - Intronic
1064229191 10:13514581-13514603 CAGGGAAGTTGGGTCGGACGTGG + Intronic
1064523739 10:16231082-16231104 CAGTGGATGTGGGCCGGGCATGG - Intergenic
1064764050 10:18652847-18652869 CAGAGAAAATGGGCTGGGCGTGG - Intronic
1065015562 10:21459790-21459812 CAAAGAAGCTGGGCCGGGCAAGG + Intergenic
1065038954 10:21671363-21671385 CAATTAAGGTTGGCCGGGCGTGG + Intronic
1065133015 10:22641749-22641771 AAGAGAAGGTAGGCCGGGCATGG - Intronic
1066380996 10:34901168-34901190 GAACAAAGGTTGGCCGGGCGCGG + Intergenic
1066428705 10:35332892-35332914 AAACTCAGGTGGGCCGGGCGCGG - Intronic
1066464423 10:35640388-35640410 CAGCGGTGGCGCGCCGGGCGCGG - Exonic
1066756964 10:38721178-38721200 CAGAGAAGGGTGGCCGGGCATGG - Intergenic
1068805123 10:61186616-61186638 CACAGAAGGTAGGCCAGGCGCGG + Intergenic
1069808067 10:71138305-71138327 CAGCGGAGGTGGCCCGGCAGAGG - Intergenic
1070833363 10:79433546-79433568 TAGCGAAGGTGGGGCTGGCAGGG + Intronic
1071314555 10:84381635-84381657 CATCCACGGTGGGCCGGGCGCGG + Intronic
1072057130 10:91770435-91770457 TAAGGAAGGTTGGCCGGGCGCGG - Intergenic
1072241337 10:93497826-93497848 CAGGGAAAGGTGGCCGGGCGCGG + Intronic
1073420715 10:103421585-103421607 CAGGGGAGGTGGGCCAGGGGTGG + Intronic
1074377156 10:112950150-112950172 CAGCCGGGGTGGGCGGGGCGGGG - Intergenic
1074377485 10:112951618-112951640 CAGCGGGCGGGGGCCGGGCGCGG - Intronic
1074560314 10:114529734-114529756 ACCCGAAGGTGGGCTGGGCGTGG + Intronic
1074781439 10:116805024-116805046 CAGGGAATGTTGGACGGGCGCGG + Intergenic
1074996985 10:118766254-118766276 AAGAGGAGGTTGGCCGGGCGCGG + Intergenic
1075603198 10:123785921-123785943 AAGCTAAAGTGGGCTGGGCGCGG - Intronic
1075851357 10:125590404-125590426 AAGAGAAGGAGGGCCAGGCGTGG - Intronic
1076748409 10:132526741-132526763 AAGTGAATGTCGGCCGGGCGCGG - Intergenic
1076864419 10:133160054-133160076 CAGCGGGGGTGGGACGGGGGCGG + Intergenic
1076877261 10:133221989-133222011 AACCCTAGGTGGGCCGGGCGCGG + Intronic
1077576440 11:3387143-3387165 GAGCCAGGGGGGGCCGGGCGCGG + Intergenic
1077582647 11:3426735-3426757 GAGAGAATGAGGGCCGGGCGTGG + Intergenic
1079013317 11:16847380-16847402 CAGCCACAGTTGGCCGGGCGTGG - Intronic
1079235841 11:18689582-18689604 GAGCCTATGTGGGCCGGGCGTGG + Intergenic
1081752996 11:45525380-45525402 CATAGAAGCTGGGCCGGGCTGGG + Intergenic
1081796086 11:45820968-45820990 CAGAAAAAGTAGGCCGGGCGCGG + Intergenic
1081819505 11:45978009-45978031 CAGAGATGGTGGGCCGGTTGCGG + Intronic
1081831596 11:46120353-46120375 CAGCCGAGGGGGGGCGGGCGAGG + Intronic
1082764745 11:57158082-57158104 CAGAGAAGCTGGGCTGGGTGGGG - Intergenic
1082916421 11:58443308-58443330 CAGCCAAGTTTGGCCAGGCGCGG + Intergenic
1083335205 11:61917899-61917921 TAGGGAAGGAGGGCCGGGTGAGG - Intronic
1083412391 11:62503296-62503318 CAACGAAAGTGGGCTGGGCACGG + Intronic
1083511029 11:63209534-63209556 CAGGGAAGATGGACAGGGCGAGG + Intronic
1083564032 11:63697764-63697786 AAGCACAGGTGGGCCGGGCGCGG - Intronic
1083584872 11:63849460-63849482 CAGGTTTGGTGGGCCGGGCGCGG + Intronic
1083620613 11:64047604-64047626 GAGGGAAGGAAGGCCGGGCGCGG + Intronic
1083664074 11:64265275-64265297 GAGCAAAGGTGGGCGGGGGGTGG - Intronic
1083687342 11:64384518-64384540 GACCGAAGGTGGGCGGGGCGCGG + Intergenic
1084002766 11:66306447-66306469 CTGCAAAAGTGGGCCGGGCGTGG + Intergenic
1084188411 11:67487577-67487599 AAGAGTGGGTGGGCCGGGCGCGG - Intronic
1084214020 11:67637915-67637937 TGGTTAAGGTGGGCCGGGCGCGG + Intronic
1084643559 11:70440806-70440828 TAGCTAAGTTGGGCCGAGCGTGG + Intergenic
1084657276 11:70526966-70526988 CAGCCAAGGTGACCTGGGCGGGG - Intronic
1084892682 11:72244217-72244239 CCGCGGAGGGGGGCGGGGCGGGG + Intronic
1085028707 11:73256841-73256863 AAGCCAAGTTAGGCCGGGCGCGG - Intergenic
1086424748 11:86672309-86672331 CAGCGCAGGTGGGCCAGGGAAGG - Exonic
1089319739 11:117617280-117617302 GAGGGAAGCTGGGCCGGGCTGGG + Intronic
1092822881 12:12370013-12370035 AAGTGAAGGTGGGCCGGGCGTGG - Intronic
1093143627 12:15538511-15538533 GTGCTAAAGTGGGCCGGGCGCGG - Intronic
1093973479 12:25396019-25396041 CAGCAAATGTTGGCTGGGCGTGG - Intergenic
1094317557 12:29149664-29149686 CCGCCAAGGTGGGGCGCGCGGGG + Intronic
1094385475 12:29888940-29888962 CAGCGCTGGTGGGCTGGGGGGGG - Intergenic
1094477706 12:30853943-30853965 CAGCGGAGGTGGACCCGGCCCGG - Intergenic
1095178294 12:39118169-39118191 AAACCAAGGTGGGCCGGGCACGG + Intergenic
1096908039 12:54953808-54953830 TAGAGAAGGTAGGCCGGGCACGG - Intronic
1097040197 12:56151846-56151868 GAGTGAAGGTGGGCCCGGCCGGG + Intergenic
1098284298 12:68892567-68892589 TAGGGTAGGTAGGCCGGGCGTGG + Intronic
1098556722 12:71826818-71826840 GAGCAAAGCTGGGCCGGGCATGG + Intergenic
1099202019 12:79689714-79689736 CCGCAGAGGTGAGCCGGGCGGGG - Exonic
1101119660 12:101565694-101565716 AAGCTAAAGTTGGCCGGGCGCGG + Intergenic
1101606054 12:106248155-106248177 CGGAGAGGGAGGGCCGGGCGGGG + Intronic
1102417892 12:112780336-112780358 CAGGGAGGGTGGGAGGGGCGAGG - Intronic
1103530981 12:121601508-121601530 CATTGAAGATGGGCCAGGCGTGG + Intergenic
1103759223 12:123235771-123235793 AAGAGAAAGTTGGCCGGGCGTGG + Intronic
