ID: 1144092975

View in Genome Browser
Species Human (GRCh38)
Location 17:11874324-11874346
Sequence GCCTCTCTTAGGCCCCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144092975_1144092980 10 Left 1144092975 17:11874324-11874346 CCCTGAAGGGGCCTAAGAGAGGC 0: 1
1: 0
2: 0
3: 18
4: 120
Right 1144092980 17:11874357-11874379 TTCTCAGACTGATAAATACTCGG 0: 1
1: 0
2: 1
3: 15
4: 219
1144092975_1144092981 25 Left 1144092975 17:11874324-11874346 CCCTGAAGGGGCCTAAGAGAGGC 0: 1
1: 0
2: 0
3: 18
4: 120
Right 1144092981 17:11874372-11874394 ATACTCGGCAGCTTCCCCACAGG 0: 1
1: 0
2: 1
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144092975 Original CRISPR GCCTCTCTTAGGCCCCTTCA GGG (reversed) Intronic
901096552 1:6685270-6685292 GAATCTCTGAGACCCCTTCAGGG + Intronic
905041670 1:34965179-34965201 TCCTCTCTTAAGTCCATTCAAGG + Intergenic
906532223 1:46530462-46530484 GCCTCCCAGAGGCCCTTTCAGGG + Intergenic
906671616 1:47659215-47659237 GGCTCTCTTAGCACTCTTCAAGG - Intergenic
907330278 1:53666516-53666538 GCAGCTCTCAGGTCCCTTCAAGG + Intronic
912569547 1:110611340-110611362 GCCTCTAAGGGGCCCCTTCATGG + Intronic
919786582 1:201262087-201262109 GCCACTCTCAGGCCCCACCAGGG - Intergenic
922026379 1:221753375-221753397 TCCTCCTCTAGGCCCCTTCATGG + Intergenic
922533358 1:226361644-226361666 GTCACTCTAAGGCCTCTTCATGG + Intronic
923276788 1:232403497-232403519 GCAGCTCTTGGGCCCCTTCCAGG + Exonic
924552105 1:245088634-245088656 GCCTCTCTTCGGCACTTGCACGG - Intronic
1063278630 10:4599271-4599293 GCCTCTCTTAGGCTCAGTCATGG - Intergenic
1063538665 10:6910373-6910395 GCCTCTCTTTGGTCCCTCCCTGG + Intergenic
1064950685 10:20846407-20846429 GCTTCTCTTATTCTCCTTCATGG - Intronic
1068783013 10:60942661-60942683 GACTCTCTTAGGCATCTACAAGG + Intronic
1070962287 10:80507479-80507501 GCCTCCCCTAGGCCCCTGCCTGG + Intronic
1071259870 10:83910048-83910070 GCCTCTCTAAGACCCCTCAACGG + Intergenic
1071429624 10:85596503-85596525 GCCTGGCTTAGGCAACTTCAGGG + Intergenic
1072175105 10:92912797-92912819 GGCTCTTCTAGGCCCCTTTAGGG - Intronic
1077135681 11:997087-997109 GCCACCCTGAGGCCCCTTCACGG - Intronic
1077191730 11:1258571-1258593 GCCTCTGAGAGGTCCCTTCAGGG + Intronic
1079520820 11:21324315-21324337 GCATCTCTTTGGGCCTTTCATGG + Intronic
1081450064 11:43162253-43162275 GGCTCTTCTAGGCCTCTTCAGGG - Intergenic
1081450657 11:43168268-43168290 GGCTCTTCTAGGCCTCTTCAGGG - Intergenic
1081625716 11:44654019-44654041 GCCTCTCTTGGGGACCTTTAAGG + Intergenic
1084518753 11:69650324-69650346 GCCTCTCCTAGGCTCCACCACGG - Intronic
1091443160 12:527340-527362 CCCTCTCTTGGGCCCCCTTAGGG + Intronic
