ID: 1144096155

View in Genome Browser
Species Human (GRCh38)
Location 17:11902506-11902528
Sequence CTAAATCTTGCATGTTATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144096151_1144096155 -6 Left 1144096151 17:11902489-11902511 CCCAAACATTTTATGCGCTAAAT 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1144096155 17:11902506-11902528 CTAAATCTTGCATGTTATTGGGG 0: 1
1: 0
2: 1
3: 5
4: 152
1144096152_1144096155 -7 Left 1144096152 17:11902490-11902512 CCAAACATTTTATGCGCTAAATC 0: 1
1: 0
2: 1
3: 7
4: 121
Right 1144096155 17:11902506-11902528 CTAAATCTTGCATGTTATTGGGG 0: 1
1: 0
2: 1
3: 5
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144096155 Original CRISPR CTAAATCTTGCATGTTATTG GGG Intronic
906579979 1:46928304-46928326 CTAAATCTTGAATGGAATGGAGG + Intergenic
906603745 1:47150583-47150605 CTAAATCTTGAATGGAATGGAGG - Intergenic
911865437 1:103014247-103014269 AGAAATCTTGCGTGTTATGGTGG + Intronic
912057538 1:105623266-105623288 CTAAATCTTTCTTGCCATTGGGG + Intergenic
913705803 1:121421748-121421770 CTAAATCTTGATTGTGATGGTGG + Intergenic
918336215 1:183516466-183516488 CAAAATTTTTCATTTTATTGGGG - Intronic
919033926 1:192281701-192281723 CTAAAACTTTTATGTTATGGAGG + Intergenic
921035380 1:211373014-211373036 CTAAATATTGAGTGTTATGGAGG + Exonic
923327522 1:232893817-232893839 CTATATCTTACATTTTAATGGGG - Intergenic
923357817 1:233177804-233177826 CTGAATCTTTCATCTTCTTGGGG + Exonic
1069098804 10:64292430-64292452 ATAAATCTTGTATGGAATTGGGG + Intergenic
1071426664 10:85562415-85562437 CTAAGGCTTGCCTGATATTGAGG + Intergenic
1075855743 10:125628347-125628369 CTATATCTTATTTGTTATTGTGG + Intronic
1076911163 10:133390643-133390665 CTAAATATTGGATCATATTGAGG - Intronic
1078944427 11:16047544-16047566 CGATATCTTGCATTTTACTGTGG + Intronic
1079818734 11:25096141-25096163 CTACATCCTGCATGTCATGGAGG + Intergenic
1081280716 11:41206610-41206632 CTAAATTTTGCATGTCAAAGTGG - Intronic
1081372807 11:42324647-42324669 CTAATTTTTGAATGATATTGGGG + Intergenic
1085639662 11:78185390-78185412 CTAAATCTGGCGACTTATTGGGG - Intronic
1086632925 11:89045747-89045769 ATAAATCATGCATTTTATTAGGG - Intronic
1087715582 11:101604923-101604945 CTAAATATTTCATGATATTTGGG - Intronic
1090160906 11:124493937-124493959 ATAAAAATTACATGTTATTGTGG - Intergenic
1091658354 12:2362422-2362444 CTGAATCCTACATGTTTTTGTGG + Intronic
1091941613 12:4488967-4488989 CTACCTCTTGCATTTTTTTGCGG - Exonic
1092633666 12:10415433-10415455 CTAAAAGTTGCATGTTATGTTGG - Intronic
1093565789 12:20601794-20601816 CTAAATTCTGCCTGTTAATGAGG + Intronic
1093670208 12:21865242-21865264 CAAAATGTTGTATGTTTTTGTGG + Intronic
1094262341 12:28515286-28515308 CTAAAGCTTTCATTTTGTTGAGG + Intronic
1099408333 12:82290910-82290932 ATAAAACTTGCATTCTATTGAGG - Intronic
1101168716 12:102065587-102065609 CTAAATCTTGCACATTCTTATGG - Intergenic
1102223447 12:111210629-111210651 CTAATTTTTGCATTTTTTTGGGG - Intronic
1104060018 12:125259725-125259747 ATAAATCTTGCTTGTTTATGGGG + Intronic