1104162147 12:126191310-126191332 AAGCACAGGTGGGCTGGGCGCGG + Intergenic
1105019070 12:132804527-132804549 CAGGGAAGGAGGGCGTGGCGGGG + Intronic
1105747036 13:23387167-23387189 AAACGAATGTCGGCCGGGCGCGG + Intronic
1105879218 13:24588954-24588976 TAGGGAAGGTAGGCCGGGCATGG - Intergenic
1105920618 13:24960104-24960126 TAGGGAAGGTAGGCCGGGCATGG + Intergenic
1106250483 13:27978531-27978553 CGGGGCAGGGGGGCCGGGCGCGG - Intronic
1106253715 13:28002859-28002881 AAGCGGAGGTGGGCGGGGCGGGG + Intergenic
1107486926 13:40836968-40836990 TAGGGAAGGTGGGCTGGGCATGG + Intergenic
1107513862 13:41110139-41110161 TAGCCTGGGTGGGCCGGGCGCGG + Intergenic
1107614868 13:42155723-42155745 TACAGAAGGTGGGTCGGGCGTGG - Exonic
1107891593 13:44919175-44919197 AAGTGAATATGGGCCGGGCGCGG + Intergenic
1108617565 13:52149187-52149209 AAGAAAAGGTGGGCTGGGCGCGG - Intronic
1109421428 13:62116746-62116768 TAACGATGGTGGGCCGGGCCTGG + Intergenic
1110616057 13:77543371-77543393 AAGCTAAAGTTGGCCGGGCGCGG - Intronic
1112831432 13:103457258-103457280 CATCAAAAGTCGGCCGGGCGCGG - Intergenic
1113195360 13:107797497-107797519 AACAGGAGGTGGGCCGGGCGCGG - Intronic
1114175758 14:20318181-20318203 AAGCGATAGTGGGCCGGGCGCGG + Intronic
1114467504 14:22933861-22933883 GAGTGAAGGTGGGCCTGGGGAGG - Intergenic
1114517233 14:23307932-23307954 CAGAGAAGGTGCGCCGGAAGCGG - Exonic
1115110776 14:29819398-29819420 AAGCAAATGGGGGCCGGGCGCGG + Intronic
1115773132 14:36687241-36687263 AAACAAAGGTGGGCCGGGCACGG - Intronic
1117057917 14:51931954-51931976 AAGAAAATGTGGGCCGGGCGCGG + Intronic
1117376607 14:55123473-55123495 AAGGGGAGGTGGGCCGGACGCGG + Intergenic
1121120976 14:91375765-91375787 CAGGGAAGGTGCTCCGGGCACGG - Intronic
1121629495 14:95412134-95412156 CAGGGCAGCTGGGCCGGGCAGGG - Intronic
1121664865 14:95664838-95664860 CAGCCAAGGTGGGCCAAGCCAGG - Intergenic
1122346770 14:101065766-101065788 CACCGAGAGTGGGCCGGGCAGGG + Intergenic
1122415534 14:101547948-101547970 CAGCGATGGTGGGGGGGGGGAGG - Intergenic
1122444938 14:101761564-101761586 CAGCGGGGCGGGGCCGGGCGCGG + Intergenic
1122467071 14:101941048-101941070 GAGAGAAGGTGGGCCTGGCGAGG + Intergenic
1122518951 14:102329256-102329278 CAAAGAAATTGGGCCGGGCGTGG - Intronic
1122625308 14:103082483-103082505 CGTAGATGGTGGGCCGGGCGCGG + Intergenic
1122634411 14:103123388-103123410 CGGGGAAGGAGGGGCGGGCGGGG + Intergenic
1123037926 14:105478864-105478886 CAGCAGAGGTGGGCTGGGCGCGG + Exonic
1123467964 15:20530113-20530135 AACAGAAGGTGGGCAGGGCGGGG + Intergenic
1123650149 15:22470929-22470951 AACAGAAGGTGGGCAGGGCGGGG - Intergenic
1123697789 15:22891599-22891621 GAGCGAGTGTGGGCCGGGGGCGG - Intronic
1123740555 15:23279771-23279793 AACAGAAGGTGGGCAGGGCGGGG - Intergenic
1123744177 15:23305732-23305754 CATCAAATATGGGCCGGGCGGGG - Intergenic
1123746443 15:23322787-23322809 AACAGAAGGTGGGCAGGGCGGGG + Intergenic
1124120444 15:26883866-26883888 CATCTAAGGAGGACCGGGCGTGG + Intronic
1124272582 15:28296183-28296205 CATCAAATGTGGGCCGGGCATGG + Intronic
1124278710 15:28346104-28346126 AACAGAAGGTGGGCAGGGCGGGG + Intergenic
1124303989 15:28565504-28565526 AATAGAAGGTGGGCAGGGCGGGG - Intergenic
1124453680 15:29821911-29821933 CAGCGAGGGAGGGCGGGACGCGG + Intronic
1124532870 15:30521979-30522001 AATAGAAGGTGGGCAGGGCGGGG - Intergenic
1124765786 15:32485665-32485687 AACAGAAGGTGGGCAGGGCGGGG + Intergenic
1124819781 15:33033318-33033340 GAGCGAAGATGAGCCAGGCGTGG - Intronic
1124922401 15:34039201-34039223 CAGCGGAGCGGGGCGGGGCGGGG + Intronic
1125705143 15:41728037-41728059 AAGCAAGGGTGGGCCGGGCGCGG + Intronic
1125933579 15:43616604-43616626 CAGTGAAGGAGGGCAGGGGGTGG + Exonic
1125946677 15:43716066-43716088 CAGTGAAGGAGGGCAGGGGGTGG + Intergenic
1127103365 15:55588637-55588659 CGGCGAGGGAGCGCCGGGCGCGG - Intronic
1128193634 15:65728777-65728799 TAGCCAAAGGGGGCCGGGCGCGG - Intronic
1128303660 15:66583413-66583435 GAGTAAGGGTGGGCCGGGCGCGG - Intronic
1128425768 15:67541536-67541558 TAACCAAGGTTGGCCGGGCGCGG + Intergenic
1129382183 15:75174902-75174924 TGGCCACGGTGGGCCGGGCGCGG + Intergenic
1129410576 15:75348300-75348322 GAGCGAAGCTCGGCCTGGCGCGG - Intronic
1129410785 15:75349185-75349207 AAGCGCAGGTGGGCATGGCGTGG - Exonic
1130527039 15:84716230-84716252 CAGCGAAGGGGCGCGGGGGGCGG - Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1131288855 15:91087197-91087219 GAGTGAAGGTGGGCCAGGCATGG - Intergenic
1132491710 16:235199-235221 CAGCGTAGGTGAGCCGGCCGTGG + Intronic
1133261311 16:4552189-4552211 CAATGAAAGTTGGCCGGGCGCGG + Intergenic
1133729926 16:8570070-8570092 CAGCGTGGCTGGGCAGGGCGAGG - Intronic
1134537891 16:15041330-15041352 CAGAGAAGGTGGGGTGGGAGTGG - Intronic
1134586956 16:15419856-15419878 AAGAAAATGTGGGCCGGGCGCGG - Intronic
1134836967 16:17369458-17369480 CAGCCCAGGTGGGCAGGGTGGGG - Intronic
1135504281 16:23022554-23022576 CAAGCAAGGTGGGCCAGGCGTGG + Intergenic
1135606339 16:23828340-23828362 TAGCTAAGATGGGCCGGGCACGG - Intergenic
1136411385 16:30079476-30079498 AACCGAAGCTAGGCCGGGCGCGG - Intronic
1136488018 16:30585571-30585593 CCGGGTACGTGGGCCGGGCGCGG + Exonic