1091596713 12:1883368-1883390 GCCACTCTTAGGTCTCTTCAGGG + Intronic
1092524653 12:9302320-9302342 GCCTCTCAGAGGCCCATGCAGGG - Intergenic
1092542612 12:9429492-9429514 GCCTCTCAGAGGCCCATGCAGGG + Intergenic
1098817520 12:75186198-75186220 GCTTCTCTGAGGCGCCTTCTTGG + Intronic
1098855706 12:75651047-75651069 GCCTCTCTCAGCCCCATTTATGG - Intergenic
1103459013 12:121089174-121089196 GCCTGTCTTAGGCCACATGAAGG - Intergenic
1104139581 12:125974473-125974495 GGCTCTTCTAGGCCTCTTCAGGG + Intergenic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1104693483 12:130845625-130845647 GTCTCTCTTGGGCCCTTGCATGG - Intergenic
1105378336 13:19864136-19864158 GCCCCTCTTGGGGGCCTTCAAGG - Intergenic
1111655250 13:91143622-91143644 GTTTCTCTTAGGGCCCTTCTGGG + Intergenic
1115794626 14:36920575-36920597 GCCTCTCTTGGGACACTTCTAGG - Intronic
1120163578 14:81170506-81170528 GTCTCTCTCAGGGCCTTTCAGGG + Intergenic
1121758396 14:96422433-96422455 GGCTCTTCTAGGCCTCTTCAGGG - Intronic
1124227178 15:27904343-27904365 GGTTCTCTTAGGCCCCAGCATGG - Intronic
1126096116 15:45091912-45091934 TCCTCACTTAGGCCCCAGCATGG + Intergenic
1129657240 15:77532318-77532340 GCCTCTCTTAGGACCCTCCTGGG + Intergenic
1132855612 16:2043340-2043362 GCCTCTCTCAGAGCCCTGCACGG + Intronic
1133265318 16:4579939-4579961 CCCTCCCTCAGGCCCCTTCCCGG + Intronic
1134568177 16:15268979-15269001 TCCTCTCTTTGCCCCCATCAAGG - Intergenic
1134734256 16:16487376-16487398 TCCTCTCTTTGCCCCCATCAAGG + Intergenic
1134933245 16:18224903-18224925 TCCTCTCTTTGCCCCCATCAAGG - Intergenic
1135983468 16:27166790-27166812 GCCCCTATGAAGCCCCTTCAAGG + Intergenic
1136061640 16:27730694-27730716 GCCTGCCTTAGGCCCCTTGTGGG + Intronic
1142469133 17:153001-153023 GTCTCTGAAAGGCCCCTTCATGG - Intronic
1144092975 17:11874324-11874346 GCCTCTCTTAGGCCCCTTCAGGG - Intronic
1144748649 17:17633350-17633372 TCCTCTGTTAGGGCCCTTCAGGG - Intergenic
1146150624 17:30466665-30466687 GCCACTCTTAGGCCCCTTGTTGG - Exonic
1147128696 17:38392694-38392716 GCCTCTCCTAGTCCCCTCCCTGG - Intronic
1151890748 17:76949266-76949288 GCCCCTCCTTGGACCCTTCAGGG - Exonic
1153834401 18:8951130-8951152 GCTTCCCTTCTGCCCCTTCAGGG + Intergenic
1158067539 18:53430337-53430359 CCCTCTCTTATGCCCATTCAGGG + Intronic
1162985309 19:14265789-14265811 GCCTCCCTTGGTCCCCATCAGGG + Intergenic
1165478799 19:36049056-36049078 CTCTGTCTTAGGCCCTTTCAGGG - Intronic
928396826 2:30949107-30949129 GCCTCTTGCAGGCCCATTCAAGG - Intronic
929587415 2:43125300-43125322 GCCTCTCTGAGGGCTCTTCAGGG - Intergenic
932702067 2:73998903-73998925 GCCTCTCCAAAGCCCCTGCAGGG - Intronic
933396374 2:81736679-81736701 TCTTCTTTTAGTCCCCTTCATGG - Intergenic