1104392241 12:128400772-128400794 CTAATTTTTGCATTTTTTTGTGG + Intronic
1106285382 13:28314030-28314052 CTAATTCTTGTATTTTTTTGTGG - Intronic
1106469622 13:30042839-30042861 ATGGATCTTGCATGTTAGTGAGG - Intergenic
1107467101 13:40661175-40661197 CTAAATGTAGCATCTTATTAAGG - Intronic
1109438104 13:62332861-62332883 CTAAATATTTCATTTTATTTTGG + Intergenic
1109919631 13:69039085-69039107 CTGAATATTGCATGATACTGAGG - Intergenic
1110602825 13:77395608-77395630 CTAATTCTTGTATTTTTTTGTGG - Intergenic
1111525192 13:89459288-89459310 CTACATCTTCCAAGTTCTTGAGG + Intergenic
1111993958 13:95144641-95144663 CTAAATATTTTATGTTTTTGTGG - Intronic
1112071159 13:95851952-95851974 CGAAATCTGGCATGTTATTGAGG + Intronic
1112658679 13:101481731-101481753 GAAAATCTTGCATGTTAGTGAGG - Intronic
1114144396 14:19956902-19956924 CTTTTTCTTGCATGTTTTTGGGG + Intergenic
1121894166 14:97630051-97630073 CAAAATTTGGCATGTTACTGTGG + Intergenic
1121975105 14:98396212-98396234 CTAAAGCTAACATGTTAATGAGG - Intergenic
1123803536 15:23847844-23847866 CTATATCTTGATTGTTATTGTGG + Intergenic
1125206351 15:37158082-37158104 CTAGAACTTGCAGGGTATTGGGG - Intergenic
1125239394 15:37556801-37556823 CTCAATCTTTCATTTTACTGAGG + Intergenic
1127386909 15:58474350-58474372 CTAAATTTTGTATTTTTTTGTGG - Intronic
1131816456 15:96226113-96226135 CTAAGTCCTGCATGTCATTCTGG - Intergenic
1132924147 16:2418949-2418971 CTAAATCTATCATCTTATTCAGG - Intergenic
1133062497 16:3183739-3183761 CTTAAAATTGCATGGTATTGCGG - Intergenic
1142915380 17:3132272-3132294 CAATATATTGCATGTTATTTTGG - Intergenic
1144096155 17:11902506-11902528 CTAAATCTTGCATGTTATTGGGG + Intronic
1144272829 17:13635239-13635261 GTAAATCTTTAGTGTTATTGAGG + Intergenic
1149032948 17:52104366-52104388 CTAATTCTTGCATTTATTTGTGG + Intronic
1150722602 17:67626323-67626345 CTAATTCCTGCATGTTCTTTGGG - Intronic
1151858980 17:76744844-76744866 CTAAAGCTTTCCTGTTCTTGTGG + Intronic
1155293907 18:24368318-24368340 CTACATCTGGCATGCTATTTTGG - Exonic
1155698510 18:28713883-28713905 CTAAATCTTGCCTGTGTCTGTGG + Intergenic
1156400742 18:36737399-36737421 TTAAATCATGCATGTTTTTAAGG + Intronic
1156804002 18:41154511-41154533 CAATATTTTGCATGTTATTTGGG + Intergenic
1161611461 19:5245452-5245474 CTAAATGTTTCATTTTTTTGTGG + Intronic
1163014529 19:14446170-14446192 CTAATTTTTGCATTTTTTTGTGG + Intronic
1164362676 19:27533316-27533338 TTAAATCTTTCATTTGATTGAGG + Intergenic
1165281801 19:34804116-34804138 CTAAAACCTGCATGTTGTTCTGG - Intergenic
1165714420 19:38035240-38035262 CTGAATCTTTCATTTTACTGAGG - Intronic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
927130302 2:20052898-20052920 CTAAAATTTGTATTTTATTGGGG - Intergenic
929663749 2:43816902-43816924 CAAAATCATGCAAGTTCTTGGGG - Intronic
930697196 2:54423829-54423851 TTAAATCTTGTGTGTTATTGGGG + Intergenic
931036427 2:58249034-58249056 CTAATTCTTGTATTTTTTTGTGG + Intergenic
932386914 2:71343400-71343422 CTAAATCCTGCATGCCACTGTGG - Intronic
