ID: 1144094384

View in Genome Browser
Species Human (GRCh38)
Location 17:11886709-11886731
Sequence CTTAGGGGATGGAGTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 370}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144094384_1144094392 5 Left 1144094384 17:11886709-11886731 CCCTCTTCACTCCATCCCCTAAG 0: 1
1: 0
2: 1
3: 48
4: 370
Right 1144094392 17:11886737-11886759 GCATGTCTACTCACACAGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 103
1144094384_1144094390 3 Left 1144094384 17:11886709-11886731 CCCTCTTCACTCCATCCCCTAAG 0: 1
1: 0
2: 1
3: 48
4: 370
Right 1144094390 17:11886735-11886757 ACGCATGTCTACTCACACAGAGG 0: 1
1: 0
2: 0
3: 5
4: 89
1144094384_1144094393 22 Left 1144094384 17:11886709-11886731 CCCTCTTCACTCCATCCCCTAAG 0: 1
1: 0
2: 1
3: 48
4: 370
Right 1144094393 17:11886754-11886776 GAGGGGCCAAGTTGATTCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 130
1144094384_1144094391 4 Left 1144094384 17:11886709-11886731 CCCTCTTCACTCCATCCCCTAAG 0: 1
1: 0
2: 1
3: 48
4: 370
Right 1144094391 17:11886736-11886758 CGCATGTCTACTCACACAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144094384 Original CRISPR CTTAGGGGATGGAGTGAAGA GGG (reversed) Intronic
900482646 1:2906681-2906703 CTCAGGGGAGGGAGGGAGGAAGG + Intergenic
900861875 1:5239628-5239650 GTTAGCGGATGGAGAAAAGAGGG + Intergenic
901012028 1:6207451-6207473 CTCAGGGGATGGCGTGGAGGCGG + Exonic
901574961 1:10193290-10193312 CTTAGGGAATGGAGAGAAGGGGG + Intergenic
902632386 1:17712851-17712873 CTGAGGAGATGGAATGCAGATGG + Intergenic
902800238 1:18825016-18825038 CCTGTGGGATGGAGTGAAGTGGG - Intergenic
903524125 1:23980083-23980105 GGGAGGGGACGGAGTGAAGATGG - Intronic
903776170 1:25795213-25795235 GTTAGGGGATGGACAGAGGAAGG - Intergenic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
905234757 1:36538311-36538333 CTTAGGGGATTGAGATCAGAAGG + Intergenic
906308477 1:44736639-44736661 GTCAAGGGATGGAATGAAGAAGG - Intergenic
906998129 1:50820117-50820139 ACTAGGGGATGGGGTGGAGAGGG + Intronic
907468324 1:54654219-54654241 CTTAGGGCAGGGAGAGGAGAAGG + Intronic
907569386 1:55468801-55468823 CCTAGGGGGTAGAGAGAAGAAGG + Intergenic
907948615 1:59158941-59158963 CTTAGGGATTGGAGTGAAAAGGG + Intergenic
908009026 1:59756710-59756732 GTTAGGGCAAGGAGTGGAGAAGG + Intronic
908107210 1:60857317-60857339 CTAAGGGCAAGGACTGAAGAGGG - Intergenic
908474782 1:64476796-64476818 CTTGGGGGAGGGAGAGGAGATGG + Intronic
909277411 1:73705355-73705377 TTTGGGGGATGGAATGGAGAAGG + Intergenic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
910692739 1:89981566-89981588 GATAAGGGAGGGAGTGAAGAGGG + Intergenic
910855327 1:91689152-91689174 CTGAGGGGAGGGTGAGAAGAAGG - Intronic
911723517 1:101217274-101217296 CTGAGGAGATGGAGTGTAGAGGG + Intergenic
911761286 1:101620185-101620207 CCTGGGGGAAGGAGTGAAGATGG + Intergenic
911856365 1:102882136-102882158 CCTTGGCTATGGAGTGAAGATGG - Intronic
913432014 1:118805635-118805657 ATCAAGGAATGGAGTGAAGAAGG - Intergenic
915087810 1:153399897-153399919 CTCAGGGGATGGAGTCCACAGGG + Intergenic
915378754 1:155422017-155422039 ATTAGGGGTTGGAGGGAGGATGG - Intronic
915655126 1:157353027-157353049 CTTGGGGGATTGAGGGAGGAGGG - Intergenic
915933072 1:160072106-160072128 TTTAGGGGATGGGAAGAAGAAGG + Intergenic
916351512 1:163854527-163854549 CTAGGGGGATGGAGCCAAGATGG - Intergenic
919189154 1:194193766-194193788 CTTGGGGGATGAAGTGAGGCAGG - Intergenic
919695384 1:200569434-200569456 CAAAGGGGATGCAGTGAAAAGGG + Intronic
919852619 1:201683387-201683409 GTTGGGGGATGGGGTGGAGATGG + Intronic
920167559 1:204046331-204046353 CTTAGGGGAGGGAGAGAACTTGG + Intergenic
920180175 1:204127550-204127572 CTTTGAGGATGGAGAGAAGACGG - Exonic
921226425 1:213024595-213024617 CTTGGGAGATGGAGAGAAAAGGG - Intergenic