1136705619 16:32185801-32185823 CATCAAACGTGGGCCGGGTGCGG + Intergenic
1136720556 16:32316553-32316575 CAGAGAAGGGCGGCCGGGCATGG + Intergenic
1136725618 16:32354945-32354967 CAGAGAAGGGCGGCCGGGCATGG + Intergenic
1136762294 16:32743606-32743628 CATCAAACGTGGGCCGGGTGCGG - Intergenic
1136805805 16:33126780-33126802 CATCAAACGTGGGCCGGGTGCGG + Intergenic
1136838936 16:33522835-33522857 CAGAGAAGGGCGGCCGGGCATGG + Intergenic
1136843948 16:33561007-33561029 CAGAGAAGGGCGGCCGGGCATGG + Intergenic
1137725425 16:50653555-50653577 CAGCCAAGGTGAGCCGGGCCTGG - Intergenic
1138212047 16:55171758-55171780 AAGAGAATGTGGGCCCGGCGTGG + Intergenic
1138501399 16:57447273-57447295 GAACGAGGGTGGGCCGGGAGGGG + Intronic
1139542341 16:67627656-67627678 ACACGAAGGTCGGCCGGGCGCGG + Intronic
1140073764 16:71677032-71677054 CAGAGAAAGGGGGCCGGGCACGG - Intronic
1140087292 16:71808611-71808633 CAGAGAAGCTGGGCCAGGAGAGG - Intronic
1141242316 16:82275177-82275199 CAAGAAAGGTAGGCCGGGCGTGG + Intergenic
1141513507 16:84527575-84527597 CAGCGAGGGGGGGCCGGGGCGGG + Intronic
1141662156 16:85447155-85447177 CAGGCAAGGTGGGCCCGGCATGG - Intergenic
1141662829 16:85450737-85450759 TATGTAAGGTGGGCCGGGCGAGG - Intergenic
1141830684 16:86508616-86508638 CAGCGACTGCTGGCCGGGCGCGG - Intergenic
1141987720 16:87590783-87590805 CAGCAAGGGTGGGTGGGGCGGGG + Intergenic
1142292910 16:89201057-89201079 CCGCGGAGAGGGGCCGGGCGGGG - Intronic
1203000813 16_KI270728v1_random:162809-162831 CAGAGAAGGGCGGCCGGGCATGG - Intergenic
1203005876 16_KI270728v1_random:201217-201239 CAGAGAAGGGCGGCCGGGCATGG - Intergenic
1203064451 16_KI270728v1_random:1003925-1003947 CATCAAACGTGGGCCGGGTGCGG - Intergenic
1203132415 16_KI270728v1_random:1699214-1699236 CAGAGAAGGGCGGCCGGGCATGG - Intergenic
1203149099 16_KI270728v1_random:1823122-1823144 CAGAGAAGGGCGGCCGGGCATGG + Intergenic
1203154113 16_KI270728v1_random:1861306-1861328 CAGAGAAGGGCGGCCGGGCATGG + Intergenic
1143630888 17:8139797-8139819 AAGCCAAGGAAGGCCGGGCGCGG + Intergenic
1144092775 17:11872628-11872650 CAGCGAAGGTGGGCCGGGCGCGG + Intronic
1144519632 17:15945196-15945218 TACCGAAGGCGCGCCGGGCGAGG - Exonic
1144606807 17:16673674-16673696 AAACGAAGATAGGCCGGGCGTGG - Intergenic
1145048249 17:19636630-19636652 GAGAAAAGGTGGGCAGGGCGTGG + Intergenic
1146277240 17:31523604-31523626 CAGAGAAGGTGGGCCTTGGGTGG + Exonic
1146433707 17:32822772-32822794 GAGCGGAGGTCGGCCGGGTGCGG - Intronic
1146806705 17:35870758-35870780 TAAAGCAGGTGGGCCGGGCGCGG - Intergenic
1146940200 17:36839236-36839258 CAGTGAAGGAGGGCCAGGTGTGG - Intergenic
1147297836 17:39498511-39498533 AAGAGAAGGATGGCCGGGCGCGG - Intronic
1147693160 17:42330717-42330739 GAGAAAATGTGGGCCGGGCGCGG - Intronic
1147705525 17:42422571-42422593 CAGGGGACGCGGGCCGGGCGCGG + Intronic
1147881551 17:43657475-43657497 AAGCAAGGGTTGGCCGGGCGCGG - Intronic
1147939471 17:44036127-44036149 CAGCGGAGGCAGGCCGGGGGAGG - Exonic
1148057970 17:44812935-44812957 AAGAGAAGTTTGGCCGGGCGTGG - Intronic
1148118947 17:45196335-45196357 CAGGGAAGTTGGGCTGGGAGAGG - Intergenic
1149495789 17:57116486-57116508 AAGTGAAGCTGGGCCAGGCGTGG + Intronic
1149827423 17:59842384-59842406 CAGACAATGTCGGCCGGGCGCGG + Intergenic
1150345779 17:64403735-64403757 CAACAAAAATGGGCCGGGCGCGG - Intronic
1150642820 17:66961110-66961132 CAGTGAATGTAGGCCGGGCACGG + Intergenic
1151359690 17:73581480-73581502 CAGCCAAGCTGGGGCAGGCGGGG - Intronic
1151471845 17:74323317-74323339 AGGGGATGGTGGGCCGGGCGCGG + Intergenic
1151695818 17:75716577-75716599 AAGTGAACGTGGGCTGGGCGCGG + Intergenic
1151796145 17:76347194-76347216 CAGACAGAGTGGGCCGGGCGCGG + Intronic
1151869174 17:76824928-76824950 AAGAGAAAATGGGCCGGGCGCGG + Intergenic
1151979605 17:77500694-77500716 AAGAAAAGGTAGGCCGGGCGCGG + Intergenic
1152351408 17:79785779-79785801 CAGCGTGGGTGGGGCGGGGGTGG + Exonic
1152550897 17:81029582-81029604 CAAGGAAAGTGGGCTGGGCGCGG - Intergenic
1152589196 17:81203099-81203121 CAGCGGGGGTGGACCGAGCGGGG - Intronic
1152636340 17:81431996-81432018 CAGGGCAGGTGGGCAGGGCAGGG + Intronic
1152755280 17:82084603-82084625 CAGGGCAGGTGGGCTGGGCATGG + Exonic
1153127899 18:1818102-1818124 AAGAAAAGCTGGGCCGGGCGCGG + Intergenic
1154157344 18:11954064-11954086 TAGCCTAGGTTGGCCGGGCGCGG - Intergenic
1154189837 18:12220691-12220713 CAGGGAGTTTGGGCCGGGCGCGG - Intergenic
1154274879 18:12949741-12949763 CGGTTAACGTGGGCCGGGCGCGG - Intronic
1154474335 18:14740336-14740358 ATGCTAAGGTCGGCCGGGCGTGG - Intronic
1155322687 18:24634014-24634036 TAAAGAAGCTGGGCCGGGCGCGG - Intergenic
1155937240 18:31766584-31766606 AAGTGAAAGTAGGCCGGGCGCGG - Intergenic
1156138190 18:34070307-34070329 AAGGCAAGGCGGGCCGGGCGCGG - Intronic
1156452600 18:37275100-37275122 CAGCAAGGGTGCGCGGGGCGGGG - Exonic
1157251464 18:46099623-46099645 CGGCGGTGGTGGGCAGGGCGTGG + Intronic
1157343550 18:46802751-46802773 AAGCCAAAGGGGGCCGGGCGCGG + Intergenic
1158076470 18:53536195-53536217 GAGAGAAGCAGGGCCGGGCGCGG + Intergenic
1158178511 18:54685470-54685492 AAGGGAAAGGGGGCCGGGCGCGG + Intergenic