932428802 2:71660771-71660793 TTAAATCTTGCATGTCTATGGGG + Intronic
932818156 2:74878072-74878094 CTAAATCTTGCATCACCTTGGGG - Intronic
934124660 2:88876050-88876072 CTATATCTTGAATGTGGTTGTGG + Intergenic
936787811 2:116115645-116115667 TTAAATCTGGCTTGTTATTATGG - Intergenic
938569681 2:132551260-132551282 CTGCATCTTCCGTGTTATTGGGG + Intronic
939466608 2:142563913-142563935 CTAAATCTGGATTGTTTTTGTGG + Intergenic
940265748 2:151834461-151834483 CTAAATGCTTCATGTAATTGAGG - Exonic
942036700 2:172016919-172016941 CTAATTCCTGCTTGTTCTTGAGG + Intronic
945112487 2:206374534-206374556 AAAAATTTTGTATGTTATTGGGG - Intergenic
946671344 2:222108127-222108149 CTAAATTTTGTATGTTGTTTTGG + Intergenic
947226312 2:227843806-227843828 CTAAAGCCTGCATGTGATTTTGG + Intergenic
1170882183 20:20306525-20306547 CAAAATCTTGCCTGTTAGAGGGG - Intronic
1171079201 20:22160939-22160961 CTAAATCTTACATGATTTGGAGG + Intergenic
1172309864 20:33909321-33909343 CTATATCTTGATTGTGATTGTGG - Intergenic
1174285499 20:49469840-49469862 CTGAATATTGGATGATATTGAGG - Intronic
1183030330 22:35099049-35099071 CTGAAGCTTGCATGCTATAGGGG - Intergenic
1183110297 22:35643836-35643858 CTAATTTTTGCATTTTTTTGTGG + Intergenic
951731710 3:25816519-25816541 CCAGATCTTGCATATTCTTGGGG + Intergenic
957738247 3:84229540-84229562 CCCAATCTTGCATATAATTGCGG - Intergenic
958453383 3:94301198-94301220 CTAAATTTTACATTTTATTTGGG - Intergenic
960920682 3:122744765-122744787 TGAAGTCTTTCATGTTATTGAGG + Intronic
962931222 3:140038678-140038700 CTAAATATTTCATGATAGTGAGG - Intronic
963957269 3:151268629-151268651 TTAAATCTAGAATGTTACTGAGG + Intronic
964001728 3:151782780-151782802 CTAAATGTTTCTTGTTAATGGGG - Intergenic
970465600 4:16319751-16319773 CCAAAATTTGGATGTTATTGGGG + Intergenic
971293290 4:25365224-25365246 CTGAATGTTGCATGCTTTTGTGG - Intronic
971551440 4:27962500-27962522 CTATATCTTGCTTGTTGTAGGGG + Intergenic
972160467 4:36219570-36219592 CTAAATCTTAATTGTTATAGTGG + Intronic
979594356 4:122517669-122517691 TTAAATCTTTCATTTTTTTGAGG - Intergenic
979680716 4:123456440-123456462 CTAAACCTTGTATATAATTGAGG - Intergenic
981095526 4:140775562-140775584 ATAAATTTTGAATGTAATTGTGG + Intergenic
983033595 4:162835122-162835144 CTAAATGCTGCATATTATTATGG + Intergenic
983290081 4:165790804-165790826 TTAAATCTTACATCTTTTTGAGG + Intergenic
984230441 4:177091326-177091348 CCAAACATTGCATTTTATTGTGG - Intergenic
984577927 4:181473000-181473022 CTTAATCCTGCTTGTAATTGAGG + Intergenic
986067393 5:4248263-4248285 GTCAATCTGACATGTTATTGGGG + Intergenic
986479621 5:8173432-8173454 CTCAATCTTGGAGGCTATTGTGG + Intergenic
987934275 5:24443686-24443708 CTAAAGCTTTCAACTTATTGGGG + Intergenic
989793371 5:45435256-45435278 CTGAAGCTTGCATGTTATCATGG + Intronic
989972172 5:50537656-50537678 CTAAATCTTGATTGTGATGGTGG - Intergenic
993201487 5:84821691-84821713 CTAAATTCTGCATTTTAATGTGG - Intergenic
994027818 5:95105384-95105406 CTAAATTTTTCATGGAATTGGGG + Intronic
994573258 5:101540897-101540919 CTAAATCTTGAATTTCAATGAGG - Intergenic