921422635 1:214966141-214966163 CTTAGGGGTTGGAGGGAAGGTGG + Intergenic
921947139 1:220894075-220894097 GTTAGGGAATGGAGTAAAGAGGG - Intergenic
922005973 1:221531109-221531131 CTGAGGGGCTGGAGTGTATAGGG - Intergenic
922202225 1:223414972-223414994 CTTATGGCATGAAGTGAAAAAGG + Intergenic
922539945 1:226411044-226411066 ATTCGGGGATGGATTGAACATGG - Intergenic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923552780 1:234977511-234977533 CTGAGGACATGGGGTGAAGATGG - Intergenic
923763805 1:236873264-236873286 ACCAGGGGATGGAGTGGAGAGGG + Intronic
924721667 1:246628728-246628750 CCCAGGGGATAGTGTGAAGAAGG - Intronic
1063038614 10:2314760-2314782 CTCAGGGGATAGAGAGAAGAGGG + Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1066487197 10:35858665-35858687 CTTAGGGGGAGGAGCCAAGATGG + Intergenic
1067661182 10:48237357-48237379 CTTGGTGGAGGGCGTGAAGAGGG - Intronic
1068256158 10:54514985-54515007 CTTGGGGGATGGAGCCAAGATGG + Intronic
1069514060 10:69063765-69063787 CATAGGAGAAGGAGTGAATAGGG - Intergenic
1070456072 10:76618896-76618918 GTTAGGGGATGGGGAGAGGAAGG + Intergenic
1070559831 10:77557908-77557930 CTTAGAGAATGGTGTAAAGAGGG - Intronic
1070747146 10:78940953-78940975 CTTAGTGGATGGATAGATGATGG + Intergenic
1070834583 10:79440295-79440317 TTTAGGAGAAGGAGAGAAGATGG - Intronic
1071081300 10:81815208-81815230 ATTAGGGAAGGGAGTGGAGAAGG + Intergenic
1071511582 10:86265632-86265654 CATAGAGGTTGGAGGGAAGAGGG + Intronic
1071966680 10:90858519-90858541 CTTATGGGAAGAAGCGAAGATGG + Intergenic
1072374871 10:94804126-94804148 CTTTGAGGATGGAATGGAGAGGG + Intronic
1074230715 10:111532262-111532284 ATTAGGGGAGGGAGTGAGGGTGG - Intergenic
1075445199 10:122508191-122508213 ACTTGGGGATGGAGTGGAGATGG + Intronic
1077054493 11:584348-584370 GTTGGGGGCTGGAGTGAAGGTGG + Intronic
1077168001 11:1152397-1152419 CCTGGAGGAGGGAGTGAAGAGGG - Intergenic
1077923199 11:6656148-6656170 AATAGGGGATGGAAAGAAGATGG - Intergenic
1080294951 11:30715836-30715858 TTTAAGGGGTGGAGTGAAGGAGG + Intergenic
1081416029 11:42817383-42817405 CATAGGGAATGGGGTGAAGGTGG - Intergenic
1081430891 11:42975487-42975509 CTGAGGGGCATGAGTGAAGAGGG - Intergenic
1081501381 11:43669996-43670018 CTTAAGGGAGGGAGGGAAGCTGG + Intronic
1081581050 11:44352242-44352264 CTTTGTGGAGGGAGTGAAGCTGG + Intergenic
1081613408 11:44576938-44576960 CTTAGGGGCTGGGCTCAAGATGG - Intronic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1083576145 11:63793252-63793274 CAAAGGGGAAGGAGAGAAGAAGG - Intergenic
1084208648 11:67610809-67610831 CTAAGGGCATGGGGTGAACAAGG + Intronic
1084805460 11:71575889-71575911 CAGAGGGGATGCAGTGCAGACGG + Intergenic
1084908451 11:72367604-72367626 CTTAGAGGAGGGAGGGATGAAGG + Intronic
1085139377 11:74126898-74126920 CTTAGGGCTGGGAGTGATGATGG - Intronic
1085757214 11:79211869-79211891 TTTAGGGCATGCTGTGAAGAAGG + Intronic
1086124900 11:83340382-83340404 GTGAGGGCAAGGAGTGAAGAGGG - Intergenic
1086889965 11:92246124-92246146 GGCAGTGGATGGAGTGAAGAGGG + Intergenic
1087081455 11:94174718-94174740 CTTAGGGGATTAAGTGCAGATGG - Intronic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089662685 11:119995914-119995936 CATGGGGGATGGAGTGGAGGGGG - Intergenic
1089756323 11:120690155-120690177 TTTAGGGTCTGGAGTGACGAGGG - Intronic
1089866468 11:121637320-121637342 GTTAGGGGATGGATTATAGAAGG + Intergenic
1090153056 11:124405296-124405318 CTTGGGGGAGGGAGAGAAGAGGG - Intergenic
1090900533 11:131026943-131026965 CTCCTGGGATGGAGTGAAGTGGG + Intergenic
1091121312 11:133060219-133060241 CTGAGGGGATGGGGAGAAGGAGG - Intronic
1094037737 12:26088628-26088650 CGTAGGTGATGGTGTTAAGAGGG - Intergenic
1094091734 12:26657387-26657409 CCTAGGTGATGGAGTTGAGAGGG - Intronic