1158586250 18:58737871-58737893 TTGGTAAGGTGGGCCGGGCGTGG - Intronic
1159051399 18:63424027-63424049 AAGCAAAGATGGGCCGGGCGTGG + Intergenic
1159699526 18:71607554-71607576 CAGCTAATCTCGGCCGGGCGCGG - Intergenic
1159931646 18:74318498-74318520 CAGCTTAAGAGGGCCGGGCGTGG + Intronic
1160140539 18:76317849-76317871 CAGTAAAGAGGGGCCGGGCGTGG + Intergenic
1160193176 18:76732154-76732176 AGGAAAAGGTGGGCCGGGCGCGG - Intergenic
1160335640 18:78036200-78036222 AAGCCAAAGAGGGCCGGGCGCGG - Intergenic
1160685650 19:435319-435341 CAGCGACTGTGGGCCAGGTGGGG - Intronic
1160698546 19:495841-495863 AAGTGCAGGCGGGCCGGGCGCGG + Intronic
1160919078 19:1511595-1511617 CAGTGATGGTGGGGAGGGCGGGG - Intronic
1160958608 19:1706848-1706870 AAGCAGAGGGGGGCCGGGCGCGG + Intergenic
1160963147 19:1733590-1733612 CAGCGTCTGTGGGCCTGGCGGGG - Intergenic
1160989122 19:1853419-1853441 CAGGGAAGCAGGGCCGGGCCAGG + Exonic
1161038200 19:2096817-2096839 CTGCGCTGGTGGGGCGGGCGGGG + Intronic
1161139057 19:2637223-2637245 CAGCAAAGACGGGCCGGGCTCGG - Intronic
1161306437 19:3571806-3571828 AAGAGGAAGTGGGCCGGGCGTGG + Intronic
1161319182 19:3633188-3633210 AGGTGAAGGTGGGCGGGGCGAGG + Intronic
1161376526 19:3941929-3941951 CAGCAAGAGGGGGCCGGGCGCGG - Intronic
1161415078 19:4141932-4141954 AAATGAAGGTTGGCCGGGCGTGG - Intergenic
1161417485 19:4155644-4155666 AAAAGAAAGTGGGCCGGGCGCGG - Intronic
1161562350 19:4980716-4980738 GAGACAAAGTGGGCCGGGCGCGG - Intronic
1161713947 19:5865128-5865150 GAGTGAAGGTGGGCAGGGCTGGG - Intergenic
1161757155 19:6142460-6142482 TAGTGAAAGTGGGCCGGGTGCGG + Intronic
1161834800 19:6638570-6638592 AAGCGTGGGAGGGCCGGGCGCGG + Intergenic
1162465321 19:10836117-10836139 CAGTGGAGGTGGGAGGGGCGGGG - Exonic
1162675985 19:12298697-12298719 AAGACAATGTGGGCCGGGCGCGG + Intergenic
1162716280 19:12636486-12636508 GAGACAAGGTTGGCCGGGCGCGG - Intronic
1163023111 19:14494380-14494402 CAGGCAAGGGGGCCCGGGCGCGG - Intronic
1163051502 19:14688149-14688171 CAAAGAAGTTGGGCCGGGCGGGG - Intronic
1163117338 19:15196341-15196363 CTGCGAAGGTGGGGCGGGATGGG - Intronic
1163306711 19:16484465-16484487 CATCGAGAGTTGGCCGGGCGTGG - Intronic
1163407094 19:17129537-17129559 CAGGGCAGGTGGGCAGGGCATGG + Intronic
1163856127 19:19703671-19703693 AAGTGAAGGAGAGCCGGGCGCGG - Intergenic
1164674047 19:30090218-30090240 CAGCTAAGGTGGGCAGGGTGGGG - Intergenic
1165172058 19:33900539-33900561 CCGAGAAGATGGGCCGGGTGTGG + Intergenic
1165809522 19:38603691-38603713 TAGCCAAGCTGGGCCGGGCGCGG + Intronic
1166109513 19:40613678-40613700 CAGTGAGGGGGGGCGGGGCGTGG + Intronic
1166791692 19:45402601-45402623 CAAGGGAGCTGGGCCGGGCGGGG + Intronic
1166873898 19:45885911-45885933 CGGGGAAGGGGGGCCGGGCCTGG - Exonic
1166880317 19:45925661-45925683 ATGCAAAGGTCGGCCGGGCGCGG - Intergenic
1167115567 19:47487451-47487473 CAGGGACGGTGGGCCTGGGGAGG - Intergenic
1167196289 19:48031247-48031269 CAGCTATTGTTGGCCGGGCGCGG + Intronic
1167311202 19:48738945-48738967 CAGCGAAGGTGAGCGGCGGGCGG - Exonic
1167416663 19:49376967-49376989 CAGCCAAACTTGGCCGGGCGTGG - Intergenic
1167592738 19:50413357-50413379 CAGTGAACGTGGGCCGGCGGGGG - Intronic
1167625872 19:50588810-50588832 TAGGGAAAGTAGGCCGGGCGCGG + Intergenic
1167741722 19:51327910-51327932 CCGGGAAGGTGGGCGGGGCCGGG + Intronic
1168019287 19:53597026-53597048 AAGCAAAGATAGGCCGGGCGCGG - Intergenic
1168028800 19:53663603-53663625 TAGGGTAGATGGGCCGGGCGCGG + Intergenic
1168356913 19:55706359-55706381 AAGTGAAAGAGGGCCGGGCGTGG + Intronic
1168536405 19:57174029-57174051 CACCTGAGGTGGGCCGGGCGCGG - Intergenic
1168536423 19:57174101-57174123 CACCTGAGGTGGGCCCGGCGTGG - Intergenic
1168536442 19:57174173-57174195 CACCTGAGGTGGGCCGGGCGCGG - Intergenic
925915655 2:8603589-8603611 AAGGGAAGGAGGGCTGGGCGTGG + Intergenic
925995816 2:9292248-9292270 CAGAGAAAGTAGGCTGGGCGTGG + Intronic
927189654 2:20508915-20508937 CACTGGAGGTGGGCCGGGCGTGG - Intergenic
928098883 2:28423319-28423341 CAGGAAAGGTGGGCGGGGGGAGG + Intergenic
928129866 2:28641743-28641765 CTTCGAAGGTGGGCCAGGCAAGG - Intronic
928576980 2:32665135-32665157 CACAGAATGTGGGCTGGGCGTGG - Intronic
928908280 2:36391416-36391438 AATCAAAAGTGGGCCGGGCGCGG - Intronic
929819194 2:45259743-45259765 AAGGGAAGGTGGGCAGGGCCAGG + Intergenic
930172800 2:48268517-48268539 GAGAGAAAGTGGGCTGGGCGTGG - Intergenic
931847568 2:66220434-66220456 AAGCAAAGATTGGCCGGGCGCGG + Intergenic
932267036 2:70376624-70376646 AAGAAAATGTGGGCCGGGCGCGG - Intergenic
932763944 2:74458494-74458516 CAGCGAAGATGGGCCGGGCAGGG + Exonic
933866080 2:86519081-86519103 AAGCAAAGGAGGGCCGGGCACGG + Intronic
933909995 2:86930841-86930863 CAGCGAAGATGGGCCGGGCAGGG - Intronic
934022730 2:87972547-87972569 CAGCGAAGATGGGCCGGGCAGGG + Intergenic
934923834 2:98367482-98367504 CAGCTGAGGTCAGCCGGGCGGGG - Intronic
935171141 2:100612379-100612401 CAGGGAAGGTGGCCGAGGCGTGG + Intergenic
935219947 2:101003434-101003456 CGGCCAAGGTGGGCCAGGTGTGG - Intronic
935728906 2:106048484-106048506 AAAAGAAGGTGGGCCGGGTGTGG - Intergenic
935987176 2:108686479-108686501 AAGTGTAAGTGGGCCGGGCGTGG + Exonic