934705250 2:96472865-96472887 TCCTCTCTGAGGCCCCTTGGTGG - Intergenic
937821813 2:126318831-126318853 GCCTCTCTGATTCCCCTTCAAGG + Intergenic
942017446 2:171831189-171831211 GGCTCCCTTAGGTCCTTTCATGG - Intronic
943574090 2:189610418-189610440 GCTACTATCAGGCCCCTTCATGG - Intergenic
943823251 2:192354786-192354808 TCCTCTCTTTTGCCCCTTCCTGG - Intergenic
945805454 2:214484612-214484634 GTTTCTCTTAGGCCTCTTTATGG + Intronic
948196999 2:236103863-236103885 GCCTCTCCTGGGCCCCTTCTAGG + Intronic
1170067822 20:12333705-12333727 GCCAATCTTAGGCCCTTTGAAGG + Intergenic
1173141099 20:40483797-40483819 TTCTATCATAGGCCCCTTCAAGG - Intergenic
1174452077 20:50626516-50626538 GCCTCTCGTTGGCCCCTTCCTGG - Intronic
1174503411 20:51001726-51001748 GCCTCTCATAGCCCCTTTCCAGG + Intergenic
1176368078 21:6045610-6045632 GCCCCTCAGTGGCCCCTTCACGG + Intergenic
1176373189 21:6074674-6074696 GCCTCTCTGAGTCTCCTTCTGGG - Intergenic
1179375930 21:40849600-40849622 GCATGTGTTAGGCCCATTCAAGG - Intergenic
1179750288 21:43463569-43463591 GCCTCTCTGAGTCTCCTTCTGGG + Intergenic
1179755441 21:43492932-43492954 GCCCCTCAGTGGCCCCTTCACGG - Intergenic
1182287099 22:29255004-29255026 GGCTCTCTTAGTCCCCTAAAGGG - Intronic
1184058840 22:42069891-42069913 GCCTCTCTGAGGCCTCTTGAGGG - Intronic
1184114690 22:42415683-42415705 GCCTCCCAGAGGCCCCTTCAGGG + Intronic
1184523355 22:45008322-45008344 TCCTCTCTTCGGCCCCCGCAGGG + Intronic
949177060 3:1076872-1076894 GCCTCTCTGAGGCCACTCCATGG - Intergenic
949629099 3:5903106-5903128 GAGGCTCTTAGGCCCTTTCAGGG + Intergenic
950068073 3:10129480-10129502 GCCATTCATAGGCACCTTCAAGG + Intergenic
950542895 3:13622669-13622691 TCCTCTCTTAGGCCCCATGTGGG + Intronic
952901868 3:38116300-38116322 GCCTCTCTAATGCCACTTCCAGG - Intronic
954105235 3:48406217-48406239 GTCACTCTCAGGCCCCTCCATGG + Intronic
956878660 3:73488897-73488919 GCCTCTCCCAGGCCCCACCAAGG - Intronic
958883678 3:99701758-99701780 GCCTCACTGAGGCCTTTTCAGGG + Intronic
961347637 3:126274407-126274429 GCCCCTCTCAGGCCCCATCCTGG + Intergenic
963416371 3:145000532-145000554 GCCACTCAGAGTCCCCTTCAGGG - Intergenic
963707704 3:148708816-148708838 GCTTCTCCTAGTCCCCTCCAGGG + Intronic
968925854 4:3547645-3547667 ACCTCTGTTAGGCACCTTTATGG + Intergenic
969971738 4:11054996-11055018 GGCTCTCTGAGGCCTCTGCAAGG + Intergenic
973394055 4:49578765-49578787 GCTTCTCTAAGGCCCATTTAGGG + Intergenic
973627694 4:52789478-52789500 CCCTCTCAGAGGCCCCTGCATGG + Intergenic
975854266 4:78606430-78606452 CCCTCTCTCAAGCCCCTACAAGG + Intronic
992650961 5:78859742-78859764 GCCTCTCTAAGGACAGTTCATGG - Intronic