1094120495 12:26969057-26969079 TTTAGGGGAGAGAGTGAGGAGGG + Intergenic
1095945039 12:47748995-47749017 CTCAGGGGCTGGAATGAAGGAGG - Intronic
1095975097 12:47935010-47935032 CATAGGGGATGAAGTCAAGATGG - Intronic
1096093780 12:48920881-48920903 ATTAGGAAAGGGAGTGAAGAGGG - Intronic
1096201670 12:49688024-49688046 CTGAGTGGATTCAGTGAAGAGGG - Intronic
1099278812 12:80615618-80615640 CTTTGGGGCAGGGGTGAAGAAGG + Intronic
1099330603 12:81280454-81280476 ATCAGTGGCTGGAGTGAAGATGG - Intronic
1099492971 12:83308504-83308526 CTGAGGGAATGCAGTGAAAAGGG - Intergenic
1099671479 12:85699798-85699820 CAAAGGGAATGGAGTTAAGAGGG - Intergenic
1100390089 12:94140408-94140430 CTCAGGGAATGGGGTGAAGTTGG - Intergenic
1100628435 12:96361198-96361220 CTGAGGGGATGTGATGAAGATGG + Intronic
1101879977 12:108619597-108619619 CTTTGGGGAAGGAATGAACAAGG - Intergenic
1102534357 12:113569780-113569802 CTGAGGACATGGAGTCAAGAGGG + Intergenic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103510355 12:121469283-121469305 CTTTGGGAATGGAGTGATGTGGG - Intronic
1104047547 12:125173838-125173860 CTTAGAGGACGGAGTGCAGTGGG + Intergenic
1104274965 12:127318308-127318330 CTGTGGGGATGCAGTGAGGATGG - Intergenic
1104639634 12:130459152-130459174 GTTAGGGGAGGGTGTGACGAGGG + Intronic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1107416639 13:40207253-40207275 TTTAGGAGAGGAAGTGAAGAAGG + Intergenic
1108482310 13:50886426-50886448 GTTCAGGGATGGAGGGAAGAGGG + Intergenic
1110252968 13:73401517-73401539 CAAAGGGGATGGAGTGAAATGGG - Intergenic
1111166584 13:84465129-84465151 CATGGAGGATGGAGTGAAGCAGG + Intergenic
1112023500 13:95392161-95392183 GGTAAGGGAGGGAGTGAAGATGG - Intergenic
1112024698 13:95401336-95401358 GTTATGGGAAGGAGAGAAGAGGG + Intergenic
1112332872 13:98490114-98490136 GGTAGGGGAGGGAGTGGAGATGG + Intronic
1112907578 13:104443672-104443694 TTTAGGGGATGAAGTGAAACTGG + Intergenic
1113758192 13:112828647-112828669 CCAAGGAGATGGACTGAAGAGGG - Intronic
1114664903 14:24371919-24371941 GGTAGGGGATGGTGTGAGGATGG - Intronic
1115792810 14:36898664-36898686 ATTGGGGGATGGAGCCAAGATGG - Intronic
1116723242 14:48527990-48528012 CTTAGGGGCGGGAGTGTAGCAGG - Intergenic
1116747292 14:48836886-48836908 GGGAGGGGAGGGAGTGAAGAGGG - Intergenic
1117090760 14:52247752-52247774 GTCAGGGGATTGAGTGAACATGG + Intergenic
1117752747 14:58940111-58940133 GTTAGGGGATGGGGTGGTGAAGG + Intergenic
1119202380 14:72765976-72765998 CTCTGGGGAGGGAGTAAAGAAGG + Intronic
1120995112 14:90411641-90411663 ATTAGGGGATGGGGGGAAGGAGG - Intergenic
1121395166 14:93615375-93615397 CTTAGAGGGTGGGGAGAAGAGGG - Intronic
1121507993 14:94490977-94490999 GTATGGGGATGGAGTGAAGGTGG - Intronic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1122871603 14:104641312-104641334 CTTAAGGGATGGAGTGAGAGCGG - Intergenic
1122981534 14:105194359-105194381 CTTGGGGGATGGAAGGAAGAGGG - Intergenic
1125477707 15:40058624-40058646 CTCAGGGGAAGGAGAGGAGAGGG + Intergenic
1127365331 15:58284247-58284269 GTACGGGGATGGAGTGGAGAAGG + Intronic
1128522868 15:68386984-68387006 CTCAGGCGAGGGAGTAAAGAGGG + Intronic
1128756292 15:70186087-70186109 CTTGGTGGATTGAGTGCAGAGGG + Intergenic
1128839400 15:70837485-70837507 TTGAGGGGATGGAGTAGAGAAGG - Intronic
1130562577 15:84970289-84970311 CTTGGAGGATGGTGTGGAGAGGG - Intergenic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1131343656 15:91626709-91626731 CTAAGGGGATGAAGAGAGGAGGG + Intergenic
1131349764 15:91688480-91688502 CCTAGGGGTAGGAGTGAAGAAGG + Intergenic
1131361181 15:91792068-91792090 CAAAGGGGATGGAGGGAGGAGGG - Intergenic
1131518314 15:93094347-93094369 CTTATGGGATGGGGGTAAGATGG + Intergenic
1134798658 16:17064855-17064877 CTTGGGGGCTGGAGTGGTGAGGG - Intergenic
1135861957 16:26064344-26064366 CTTAGGGTATAGAGGGTAGAAGG + Intronic