936095296 2:109526600-109526622 AAGAGGAGGTGAGCCGGGCGTGG - Intergenic
936346383 2:111678627-111678649 CAGGGAAGGGGGGCGGGGGGAGG - Intergenic
937216095 2:120314589-120314611 GAGGGAAGGAGGGCCGGGGGAGG - Intergenic
937330694 2:121026469-121026491 GAAGGAGGGTGGGCCGGGCGCGG - Intergenic
937787569 2:125920626-125920648 AAGCAAATGTGGGCCGGGCGCGG + Intergenic
937791163 2:125963283-125963305 CAACAAAAATGGGCCGGGCGTGG - Intergenic
937952065 2:127396164-127396186 AAGAAAATGTGGGCCGGGCGCGG + Intergenic
937977834 2:127592657-127592679 CAGTGGGGGTGGGCGGGGCGGGG + Intronic
937984955 2:127634282-127634304 CAGACAAGGTGGGCCGGGCTGGG + Exonic
938296303 2:130181689-130181711 AAGCGAAGGCCGGCCGGGCGGGG + Exonic
938486403 2:131713908-131713930 GAGCTAAGCAGGGCCGGGCGTGG - Intergenic
938785141 2:134621598-134621620 AACCCAATGTGGGCCGGGCGTGG + Intronic
939067619 2:137503734-137503756 AAGAGAAAGTGAGCCGGGCGCGG + Intronic
939392493 2:141586650-141586672 GAGAGAAAGGGGGCCGGGCGCGG + Intronic
939987005 2:148839387-148839409 AAGAGAAAATGGGCCGGGCGCGG - Intergenic
940893957 2:159062675-159062697 AAGCAAAGCTCGGCCGGGCGCGG + Intronic
941018009 2:160378927-160378949 CAGTTAATGTGGGCCGGACGTGG + Intronic
941381873 2:164803273-164803295 AAGCAAAGTTTGGCCGGGCGCGG + Intronic
942004881 2:171687960-171687982 CCCCAAAGCTGGGCCGGGCGGGG - Intronic
942430020 2:175900760-175900782 AATCGAGTGTGGGCCGGGCGCGG + Intergenic
943868179 2:192956220-192956242 TAGTGAAGGATGGCCGGGCGTGG - Intergenic
945935332 2:215897974-215897996 CAGAGAGGGTTGGCCAGGCGCGG - Intergenic
946217872 2:218199707-218199729 TAGCCAAGGTGGGCTGGGAGTGG + Intergenic
946397272 2:219449243-219449265 CAGGGGAGGTGGGCCGGGCCCGG - Exonic
946845483 2:223855198-223855220 AAGCAATGGTGGGCCGGGCATGG + Intergenic
947597100 2:231419794-231419816 ATACGAAAGTGGGCCGGGCGCGG + Intergenic
947635959 2:231680936-231680958 GAGCGCAGCTGGGCCGGGGGTGG + Intergenic
947868534 2:233418835-233418857 CAGAGCTGGTGGGCTGGGCGGGG + Intronic
948423027 2:237872184-237872206 CAGCCAAGGAGGGCCTGGCACGG + Intronic
948804516 2:240447699-240447721 CAGCGACTGTGGGCAGGGCCAGG - Intronic
1168757601 20:327248-327270 CAGAGAAGGCGGGCCGGGCGAGG - Exonic
1168832360 20:853553-853575 CAGAGAAGGTGGGTGGGGCTGGG + Intronic
1169314042 20:4573262-4573284 AAGTGAAGAGGGGCCGGGCGAGG - Intergenic
1169706690 20:8514146-8514168 CAGCCTGGGTGGGCCGGGCATGG + Intronic
1170019852 20:11825161-11825183 TAGCGTAGCTCGGCCGGGCGCGG - Intergenic
1170577499 20:17675532-17675554 CAGAGAAGGGGGGCAGGGAGTGG + Intronic
1170751277 20:19147900-19147922 CAGCCAAGGGCGGCCGGGCGCGG - Intergenic
1172244404 20:33435902-33435924 ATGAGGAGGTGGGCCGGGCGCGG + Intronic
1172657350 20:36545205-36545227 CAGGGAAACTGGGCCGGGCGCGG + Intronic
1172719284 20:36986975-36986997 CAGCAAAAGTGGGCCGGGTGCGG + Intergenic
1172772185 20:37388280-37388302 CAGGGAGGGTGGGCTGGGGGAGG + Intronic
1173548073 20:43914615-43914637 CAGGGATGCAGGGCCGGGCGGGG + Intergenic
1174049617 20:47758603-47758625 CAGCGAAGGTGGGTGCGGGGAGG + Intronic
1174204345 20:48828031-48828053 CAGCGCGCGGGGGCCGGGCGAGG + Intergenic
1174393065 20:50229756-50229778 AAGCGAAGATAGGCCGGGTGCGG + Intergenic
1174419558 20:50390836-50390858 CAGGGTAGGTGGACGGGGCGTGG - Intergenic
1174539965 20:51281522-51281544 TAGTGAGGGTGGGCCTGGCGTGG - Intergenic
1174615413 20:51831699-51831721 AAGAGAAGCTGGGCCGGGCGCGG - Intergenic
1175152400 20:56945577-56945599 AAGAAAAGGGGGGCCGGGCGTGG + Intergenic
1175727358 20:61328463-61328485 CAGCAATTTTGGGCCGGGCGCGG - Intronic
1176084021 20:63287783-63287805 CAGCGACGGCGGGGAGGGCGGGG + Exonic
1176164774 20:63667127-63667149 AAGCAGAGCTGGGCCGGGCGCGG - Intronic
1176302074 21:5103165-5103187 AAGGAAATGTGGGCCGGGCGTGG + Intergenic
1177539404 21:22472076-22472098 AAGCCAGTGTGGGCCGGGCGCGG + Intergenic
1178518214 21:33266354-33266376 CAGCGGAGATGGGCGGGGCGGGG - Exonic
1178865077 21:36320356-36320378 AAGCGAAGGGGGGCCGGCAGTGG + Intronic
1178974970 21:37213668-37213690 CTGGGCATGTGGGCCGGGCGCGG + Intergenic
1179465100 21:41566768-41566790 CAGCCCAGGTGAGCCAGGCGTGG + Intergenic
1179667430 21:42922448-42922470 GAGTGAAGGAAGGCCGGGCGCGG + Intergenic
1179854955 21:44158735-44158757 AAGGAAATGTGGGCCGGGCGTGG - Intergenic
1180109533 21:45641739-45641761 AAGGGAAGGTGGGCCGGGCGCGG - Intergenic
1180593736 22:16960790-16960812 CAGGGAAGGAGGGCAGGGCCAGG - Intergenic
1180724631 22:17937371-17937393 CAAAAAAGATGGGCCGGGCGTGG + Intronic
1181952341 22:26563617-26563639 GAGGGAGGGAGGGCCGGGCGTGG - Intronic
1182278631 22:29205841-29205863 CAGCGCAGAGGGGCCGGGCGAGG + Exonic
1182451152 22:30422676-30422698 CAGCGAAGCTGGGGGTGGCGGGG + Exonic
1183041581 22:35183057-35183079 CAGTGATGGTGGGCTGGGTGTGG - Intergenic
1183200920 22:36385708-36385730 CAGCGCAGGTGGGCAGAGCCAGG - Intronic
1183205845 22:36418442-36418464 TAGCGACTGGGGGCCGGGCGCGG + Intergenic
1183655174 22:39180259-39180281 AAGGCAAGGAGGGCCGGGCGCGG + Intergenic
1184043682 22:41958863-41958885 CAGCGAAGGGGGGCGGGGTGAGG - Intergenic
1184389686 22:44196257-44196279 CAGCGCAGGTGGGCAGTGGGTGG - Intronic