992818658 5:80471187-80471209 GGCTCTTTTAGGCCTCTTTAGGG + Intronic
993503803 5:88689129-88689151 GCCTCTCTTGGGCCGCTCCCTGG + Intergenic
995631924 5:114143467-114143489 GGCTCTTTTAGGCCTCTTTAGGG - Intergenic
998497772 5:142605551-142605573 ACCTCTATGAGGCCTCTTCATGG - Intronic
1002303763 5:178271916-178271938 GCCTCTCATAGGCCCCTGACCGG + Intronic
1006893562 6:37450813-37450835 GGATCTCTAAGACCCCTTCAGGG + Intronic
1014841459 6:126224997-126225019 GCCTCTCTCAGGCTCCCTCGTGG - Intergenic
1014849553 6:126324584-126324606 GCCTTTCTTATGCCCCTACATGG - Intergenic
1019359023 7:595296-595318 GGGTCTCTGAGGCCCCTCCACGG + Intronic
1022508041 7:30918846-30918868 GCCACTCCTAGGCCCAGTCAAGG - Intronic
1023341605 7:39227485-39227507 GCAACTCCTAGGCCCCTTCATGG + Intronic
1024672744 7:51611345-51611367 CACTCTCTTAGGCCCCTTTGAGG + Intergenic
1029515665 7:101021579-101021601 ACCTCTCCTTGGCCCCTTCCTGG + Intronic
1033177636 7:139140250-139140272 GTCTTTCTTAGGCCCTATCACGG + Intronic
1033248166 7:139736151-139736173 GCCTCTCAGATGCGCCTTCATGG - Intronic
1034447353 7:151120428-151120450 CTCTCTCCTAGGCCCCTTTAGGG + Intronic
1037523535 8:19702943-19702965 ACCCCTCTTAGCCCCCTTCCTGG + Intronic
1043137150 8:76542322-76542344 GCCTCTGTTAAGCCCCTACAGGG - Intergenic
1047832757 8:128654566-128654588 CCCTCTCTTAGGCCCCTTTTGGG - Intergenic
1049344915 8:142133700-142133722 GAGTCTCTGAGGCCCCTGCAGGG - Intergenic
1049358145 8:142198834-142198856 GCCTTTCCAAGGACCCTTCAGGG - Intergenic
1051801815 9:20943396-20943418 GCCCCTCTCAGTGCCCTTCATGG - Intronic
1053754340 9:41288581-41288603 CATTCTCTTAGGCCCCTGCATGG - Intergenic
1053800734 9:41762823-41762845 ACCTCTGTTAGGCACCTTTATGG + Intergenic
1054144461 9:61552012-61552034 ACCTCTGTTAGGCACCTTTATGG - Intergenic
1054189165 9:61974975-61974997 ACCTCTGTTAGGCACCTTTATGG + Intergenic
1054259857 9:62852920-62852942 CATTCTCTTAGGCCCCTGCATGG - Intergenic
1054331911 9:63767092-63767114 CATTCTCTTAGGCCCCTGCATGG + Intergenic
1054464148 9:65482971-65482993 ACCTCTGTTAGGCACCTTTATGG - Intergenic
1054649356 9:67613642-67613664 ACCTCTGTTAGGCACCTTTATGG - Intergenic
1059730968 9:117056469-117056491 GTCTCTCTGTGGCTCCTTCAAGG - Intronic
1202799292 9_KI270719v1_random:160216-160238 CATTCTCTTAGGCCCCTGCATGG + Intergenic
1185997210 X:4965194-4965216 GCCTCTTTTAGCTCCCTTTAAGG + Intergenic
1186835700 X:13435621-13435643 GCCTCTGTTAGAAACCTTCAGGG - Intergenic
1194508229 X:94759941-94759963 GCCTCTTTTATGCCCCCTCCAGG - Intergenic
1195941961 X:110174396-110174418 CCCTCTCTCAGGCAGCTTCAGGG + Exonic
1200850872 Y:7881867-7881889 GCCTCTCATAGTCAGCTTCATGG - Intergenic