1136254998 16:29032626-29032648 CTTAGGGGATGCTTTGAAGAGGG + Intergenic
1137321350 16:47386516-47386538 AGTAGGGGCTGGATTGAAGAAGG - Intronic
1137371158 16:47907013-47907035 CTTAGGGAAGGGAGAGCAGATGG + Intergenic
1138239503 16:55415688-55415710 CTTGGAGGATGGAGGGCAGATGG + Intronic
1138348658 16:56335025-56335047 GTTAGGGGCTGGAGTGAGCAGGG + Intronic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139223644 16:65212452-65212474 GCTATGGGATGGAGTGACGAGGG - Intergenic
1140867544 16:79077112-79077134 CTTAGGGGTTGGAGAGCAGTGGG - Intronic
1142810373 17:2393166-2393188 CGTAGGGGATGGAGGGACGTGGG - Intronic
1142871892 17:2826555-2826577 CTTTGGGGATGGATTGCGGAAGG + Intronic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1144098462 17:11922994-11923016 CTTTGGGAATTAAGTGAAGAGGG + Intronic
1146469539 17:33112795-33112817 CTTAGAGGATGGGCTGGAGAAGG - Intronic
1146521860 17:33531711-33531733 CGTAGAGGATGGAGGAAAGAAGG - Intronic
1147370527 17:39989521-39989543 CTTAGGGAATGCAGTGCAGTGGG - Intronic
1147383534 17:40069455-40069477 CTTAGATGAGGGAGTGAGGAGGG + Intronic
1147562069 17:41515436-41515458 CACAGGGGAAGGAGTGATGAGGG - Intronic
1148864217 17:50620155-50620177 CTTAGGGGGTGGAGGGAAGGAGG + Intronic
1149284304 17:55145022-55145044 GCAAGGGGAGGGAGTGAAGAGGG - Intronic
1149334589 17:55622482-55622504 CCTAAGGGATGGATTGAAGAAGG - Intergenic
1151906933 17:77054845-77054867 CTCAGGGGCTGGAGAGCAGAGGG + Intergenic
1152012566 17:77727373-77727395 CTGAGGGGCTTGAGTGATGATGG - Intergenic
1152945442 17:83195262-83195284 CTTAGGGGCTGGAGCGGGGAGGG + Intergenic
1153006891 18:504983-505005 CATGGGGGATGCAGTGGAGATGG - Intergenic
1157594262 18:48854300-48854322 CTTAAAGGATGGAGAGAGGATGG + Intronic
1158124741 18:54088601-54088623 ATTGGAGGATGGAATGAAGAGGG - Intergenic
1158485804 18:57864787-57864809 CTGAGGGGATACAGTGAATATGG + Intergenic
1158672303 18:59487453-59487475 CTTGGGGGATGTAGTGTAAAAGG - Intronic
1163038106 19:14583299-14583321 CTTGAGGGATGGAGGGAGGAGGG + Intronic
1163038795 19:14587556-14587578 CTTGAGGGATGGAGGGAGGAGGG + Intronic
1163039541 19:14592223-14592245 CTTGAGGGATGGAGGGAGGAGGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1165340681 19:35209628-35209650 CTTTGGGGATGGAGTGGAGGTGG + Intergenic
1165391764 19:35543094-35543116 CTTACTGTATGGAGTTAAGAGGG + Intronic
1165741189 19:38206257-38206279 CTGAGGGGAAGGAGCGAAGGCGG - Exonic
1167158685 19:47754504-47754526 CTGAGGGGCGGGAGTGAGGATGG - Intronic
1167454877 19:49592790-49592812 TTTGGGGGGTGGAGAGAAGAGGG - Intronic
1167563854 19:50243794-50243816 CTTAGGGAAATGAATGAAGAAGG - Intronic
1168156239 19:54474269-54474291 CGCAGGGGATGGAGTGAAGCAGG + Intergenic
1168243049 19:55096737-55096759 CTGCGGGGAAGGTGTGAAGACGG - Intronic
1168243123 19:55097049-55097071 CTGCGGGGAAGGGGTGAAGACGG - Intronic
1168243203 19:55097402-55097424 CTGCGGGGAAGGGGTGAAGACGG - Intronic
1168243255 19:55097631-55097653 CTGCGGGGAAGGGGTGAAGACGG - Intronic
925132217 2:1502066-1502088 CCCAGGGGATGGAGAGAAAATGG + Intronic
925425769 2:3747761-3747783 CTGAGGGGATGGGGTGAGTATGG + Intronic
925428289 2:3769439-3769461 CTGATGGAATGGAGTGAAGACGG - Intronic
925472774 2:4180718-4180740 CTGAGGGCATCCAGTGAAGAAGG - Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
927282967 2:21326857-21326879 CTGAGGGGATGGTGTGTAGATGG - Intergenic
927512105 2:23650195-23650217 CTCAGGGGCTGGAGAAAAGAGGG + Intronic
928654726 2:33438927-33438949 CTTGGGGGATGTGTTGAAGAGGG + Intronic
928764971 2:34635308-34635330 CTTGGGGGGTGGAGCCAAGATGG + Intergenic
928911816 2:36429613-36429635 TTTAGGGGGAGGAGAGAAGATGG + Intronic
929434648 2:41919232-41919254 TTTGGGGGGTGGAGGGAAGATGG - Intergenic
931536283 2:63280565-63280587 CTTAGGGTATGGTTTGAAGTTGG - Intronic