1184520462 22:44991028-44991050 CCTGGAAGGTGGGCAGGGCGGGG - Intronic
1184645086 22:45891165-45891187 CCGCGGAGGTGGGGCCGGCGGGG - Intergenic
1203255551 22_KI270733v1_random:135731-135753 GAGCGGAGGTCGGCCGGGTGCGG - Intergenic
951543936 3:23806925-23806947 AGGCGAAGGAGGGCAGGGCGGGG - Intronic
952706212 3:36380459-36380481 CCGGGGAGGTGGGCAGGGCGGGG + Exonic
953378701 3:42450193-42450215 AAGCTACCGTGGGCCGGGCGCGG + Intergenic
953944934 3:47138260-47138282 AAAAGAAAGTGGGCCGGGCGCGG - Intronic
953948033 3:47165202-47165224 AACTGAAAGTGGGCCGGGCGCGG + Intergenic
954476443 3:50750616-50750638 AAGCAAAGGTAGGCCAGGCGCGG - Intronic
954567618 3:51611844-51611866 GAGAGAAGGTAGGCCAGGCGCGG - Intronic
955188009 3:56733313-56733335 CAGGCGAGGTGGGCGGGGCGGGG + Intronic
955887985 3:63620631-63620653 AAGGGAAGGCTGGCCGGGCGCGG - Intergenic
955910496 3:63854716-63854738 AAGAAAAGGAGGGCCGGGCGCGG + Intronic
956080594 3:65551588-65551610 AAAGGAAAGTGGGCCGGGCGTGG - Intronic
956175330 3:66467649-66467671 TAGCTAATGTGGGCTGGGCGTGG - Intronic
956974712 3:74566293-74566315 AAGCGAAGGTGGCCTGGGGGTGG - Intergenic
958072290 3:88629822-88629844 CAGGGAGAATGGGCCGGGCGCGG + Intergenic
958710900 3:97716276-97716298 AAGAAAAGATGGGCCGGGCGCGG + Intronic
960689833 3:120334212-120334234 TATAAAAGGTGGGCCGGGCGTGG + Intronic
960914359 3:122681181-122681203 TAGCGGAGGTGGCCGGGGCGGGG + Intronic
961967264 3:130918699-130918721 CAGCAGCAGTGGGCCGGGCGCGG + Intronic
962266305 3:133946822-133946844 GATCAAAAGTGGGCCGGGCGGGG + Intronic
962860008 3:139390447-139390469 CCTCAAAGTTGGGCCGGGCGCGG + Intergenic
965137773 3:164795014-164795036 AGGCAAAGATGGGCCGGGCGCGG - Intergenic
965874986 3:173305777-173305799 AAATGAAGGTGGGCCGGGCGCGG - Intergenic
966146135 3:176814033-176814055 AAGGGAAGGTGGGCTGGGCGCGG - Intergenic
966615804 3:181911236-181911258 AAAGGAAGGGGGGCCGGGCGCGG - Intergenic
966657781 3:182378863-182378885 CAGCAAAACCGGGCCGGGCGCGG - Intergenic
966731600 3:183156067-183156089 CACAGATGTTGGGCCGGGCGCGG + Intronic
966830856 3:184007308-184007330 AAGCAGAAGTGGGCCGGGCGTGG - Intronic
966970475 3:185040910-185040932 AAGCCAAGGTTGGCCAGGCGCGG + Intronic
967014760 3:185471748-185471770 GAGTAAAGGTCGGCCGGGCGTGG - Intronic
968216080 3:196892078-196892100 GAGTCAAGGTCGGCCGGGCGCGG - Intronic
968259510 3:197308461-197308483 TAGTGAAGCTGGGCCGGGCGTGG - Intergenic
968497582 4:927139-927161 GAGCGCAGGTGAGCCGGGAGGGG - Intronic
968497617 4:927250-927272 GAGCGCAGGTGAGCCGGGAGGGG - Intronic
968503301 4:961002-961024 CAGGGGAGGTGGGCCGGGCTGGG - Intronic
968620634 4:1601984-1602006 CAGTGGAGGTGGGCCGGGGGAGG + Intergenic
968643037 4:1724260-1724282 CAGCCAAGGCCGGCCGGGCGTGG - Intronic
970737912 4:19196026-19196048 CAGTGAAGGGGGGCCGGGGATGG + Intergenic
972218202 4:36921116-36921138 GAGAAAATGTGGGCCGGGCGTGG + Intergenic
972595144 4:40523358-40523380 CAGCCATGGTAGGCCGGGCGTGG + Intronic
972608684 4:40637093-40637115 TAGCGAGGCAGGGCCGGGCGCGG + Intergenic
972868718 4:43269054-43269076 TAGCAAAGATGGGCCAGGCGCGG + Intergenic
974001976 4:56520919-56520941 AAGAGAGGTTGGGCCGGGCGTGG + Intronic
975049555 4:69843124-69843146 AAAAGAAGGTGGGCTGGGCGCGG - Intronic
975583044 4:75923826-75923848 AAGGGAAGATGGGCCGGGCGCGG - Intronic
976496849 4:85739914-85739936 GATTGAACGTGGGCCGGGCGCGG - Intronic
976742685 4:88373130-88373152 TGGTGAAAGTGGGCCGGGCGCGG - Intergenic
978691553 4:111518828-111518850 CAGAGCAGATGGGCTGGGCGTGG + Intergenic
979861349 4:125697473-125697495 GAACAAAGCTGGGCCGGGCGCGG + Intergenic
982068547 4:151675200-151675222 CCGAGAAGGAGGGCCAGGCGGGG + Intronic
982981442 4:162141403-162141425 GAGAGAAGGGAGGCCGGGCGCGG - Intronic
983849919 4:172568464-172568486 TAACAAAGATGGGCCGGGCGCGG + Intronic
984384327 4:179035688-179035710 AAGAAAATGTGGGCCGGGCGCGG + Intergenic
984424617 4:179566840-179566862 CACAAAAGGTTGGCCGGGCGTGG - Intergenic
984582088 4:181521804-181521826 AAGCCAATGTGGGCCGGGTGTGG + Intergenic
984762659 4:183376502-183376524 CAACGTGGGTGAGCCGGGCGGGG - Intergenic
984889918 4:184482698-184482720 AAGGAAATGTGGGCCGGGCGCGG - Intergenic
985054630 4:186025642-186025664 CAGCCAGGATGGGCCGGGTGCGG + Intergenic
985229053 4:187795545-187795567 CAGCAAAGGTGGGACTGGCATGG + Intergenic
985643268 5:1073618-1073640 CCGAGGAGGTGGGCCGGGCGGGG - Exonic
985643339 5:1073866-1073888 CAGGGCAGATGGGACGGGCGGGG + Intronic
987302403 5:16608168-16608190 CAGTGAGAGTGGGCCGGGCACGG - Intronic
987386201 5:17332002-17332024 AAGTGTAGGTGGGCCGGGCGCGG + Intergenic
987805510 5:22760388-22760410 AAGCGTAAATGGGCCGGGCGCGG + Intronic
988325950 5:29768326-29768348 AAGAGCAGGTAGGCCGGGCGCGG + Intergenic
988640696 5:33038182-33038204 AAGCTATGGTGGGCCGGGCACGG + Intergenic
989282953 5:39665702-39665724 CACCGAGGGTGGGCTAGGCGTGG - Intergenic
990841951 5:60091760-60091782 AAGAAAATGTGGGCCGGGCGCGG + Intronic
992088621 5:73299152-73299174 GAGCGCCGGCGGGCCGGGCGGGG - Intergenic
993350430 5:86843507-86843529 AAGAGAATGTTGGCCGGGCGCGG + Intergenic
993978789 5:94516511-94516533 AAGAAAACGTGGGCCGGGCGCGG + Intronic