994735653 5:103551409-103551431 CTAAATTTTGCATGTTGAGGCGG - Intronic
998017399 5:138743432-138743454 ATGAATCTTACATTTTATTGAGG + Intronic
1001858255 5:175031514-175031536 CTAAATGTTGGATTTTCTTGGGG + Intergenic
1005446801 6:25932207-25932229 CTAATTTTTGCATTTTTTTGTGG - Intergenic
1006622833 6:35378496-35378518 CTAAATCTTGCAAATTAAAGTGG + Intronic
1008436010 6:51477478-51477500 CTAAATCATGGAGGTTATTCAGG - Intergenic
1008894409 6:56536240-56536262 CTACATCTTACAAGTAATTGAGG + Intronic
1011857090 6:91706845-91706867 TTAATTCTTACATGTTACTGTGG - Intergenic
1016252280 6:142058169-142058191 CTAAATCTTGCATGGTAAAATGG - Intergenic
1016806827 6:148219893-148219915 CAAAATGGTGCATGGTATTGAGG + Intergenic
1018048150 6:159982930-159982952 TTACATCTTGCAAGCTATTGTGG + Intronic
1018884944 6:167927462-167927484 CTAAATCCTGCATTTCTTTGTGG - Intronic
1019862820 7:3676129-3676151 CTAAATTTTGTATTTTTTTGTGG + Intronic
1019862827 7:3676181-3676203 CTAAATTTTGTATTTTTTTGTGG + Intronic
1020762527 7:12286184-12286206 CTAATTCTTGTATTTTTTTGTGG + Intergenic
1021812028 7:24411973-24411995 CTAATTCTTTCTTGTCATTGAGG - Intergenic
1024460919 7:49658610-49658632 ATTAAACTTGCATGTTAATGAGG + Intergenic
1026579247 7:71600132-71600154 CAAAATCTTAGATGTTATAGTGG + Intronic
1026952790 7:74358733-74358755 CTAAATTTTGTATTTTTTTGTGG + Intronic
1031901538 7:127416725-127416747 CTATATCTTGAATGTGATAGTGG + Intronic
1032688227 7:134257204-134257226 ATAAATCTTGCCTTTTAATGAGG - Intronic
1033209253 7:139448391-139448413 CTAAATTTATCATGTTATTTGGG - Intergenic
1033537542 7:142325967-142325989 CTAAATATTTTATGGTATTGGGG - Intergenic
1041502207 8:58551784-58551806 CTAAATATTTCATTTTATTTTGG + Intergenic
1043397301 8:79851488-79851510 CTAAATGTTCCATATTATGGTGG - Intergenic
1046072634 8:109276633-109276655 CTAAATCTGGGCTTTTATTGTGG - Intronic
1047660576 8:127030397-127030419 TTAATTCTTTCATGATATTGAGG - Intergenic
1048702582 8:137109550-137109572 CAAAAACTTGCATGTTACTCGGG - Intergenic
1052250854 9:26395464-26395486 TTAAAGCTTATATGTTATTGGGG - Intergenic
1055274986 9:74605139-74605161 CTTAATGTTGAATGTTATTTCGG - Intronic
1056057633 9:82844029-82844051 CCAAATCTTGCATGTATTTTGGG - Intergenic
1058495758 9:105557621-105557643 CTAAATCTTGAATGTCATAAAGG + Intergenic
1059935988 9:119311316-119311338 CTAAATCTTAAATGTAATTTTGG + Intronic
1060766385 9:126297419-126297441 CTATATCTGGCATTTTAATGAGG - Intergenic
1186052413 X:5612314-5612336 CTATATTTTGACTGTTATTGGGG + Intergenic
1186221223 X:7351374-7351396 CAAAATCATGCATCTCATTGTGG - Exonic
1189126159 X:38449275-38449297 CCAAATCTTGCATCTCACTGTGG + Intronic
1189739727 X:44105520-44105542 CTAAATCTTTCATGGTGCTGTGG - Intergenic
1189992271 X:46606829-46606851 CTAACTCTTCTATTTTATTGGGG - Exonic
1193378543 X:80790471-80790493 TTAAATCTGGCATGTTATTTGGG - Intronic
1193956730 X:87873028-87873050 CTAAATTTTGTATGTTATTATGG - Intergenic
1197080657 X:122411502-122411524 GTAGTTCTTGCATGTGATTGAGG - Intergenic