934131767 2:88955530-88955552 CTTAGGCCCTGGAGTGAGGAGGG - Intergenic
935330502 2:101974108-101974130 CATAGGGGAGGGAGTGATGGGGG + Intergenic
935503234 2:103868065-103868087 CTTAGAGGAAGGAGGAAAGAGGG + Intergenic
935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG + Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937369265 2:121286285-121286307 CTTAGGAGATGAGGTGAGGAGGG + Intergenic
940404315 2:153283578-153283600 GCTAGGGCATGGAGTGGAGAGGG + Intergenic
941142973 2:161807457-161807479 CTTCAGGGATGGAGTGAATATGG - Intronic
942050698 2:172137819-172137841 CTTAGGGAATGGAGTTTAGAAGG - Intergenic
942331193 2:174826343-174826365 CTTATGGGAATGAGTGAAGTAGG + Intronic
943741148 2:191410440-191410462 CTTCAGGGATGGAGTGAAAGGGG + Intronic
944146039 2:196508687-196508709 TTTAGGGGATGAAGTGATGGAGG - Intronic
945375647 2:209076976-209076998 AGAAGGAGATGGAGTGAAGAGGG - Intergenic
945435193 2:209809975-209809997 CTTCGGGGAAGGAGTGGGGAGGG - Intronic
945513003 2:210725736-210725758 ATGAGGGGTGGGAGTGAAGAGGG + Intergenic
946071629 2:217039221-217039243 CTTAAGGGATGAAGGGAATATGG - Intergenic
946138960 2:217671786-217671808 GTTTGGGGATGGAGTGAAACTGG - Intronic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
946445399 2:219735517-219735539 ATCAAGGGAGGGAGTGAAGAGGG - Intergenic
947071031 2:226288050-226288072 CTTAAGGAAGAGAGTGAAGAAGG - Intergenic
947449631 2:230195274-230195296 ATTAGGGGATTGAATAAAGATGG + Intronic
948091032 2:235295872-235295894 TTTAGGTGGTGGAATGAAGATGG + Intergenic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
948885712 2:240882988-240883010 TTTGGGAGATGCAGTGAAGAAGG - Intergenic
1168764247 20:371209-371231 CTGAGGGGCTGGACTGAACATGG - Intronic
1168774966 20:439783-439805 CTTGAGGGATGGGGTGGAGATGG - Intronic
1169038453 20:2472518-2472540 CTTTAGAGATGGTGTGAAGATGG - Intronic
1169371982 20:5034963-5034985 TATAGGAGATGGAGTGAACAAGG - Intergenic
1169794968 20:9452085-9452107 TTTAGGAGAAGGAGTGGAGAAGG - Intronic
1169985736 20:11441790-11441812 CTTAGGGGATGCAGCCAAGTGGG + Intergenic
1171077688 20:22145623-22145645 GTGAGGGGATGGCGTGGAGAAGG + Intergenic
1174986469 20:55459693-55459715 CTTAGTGGTTTGAGTGTAGAAGG + Intergenic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1180258847 21:46652147-46652169 TTTAGCAGATGGTGTGAAGAAGG - Intronic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1182540625 22:31039209-31039231 CTTACGGGATGGAAGGAGGAGGG - Intergenic
1183509570 22:38227011-38227033 CGGAGGGGATGGAGGGACGAAGG + Intronic
1184550109 22:45199964-45199986 CTTGAGGGATGGGGAGAAGAAGG + Exonic
1184730377 22:46368312-46368334 CAGAGGGGATGGAGTGAATCCGG + Intronic
949679224 3:6493979-6494001 CTAAAGGGAGGGAGTGAAGAAGG - Intergenic
950032830 3:9863357-9863379 CCTACGGGCTGCAGTGAAGAAGG + Intergenic
950702799 3:14761718-14761740 CTGAAGGGATGGAGTGGGGAGGG + Intronic
950909690 3:16576242-16576264 ATTTGGGGATGGAGTGGTGAAGG - Intergenic
951794711 3:26525431-26525453 CATAGTGGAAGGAGTGAACACGG + Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952307268 3:32157335-32157357 CAGAGGGGATGGAGTGAACCTGG - Intronic
952364392 3:32662066-32662088 CTGAGGGGAGGGAGTGGAGAGGG + Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
953241577 3:41154191-41154213 CTCAGGGGCTGGGCTGAAGAGGG - Intergenic
954822819 3:53346773-53346795 CTTCGGGGATCCAGTGAACACGG + Intronic
955048778 3:55388734-55388756 CTTAGTGGGTGGAGCCAAGATGG + Intergenic
955194460 3:56792243-56792265 CATATGGGATGTAGAGAAGAGGG - Intronic
955268876 3:57476935-57476957 CTAAGGGGGTGGAGCCAAGATGG + Intronic
955462799 3:59203325-59203347 CTTGGGAGAGGGGGTGAAGAGGG - Intergenic
955875941 3:63490448-63490470 CTTAAGGGGTGAAGTCAAGAAGG + Intronic