994343607 5:98660956-98660978 CAGGCACTGTGGGCCGGGCGTGG - Intergenic
995171949 5:109124754-109124776 GATAGAAGTTGGGCCGGGCGCGG + Intronic
996317123 5:122172741-122172763 GAACAAATGTGGGCCGGGCGCGG + Intronic
996571674 5:124938816-124938838 AATCAAAGGTTGGCCGGGCGTGG + Intergenic
996717936 5:126602235-126602257 CAGGGAAGCTGGGCCGGGCGCGG - Intronic
996778637 5:127159887-127159909 TAGCCATGCTGGGCCGGGCGCGG + Intergenic
997595508 5:135104565-135104587 TAGCTAAGGTGGGCCGGGCACGG - Intronic
998262059 5:140639336-140639358 CGGGGACGGTGGGCGGGGCGAGG - Intronic
998469634 5:142373725-142373747 AATCTAAGGTGGGCCAGGCGTGG + Intergenic
1000826964 5:166057089-166057111 AAGAAAATGTGGGCCGGGCGCGG + Intergenic
1001617970 5:173057269-173057291 TGCCGGAGGTGGGCCGGGCGGGG + Intronic
1001954412 5:175838546-175838568 GACAGAAGGGGGGCCGGGCGCGG - Intronic
1002336716 5:178484531-178484553 CAGTGAGGCCGGGCCGGGCGTGG + Intronic
1002400935 5:178991292-178991314 CAGGGAAGGTGGGGGGTGCGGGG + Intronic
1002649064 5:180678489-180678511 AAGTGGAGTTGGGCCGGGCGCGG + Intergenic
1002822262 6:736628-736650 AAGCACAGCTGGGCCGGGCGCGG - Intergenic
1002980974 6:2137622-2137644 AAGGGAATATGGGCCGGGCGCGG - Intronic
1003044496 6:2720870-2720892 AAGAGAATGTGGGCTGGGCGTGG + Intronic
1003288945 6:4761630-4761652 TGGGGAAAGTGGGCCGGGCGTGG - Intronic
1003545090 6:7052100-7052122 CAGCGGAGTTGGGCTGGGGGCGG + Intergenic
1004268024 6:14166304-14166326 AAATGAAGGTAGGCCGGGCGCGG + Intergenic
1005303795 6:24495111-24495133 CAGCGGAGCTGGGCCGGGCCGGG - Exonic
1005796175 6:29364506-29364528 GAACAAAGCTGGGCCGGGCGCGG + Intronic
1006177405 6:32130731-32130753 AAAAAAAGGTGGGCCGGGCGCGG + Intergenic
1006338847 6:33434812-33434834 AAGAGTAGGGGGGCCGGGCGCGG + Intronic
1006674298 6:35751200-35751222 CAGTGAATGAGGGCTGGGCGTGG - Intergenic
1006877720 6:37313197-37313219 CAGCAATGGTGGGTCGGGCACGG + Intronic
1008346395 6:50432677-50432699 CAGGGAAGGTTGGCCAGGCGTGG + Intergenic
1009413583 6:63393467-63393489 AAGGGAAGATGGGCCAGGCGCGG - Intergenic
1009964686 6:70566153-70566175 AAGAGAAAGTGGGCCGGGCAAGG - Intergenic
1012438780 6:99242469-99242491 CAGCGAAGGTGGCCTGAGCTGGG + Intergenic
1012875463 6:104720927-104720949 GAGCGTCGCTGGGCCGGGCGCGG - Intergenic
1015528570 6:134197533-134197555 AAGCAAAAGTAGGCCGGGCGTGG + Intronic
1015559150 6:134496212-134496234 CAGCAGTGGAGGGCCGGGCGCGG + Intergenic
1015695263 6:135972822-135972844 CAGCTAAGGTGGGTTGGGAGTGG + Intronic
1015880579 6:137867062-137867084 CAGGGAAAGGGGGCGGGGCGGGG + Intergenic
1017632454 6:156410247-156410269 CATCAATGGCGGGCCGGGCGAGG + Intergenic
1017659708 6:156661958-156661980 TAGCGAAGGTGGGGCGAGAGAGG - Intergenic
1018678993 6:166247678-166247700 AAGAGAATGTGGTCCGGGCGCGG - Intergenic
1018683525 6:166284252-166284274 CAGAGACGCTGGGCCGGGTGAGG - Intergenic
1018790441 6:167143938-167143960 CAGCAAAGGTGGACCTGGCCTGG + Intergenic
1018986173 6:168638686-168638708 CTGCGAAGGTGCCCCGGGCTGGG + Intronic
1019082774 6:169446355-169446377 CAGGGAAGGTGGGCAGGGGCCGG + Intergenic
1019082791 6:169446399-169446421 CAGGGAAGGTGGGCAGGGGCCGG + Intergenic
1019168180 6:170112886-170112908 CAGAGAAGGTGGGATGGGAGTGG - Intergenic
1019984266 7:4643715-4643737 AAGAGAAGGTAGGCCGGGCGCGG + Intergenic
1021591827 7:22272051-22272073 AAGGAAAGTTGGGCCGGGCGCGG + Intronic
1021959320 7:25856959-25856981 CAGCGAAGGTGGTGGTGGCGGGG - Intergenic
1022008957 7:26292260-26292282 CAGCCGAGGTGTGCCGGGCAGGG + Intronic
1022462721 7:30626639-30626661 CAGGGAATGAGGGCCAGGCGTGG - Intronic
1023972425 7:45000639-45000661 CAGAGGAAGTGGGCCCGGCGAGG + Intronic
1024254721 7:47532064-47532086 CAGGGATGGTGGGCGGGGGGGGG - Intronic
1024325187 7:48103927-48103949 CAAAGATGGTTGGCCGGGCGCGG + Intronic
1026769105 7:73182572-73182594 CATAGAATGGGGGCCGGGCGCGG - Intergenic
1026901576 7:74040286-74040308 CAGCGCAGGTGGGTCTGGCCCGG + Intronic
1027009974 7:74735957-74735979 CATAGAATGGGGGCCGGGCGCGG - Intronic
1027078067 7:75210080-75210102 CATAGAATGGGGGCCGGGCGCGG + Intergenic
1027198577 7:76048172-76048194 CAGCGCTGGCAGGCCGGGCGAGG - Exonic
1027543714 7:79500262-79500284 CAGAAAGGGAGGGCCGGGCGCGG - Intergenic
1027988286 7:85323342-85323364 AAGGGAAAGTGGGCCCGGCGCGG - Intergenic
1028151934 7:87383785-87383807 AAGAAAATGTGGGCCGGGCGTGG - Intronic
1030208038 7:106969577-106969599 GATGGAAGGTGGGCCGGGCGTGG + Intergenic
1030292150 7:107883490-107883512 GAGTGAGGGCGGGCCGGGCGCGG + Intergenic
1030694578 7:112570699-112570721 CAGGGAGTTTGGGCCGGGCGCGG - Intergenic
1031908623 7:127489403-127489425 AAGAAAATGTGGGCCGGGCGTGG - Intergenic
1032019484 7:128399077-128399099 AAGCGAAAGTTGGCCGGGTGTGG + Intronic
1032125194 7:129188593-129188615 CGGCGCAGGGGGGCCGGGCTTGG + Intergenic
1032134176 7:129259784-129259806 CAGCTGAGGTTGGCCAGGCGAGG + Intronic
1033057518 7:138072846-138072868 AAGAAAAGGTGGGCCAGGCGTGG + Intronic
1034095716 7:148405940-148405962 TAAAGAAGGTCGGCCGGGCGCGG + Intronic
1034177536 7:149111970-149111992 TAGCAAATGTGGGCTGGGCGTGG - Intronic