956761596 3:72448617-72448639 CTTAGGGGAGGGATGAAAGAAGG + Intergenic
957255374 3:77829066-77829088 CTTGAGGGATGTAATGAAGAAGG - Intergenic
958129992 3:89406171-89406193 ATTAGGAGATGGAGAGGAGAAGG + Intronic
958800011 3:98744348-98744370 CTCAGGGGATGCAGAGAAGAGGG - Intronic
959080542 3:101796255-101796277 CCTATGGGCTGGAGTGAACATGG - Intronic
959122973 3:102254715-102254737 CTTAAAGGATGATGTGAAGAGGG - Intronic
959694399 3:109234092-109234114 CTTCGGGGGTGGGGTCAAGATGG + Intergenic
962405319 3:135095201-135095223 CCTAGAGGATGAAGTGTAGAGGG + Intronic
962417284 3:135194587-135194609 CTTAGGGGCTGTAGTGTGGAAGG + Intronic
962931350 3:140040506-140040528 CTTGGGAGGTGGAGAGAAGAAGG + Intronic
963541174 3:146590712-146590734 CTTTGGGGATAGGGTGAAGTTGG + Intronic
964833170 3:160908895-160908917 CTTAGGGAATGGCATGAATAAGG + Intronic
966409204 3:179631241-179631263 CTTAGGGGAGGAAGTGAAGTGGG + Intergenic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
967281596 3:187828764-187828786 ATTAGGGCAGGAAGTGAAGAAGG + Intergenic
967640289 3:191854725-191854747 CTTAGAGAAGGGAGTGAAGAAGG - Intergenic
967955890 3:194876918-194876940 CTTGGGGGATGCAGGGAAGCTGG + Intergenic
970240824 4:14006896-14006918 ATGAGGGGAAGGAGTGAAGAGGG + Intergenic
970425979 4:15946751-15946773 CTTACGTGATGGAGGCAAGATGG + Intergenic
970869427 4:20798686-20798708 CTGAGGGGATGGAGTGGCGGAGG - Intronic
971422095 4:26482604-26482626 GTTAGGGCATGGAGTGAGAAGGG + Intronic
972454935 4:39244845-39244867 TTTAGGGGAGGGAGTGAAGTGGG + Intronic
973236800 4:47914393-47914415 CTTTGGAGATGGACCGAAGAGGG + Exonic
973877939 4:55240509-55240531 TTTTGGGAATGGTGTGAAGAAGG - Intergenic
974281588 4:59801930-59801952 GTTGGGGGATGGAGAGAAGCAGG + Intergenic
974308584 4:60174520-60174542 CTGAGAGGATGGAGAGATGATGG - Intergenic
977029573 4:91864441-91864463 CATAGGGGGTGGAGCCAAGATGG - Intergenic
977617229 4:99099984-99100006 ATTAGGGGGTGGAGCCAAGATGG - Intergenic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
978633624 4:110777701-110777723 CTAAGGGGCATGAGTGAAGACGG - Intergenic
979217017 4:118177850-118177872 GTTAGGTGAAGGAGTGGAGAAGG + Intronic
979589889 4:122465977-122465999 CTTGGGGGGTGGAGCCAAGATGG - Intergenic
979841241 4:125443393-125443415 CTGAGGGAATGTAGTGAAGACGG - Intronic
981307482 4:143262261-143262283 GGTAGGGGCTGGAGAGAAGATGG + Intergenic
982406543 4:155026780-155026802 CTTAGGGGAGGAAGGGAAGAGGG - Intergenic
982805946 4:159762648-159762670 ATTAGGGAGTGGAGTGGAGACGG - Intergenic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
983979240 4:173973688-173973710 GCTAGGGGATGGAGTGAGGCAGG + Intergenic
984622239 4:181966952-181966974 CGAAGGGGAGGGAGAGAAGAAGG - Intergenic
985151864 4:186955401-186955423 GTTAGGGGTGGGAGTGAAGATGG - Intergenic
987029098 5:13959621-13959643 CTTGGGGTAAGGAATGAAGAGGG - Intergenic
987036792 5:14027176-14027198 AATAGGGGATGCCGTGAAGAGGG + Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
988450413 5:31336909-31336931 CTTAGGGCAAGAAGGGAAGAGGG + Intergenic
988555391 5:32232045-32232067 CTTAGGAGATAGAGAGAAGGGGG - Intronic
989786456 5:45337137-45337159 CTTGGAGGATGGGGTAAAGATGG - Intronic
991509765 5:67363825-67363847 CTTGGGGGAAAGAGTGAGGAAGG + Intergenic
992411524 5:76510392-76510414 CTTGGGGGATGCAGTGATGACGG + Intronic
995204648 5:109465771-109465793 CTTAGCCATTGGAGTGAAGATGG + Intergenic
995623520 5:114053740-114053762 CCTAGGGGATGTGGTGAAGGGGG + Intergenic
997055483 5:130438498-130438520 GTCTGGGGGTGGAGTGAAGAGGG + Intergenic
997712213 5:136015318-136015340 CTAATGGGATGGGGTGAAGTGGG + Intergenic
997744702 5:136289168-136289190 ATTAGGGGGTGGAGCCAAGATGG + Intronic
998163477 5:139826924-139826946 CTTAGGAGCTGGAGTCAGGAAGG + Intronic
998788054 5:145733974-145733996 CTATGGGGAAGGACTGAAGATGG + Intronic