1034546565 7:151793564-151793586 CAGGCAAGGTGGGCAGGACGGGG - Intronic
1035842104 8:2824413-2824435 GAGCTAATGTGGGCCGGGTGTGG - Intergenic
1035870217 8:3129696-3129718 CTGTGGAGCTGGGCCGGGCGGGG + Intronic
1036163050 8:6406782-6406804 CAGCGAGGGAGGGGCGAGCGGGG - Intronic
1036213296 8:6859986-6860008 AAGAGAACCTGGGCCGGGCGCGG - Intergenic
1036800649 8:11788645-11788667 CAAAGAATGTGGGCCAGGCGTGG + Intergenic
1036850609 8:12198274-12198296 AAGAGAATGAGGGCCGGGCGTGG + Intergenic
1036871974 8:12440539-12440561 AAGAGAATGAGGGCCGGGCGTGG + Intergenic
1037756477 8:21713307-21713329 CAGCTACGGTGGGTGGGGCGGGG - Intronic
1038304112 8:26383517-26383539 CAGCGGAGCCGGGCGGGGCGGGG + Intronic
1039238092 8:35525095-35525117 CAGCGGAGGCAGGCCGGGGGAGG - Intronic
1040027215 8:42792814-42792836 AAGGGAAGGTGGGCCAGGCGCGG + Intronic
1041405839 8:57498257-57498279 CAAAAAAGGGGGGCCGGGCGTGG - Intergenic
1041726913 8:61026584-61026606 CAGCTAAGTTGGGCAGGGCCAGG - Intergenic
1043536920 8:81215269-81215291 TAGAGCACGTGGGCCGGGCGAGG + Intergenic
1044841978 8:96344650-96344672 AAGAGAATTTGGGCCGGGCGTGG - Intergenic
1045343456 8:101274102-101274124 CAGTGAAGATGGGCCGGGCATGG - Intergenic
1045389845 8:101704624-101704646 AAGTGAATGGGGGCCGGGCGCGG + Intronic
1046377051 8:113397528-113397550 CAAAGACTGTGGGCCGGGCGCGG + Intronic
1047316750 8:123741669-123741691 TGGAGAATGTGGGCCGGGCGTGG + Intergenic
1047459765 8:125051595-125051617 AAAGGAAGGAGGGCCGGGCGTGG + Intronic
1047704850 8:127487703-127487725 CAGTGAATTAGGGCCGGGCGCGG - Intergenic
1048350436 8:133611567-133611589 GAAAGGAGGTGGGCCGGGCGCGG + Intergenic
1049463990 8:142742822-142742844 CAGGGAAGGGGTGCCAGGCGGGG - Intergenic
1049932437 9:470138-470160 CAGCAGTGGTGGGACGGGCGGGG + Intergenic
1050815935 9:9811415-9811437 CAAAGAAAGTGGGCCAGGCGCGG + Intronic
1051193629 9:14539426-14539448 TAGGGAAATTGGGCCGGGCGCGG + Intergenic
1052016083 9:23469512-23469534 TAGCGGGGGAGGGCCGGGCGTGG + Intergenic
1052920723 9:33965756-33965778 CAGGGAGTGTGGGCCGGGTGCGG + Intronic
1053345395 9:37374489-37374511 AATCTCAGGTGGGCCGGGCGCGG - Intergenic
1053585550 9:39454709-39454731 CAGTAAAGTTGGGCCAGGCGTGG - Intergenic
1054580762 9:66910516-66910538 CAGTAAAGTTGGGCCAGGCGTGG + Intronic
1056341866 9:85642620-85642642 GAGGGGAGATGGGCCGGGCGTGG - Intronic
1057502171 9:95604505-95604527 AAGAAAATGTGGGCCGGGCGTGG - Intergenic
1057533142 9:95873019-95873041 CAGAAAATGAGGGCCGGGCGCGG + Intergenic
1058157893 9:101535195-101535217 AAGTCAAGGCGGGCCGGGCGCGG - Intronic
1058452666 9:105111805-105111827 CAGCAGAAGTGGGCCGGGCGCGG + Intergenic
1059633188 9:116147016-116147038 CACAGAGGGTAGGCCGGGCGCGG + Intergenic
1059903337 9:118953403-118953425 AAATGAAGGTAGGCCGGGCGCGG - Intergenic
1060175743 9:121496438-121496460 AATAGAAGGTAGGCCGGGCGTGG + Intergenic
1060346432 9:122820691-122820713 CAGTTAATATGGGCCGGGCGCGG + Intronic
1060760448 9:126243064-126243086 CAACGAAAATTGGCCGGGCGCGG - Intergenic
1060835915 9:126755102-126755124 CAGCAAAGGTGGGGCGTGGGTGG + Intergenic
1060971930 9:127743210-127743232 CAGTTACGGTCGGCCGGGCGGGG + Intronic
1061060767 9:128249364-128249386 TAGCGGGGGTTGGCCGGGCGCGG + Intronic
1061095837 9:128456411-128456433 CCGCGCCGGTGGGCGGGGCGGGG - Exonic
1061186720 9:129059284-129059306 CAGTGCAGGTGGGGTGGGCGTGG + Intronic
1061611145 9:131746857-131746879 TGACTAAGGTGGGCCGGGCGTGG + Intergenic
1061683975 9:132259622-132259644 CTTCGAAGAGGGGCCGGGCGCGG + Intergenic
1061695065 9:132367281-132367303 CAGCTACAGTGGGCTGGGCGCGG + Intergenic
1061703917 9:132437799-132437821 ATGCAAAAGTGGGCCGGGCGCGG - Intronic
1062084424 9:134641567-134641589 GAGCGGACGTGGGGCGGGCGCGG - Intergenic
1062121582 9:134836680-134836702 CAGCGATGCTGGGCAGGGGGAGG - Intronic
1062305866 9:135906985-135907007 CGGCCGAGGTGGGCCGGGTGAGG - Exonic
1062341294 9:136094964-136094986 CCGCGGAGGGGGGCCGGGCGGGG - Intronic
1203471947 Un_GL000220v1:118866-118888 GAGCGGAGGTCGGCCGGGTGCGG - Intergenic
1186453305 X:9691143-9691165 CATCAGAGGTAGGCCGGGCGTGG + Intronic
1186769579 X:12804430-12804452 ATGCAAAGGTGGGCCAGGCGCGG - Intronic
1188205061 X:27345831-27345853 AAGAAAATGTGGGCCGGGCGTGG + Intergenic
1188799823 X:34515725-34515747 AAGAAAATGTGGGCCGGGCGCGG + Intergenic
1189344941 X:40233565-40233587 CAGATGAGGTTGGCCGGGCGCGG + Intergenic
1189455704 X:41187121-41187143 CACCGAATCTGGGCCGGGCATGG - Intronic
1189818559 X:44847811-44847833 GAGTCAAGGAGGGCCGGGCGCGG - Intergenic
1191773342 X:64785792-64785814 AAGACAAGGGGGGCCGGGCGCGG - Intergenic
1192281368 X:69689623-69689645 GAACAAAGTTGGGCCGGGCGCGG - Intronic
1194205478 X:91006139-91006161 GAGAGAAAATGGGCCGGGCGCGG - Intergenic
1196915599 X:120531748-120531770 CAGTGAAGGTGGGCCAGGTACGG - Intronic
1198403618 X:136291053-136291075 AAGCAAGGGTTGGCCGGGCGCGG - Intergenic
1199846541 X:151695724-151695746 CAGCGAAGGTGGGCGAGGACAGG + Intronic
1200161957 X:154014114-154014136 CAGCTCAGGTGGGCAGGGCCCGG + Exonic
1201014513 Y:9586713-9586735 GAGGAAAGGTGGGCCGGGTGCGG + Intergenic
1202577652 Y:26344858-26344880 GGGCGAAGGACGGCCGGGCGCGG + Intergenic