999143535 5:149378294-149378316 CTTGGGGGATGGCTGGAAGAGGG - Intronic
1000275510 5:159731236-159731258 CCTAGGGGAAGGAGGGAAGGAGG + Intergenic
1000573772 5:162949976-162949998 GGGAGGGGAAGGAGTGAAGAGGG + Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1003499442 6:6692140-6692162 CTTTGGTGATGGAGTGTAGAAGG + Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003616797 6:7661649-7661671 AGTAGGGGAAGGAGTGAACAGGG - Intergenic
1003712896 6:8613560-8613582 CTAAGGGGAGGGAGAGGAGACGG - Intergenic
1004390576 6:15206225-15206247 CTCAGGGGATGGCGTGAACCCGG - Intergenic
1007368144 6:41408861-41408883 CTGAGCGGATGGAGTGAACCTGG + Intergenic
1009798461 6:68502600-68502622 CTTGGGGGAGGGCGTGAAGCTGG + Intergenic
1009892028 6:69696494-69696516 TTTAGGGGTTGGAGGGAGGAAGG - Intronic
1012810427 6:103949663-103949685 GCTAAGGGAAGGAGTGAAGATGG - Intergenic
1013298476 6:108781128-108781150 TTTAGGGGCAGGGGTGAAGAGGG - Intergenic
1014660879 6:124170013-124170035 TTTAGGGGCTGAAGTGAGGAAGG + Intronic
1015517579 6:134099321-134099343 GTAATGGGATGGAGTGAGGAAGG - Intergenic
1016056374 6:139581961-139581983 CCTAGGTGACAGAGTGAAGATGG - Intergenic
1017215473 6:151901422-151901444 CTTGGGGGAGGGAGTGAATTTGG - Intronic
1017570755 6:155742009-155742031 CTTTTAGGATGGGGTGAAGAGGG - Intergenic
1017746250 6:157449166-157449188 CCTAGGGGGTGGAGTTAAGTTGG + Intronic
1018438153 6:163782095-163782117 TTCAGGGGATGGTGTAAAGAAGG + Intergenic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1020362998 7:7349860-7349882 AGTAAGGGAGGGAGTGAAGAAGG + Intergenic
1020885703 7:13816848-13816870 ATCAGGGGAAGGAGAGAAGAGGG - Intergenic
1021056764 7:16058717-16058739 GTTAGGAGATGGAGGAAAGAGGG + Intergenic
1022374584 7:29801662-29801684 CTTATGGGATGGGGAGCAGATGG - Intergenic
1022879894 7:34575795-34575817 TTTGGGGGATGGAGCCAAGACGG + Intergenic
1026892716 7:73991938-73991960 CTAGGGGGATGGAGTGAGGGTGG + Intergenic
1028320404 7:89452430-89452452 CATAAGGGATGGAGTGTGGAGGG + Intergenic
1028624840 7:92865862-92865884 TTGAGGGGAGAGAGTGAAGAGGG + Intergenic
1030169157 7:106584260-106584282 TTTAGGTGATGGAGTGGAAATGG - Intergenic
1030996977 7:116371248-116371270 CTTAGGGGGTGGAGCCAAGATGG + Intronic
1031614353 7:123863868-123863890 CTTTGGGGAAGGAGTGAGAAGGG + Intronic
1031965459 7:128025008-128025030 CTAAGGGGAAGGAGTGAAGTAGG - Intronic
1032550826 7:132782341-132782363 GTTAGAGGAGGGAATGAAGATGG + Intergenic
1033473786 7:141671559-141671581 CCTAGGAGATGCAGGGAAGAGGG - Intronic
1033522608 7:142176639-142176661 GGTATGGGATGGAGTGAACAGGG + Intronic
1033765082 7:144480527-144480549 ATTAGGGAATGGAGTGTAGAGGG + Intronic
1034183407 7:149156075-149156097 CGTAGGGGAAGAACTGAAGAAGG + Intronic
1034949476 7:155287303-155287325 CCTACGGGATGGGATGAAGAGGG - Intergenic
1035444689 7:158932282-158932304 CTTGGGGGATGGAGTGCAGTGGG + Intronic
1035673707 8:1439701-1439723 CCTAGGGGATGGCGGGAAGAAGG - Intergenic
1035692710 8:1570738-1570760 CTTCTGGGATGGAGAGGAGAGGG + Intronic
1035692926 8:1571768-1571790 CTTCTGGGATGGAGAGGAGACGG + Intronic
1035825641 8:2641842-2641864 CTGAGAGGATGGAGTGAAGGAGG + Intergenic
1036149744 8:6286362-6286384 ATCAGTAGATGGAGTGAAGAAGG - Intergenic
1037234112 8:16696250-16696272 CTTAGTGGAGGGAGTGAAGAAGG - Intergenic
1037326669 8:17698733-17698755 GTTGGGGGCTTGAGTGAAGAGGG - Intronic
1037386479 8:18347855-18347877 CTTGGGGGAAGGAGTGGAAAGGG + Intergenic
1038892446 8:31741213-31741235 CTTAGGGGCAGGAGGGAACAGGG + Intronic
1039177753 8:34828386-34828408 ATTAAGGGATGGAGAGAAGTTGG + Intergenic
1039617298 8:38966297-38966319 CTTTGGGGATGGGGGGATGAGGG + Intronic
1039847803 8:41338173-41338195 GCTGGGGGATGGGGTGAAGATGG - Intergenic
1042025672 8:64421133-64421155 GTTAGGGGTTAGAGTGAATATGG - Intergenic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1042970499 8:74402688-74402710 CTTTGGGGAAGGAGCCAAGATGG - Intronic
1043575771 8:81654405-81654427 CTTGGGGGAGGGAGTAAAGAGGG - Intergenic
1045063998 8:98429272-98429294 CTTTGGAGATGGAATGAAGGAGG + Exonic
1045095390 8:98792307-98792329 TGTCGGGGATGGAGTGAACAGGG + Intronic
1045611317 8:103846345-103846367 GTAAGGGAATGGAGTGAAGCAGG + Intronic
1046007771 8:108506427-108506449 CTCAGGGGGTGGAGCCAAGATGG - Intergenic
1046066808 8:109207137-109207159 AGTAGGGGATGGAGGGAGGAGGG + Intergenic
1046081646 8:109376630-109376652 TTTGGGGGGTGGAGTCAAGACGG - Intronic
1046803667 8:118456368-118456390 CATAAGGGATATAGTGAAGACGG - Intronic
1046832102 8:118757842-118757864 TTTAGAGGGTGGACTGAAGAAGG + Intergenic
1048323456 8:133420438-133420460 ACTAGGTGATGGAGAGAAGATGG - Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048616524 8:136081022-136081044 CCTGGGGGAGGGTGTGAAGAAGG - Intergenic
1049157401 8:141075411-141075433 CTTAGGCGGTGGGGTGGAGAGGG - Intergenic
1049392215 8:142377736-142377758 CTCTGGGGGTGCAGTGAAGAGGG - Intronic
1050249616 9:3730975-3730997 ATTAGGAAATGAAGTGAAGAGGG - Intergenic
1051301362 9:15654660-15654682 CTAAGGGGGTGGAGCCAAGATGG + Intronic
1052503001 9:29316909-29316931 CTTAAGGGAGGGAGGGAAGGGGG + Intergenic
1053076992 9:35141656-35141678 TTTAGGGGATCGAGAGAAGGAGG + Intergenic
1057980509 9:99657484-99657506 CTTTGGGGTTGGGATGAAGAAGG - Intergenic
1058227813 9:102388237-102388259 TTTAGGGGATGGATGGGAGAGGG + Intergenic
1058466727 9:105236352-105236374 TTTGGGGGATGGAGAGAAGACGG + Intergenic
1058478614 9:105367757-105367779 CAGAGGGGCTGGGGTGAAGAGGG - Intronic
1058795846 9:108497776-108497798 CTTTTGGGATGGAGCCAAGATGG + Intergenic
1059134681 9:111794247-111794269 TTTATGCGAGGGAGTGAAGAAGG - Intronic
1059458161 9:114412757-114412779 GTAAGGGGATGAAATGAAGAGGG + Intronic
1059577553 9:115507173-115507195 CTTCTGAGAAGGAGTGAAGAGGG + Intergenic
1060077111 9:120601764-120601786 CCTAGGGGATAGAGGGTAGAGGG + Exonic
1060927802 9:127467439-127467461 CTTAAGGGAGGGAGGGAAGGGGG + Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061914409 9:133741884-133741906 GTTAGGCCATGGAGTGGAGAGGG - Intergenic
1062423627 9:136496194-136496216 CTCAGGGGACGGGGTGAGGAAGG + Exonic
1186001613 X:5018251-5018273 CTTAGGGGACTGATTGGAGAAGG + Intergenic
1188525478 X:31083445-31083467 CTTGGGGGGTGGAGCCAAGATGG - Intergenic
1188734578 X:33696705-33696727 ATGAGGGGAGGGAGAGAAGAAGG + Intergenic
1189700825 X:43715388-43715410 GCTAGGGGATGCAGGGAAGATGG + Intronic
1189809521 X:44768344-44768366 CCTAGAGGATGGAGGGAAGTGGG + Intergenic
1190441227 X:50476271-50476293 CTTAGGTGATGGTGTTTAGAAGG + Intergenic
1190585812 X:51940553-51940575 ACTAGAGGATGGAGAGAAGAAGG - Intergenic
1190605184 X:52134182-52134204 CTCAGGGAATTGAGTGAGGATGG + Intergenic
1190924137 X:54886459-54886481 GGTAAGGGATCGAGTGAAGATGG - Intergenic
1190930784 X:54948252-54948274 CATCGGAGATGGAATGAAGAAGG - Intronic
1191073016 X:56421765-56421787 CTGGGGGGATGGAGCCAAGATGG - Intergenic
1191688953 X:63920512-63920534 CTTAGGGGATGGGGGGAGGCTGG + Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1195588569 X:106597224-106597246 ATTAGGGGGTGGAGGGTAGATGG + Intergenic
1197758810 X:130013935-130013957 TGTAGGGGCTGGAGTAAAGATGG - Exonic
1197857957 X:130937877-130937899 GTTGGGGGTGGGAGTGAAGAAGG + Intergenic
1198686015 X:139228880-139228902 ATAGGGGGATGGAATGAAGATGG + Intergenic
1202275795 Y:23118545-23118567 ATTTGGGGATGGAGTGGTGAAGG - Intergenic
1202290233 Y:23302146-23302168 ATTTGGGGATGGAGTGGTGAAGG + Intergenic
1202428789 Y:24752264-24752286 ATTTGGGGATGGAGTGGTGAAGG - Intergenic
1202442002 Y:24917825-24917847 ATTTGGGGATGGAGTGGTGAAGG + Intergenic