ID: 1144096581

View in Genome Browser
Species Human (GRCh38)
Location 17:11905450-11905472
Sequence CGAGCTGCTCACCTGGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144096581_1144096587 27 Left 1144096581 17:11905450-11905472 CCCAGATCCAGGTGAGCAGCTCG 0: 1
1: 0
2: 3
3: 10
4: 116
Right 1144096587 17:11905500-11905522 GACTTAATAAGCAGTGGACTTGG 0: 1
1: 0
2: 1
3: 11
4: 102
1144096581_1144096585 -5 Left 1144096581 17:11905450-11905472 CCCAGATCCAGGTGAGCAGCTCG 0: 1
1: 0
2: 3
3: 10
4: 116
Right 1144096585 17:11905468-11905490 GCTCGGCAACTAGCAGCACAAGG 0: 1
1: 0
2: 0
3: 4
4: 62
1144096581_1144096586 21 Left 1144096581 17:11905450-11905472 CCCAGATCCAGGTGAGCAGCTCG 0: 1
1: 0
2: 3
3: 10
4: 116
Right 1144096586 17:11905494-11905516 TGTGTTGACTTAATAAGCAGTGG 0: 1
1: 0
2: 1
3: 13
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144096581 Original CRISPR CGAGCTGCTCACCTGGATCT GGG (reversed) Intronic
900251282 1:1671449-1671471 CCCGGTGCTCACCTGCATCTGGG - Intronic
900529892 1:3148010-3148032 CCTGCTGCTCACCTGCAACTTGG + Intronic
903735426 1:25527349-25527371 CGAGCCGCACAGCTTGATCTCGG + Intergenic
910060926 1:83090628-83090650 TGAGCTGATGACCTTGATCTTGG - Intergenic
917729107 1:177856368-177856390 TGATCTGCTCACCTCGACCTGGG - Intergenic
918046020 1:180941455-180941477 GGAGCTGCTGACTTGGTTCTAGG - Intronic
924683325 1:246260365-246260387 TGTTCTGCTCACCAGGATCTGGG + Intronic
1067711743 10:48656013-48656035 GGGGCTGCTCACCTGGAACCAGG + Intronic
1068016053 10:51517444-51517466 CTTGCTGATGACCTGGATCTGGG + Intronic
1069962554 10:72087428-72087450 CGAGCTGCTCCCCTCGCTCCAGG + Intronic
1070160189 10:73862081-73862103 CACGCAGCTCACTTGGATCTGGG - Intronic
1070916748 10:80159955-80159977 CTTGCTGCTCACCTCGACCTAGG + Intronic
1071532447 10:86400544-86400566 CGCGCTCCTAACCTGGCTCTGGG + Intergenic
1074696652 10:116055803-116055825 TCAGCAGCTCACCTGGCTCTGGG - Intergenic
1075492105 10:122880088-122880110 CCAACTGCTCTCCTGGATCCCGG - Intergenic
1077134842 11:993371-993393 AGGGCCTCTCACCTGGATCTCGG - Exonic
1082976399 11:59076900-59076922 AGGGCTGCCCACCTGGAACTGGG + Intergenic
1083888053 11:65582273-65582295 CCAGCTGCTCACCTGGGGCCTGG - Exonic
1084118728 11:67056752-67056774 CGGGCCTCTCACCTGGCTCTCGG + Intergenic
1085013573 11:73157988-73158010 CCAGCAGCTCACCTGGACCACGG - Intergenic
1085295014 11:75426576-75426598 CCATCTGCACACCTGGATCAAGG - Exonic
1087237454 11:95735981-95736003 CGTGGGGTTCACCTGGATCTAGG + Intergenic
1088626047 11:111731470-111731492 CAAGCTGCTCTCCTGCATCCTGG + Intronic
1090750206 11:129739986-129740008 CCAGCTGCACACTTGGATTTTGG - Intergenic
1103240855 12:119412194-119412216 CAAGCAGCTCTCCTGAATCTTGG + Intronic
1104128176 12:125867253-125867275 CCAGCTGCACTCCTGGAGCTGGG + Intergenic
1104405270 12:128511639-128511661 CGAGATGCTCACCTGAACCTTGG + Intronic
1104639271 12:130457138-130457160 TGAGCTGCTCCCCTGAGTCTGGG - Intronic
1105253884 13:18726797-18726819 AGAGCTCCGCAGCTGGATCTAGG + Intergenic
1106394289 13:29365623-29365645 CCAACTGCCCACCAGGATCTGGG - Intronic
1111829707 13:93311846-93311868 CCAGCTTCTCGCCTGGATGTCGG + Intronic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1119190580 14:72679462-72679484 GGAGCTGCTCAGCTGGGGCTGGG - Intronic
1120394970 14:83957025-83957047 GGGGCTGCTCTCCTGGCTCTTGG + Intergenic
1121781970 14:96627815-96627837 GGAGCTGCCCACCTGCACCTGGG - Intergenic
1122479071 14:102034178-102034200 CGTGATTCTCACCTGGATGTTGG - Exonic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1124853217 15:33361120-33361142 CCAGCTGCTGACCTGGATCCAGG - Intronic
1125658895 15:41381076-41381098 CTAGCTGCTCACCTAAATCTTGG - Intergenic
1126850890 15:52796149-52796171 CTAGCTGCACCCCTGGACCTTGG - Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1132574275 16:657457-657479 CCAGCTGCTGACCTGGAGCTTGG - Intronic
1134833212 16:17340225-17340247 TGAGCTGCAGAACTGGATCTGGG - Intronic
1136450745 16:30353169-30353191 AAAGCAGCTCACCTGCATCTGGG + Exonic
1138137196 16:54533290-54533312 GGAGCTGCTCAGCTGGAGCTGGG + Intergenic
1139244521 16:65428438-65428460 CTACCTGATCACCTGGGTCTAGG + Intergenic
1144096581 17:11905450-11905472 CGAGCTGCTCACCTGGATCTGGG - Intronic
1144455541 17:15415368-15415390 CGTGCTGCTCACCTTGTTTTGGG + Intergenic
1145917474 17:28583946-28583968 CAGGTTGCTCACCTGGAGCTGGG - Exonic
1146182453 17:30706909-30706931 CAGGCTGGACACCTGGATCTGGG - Intergenic
1151828580 17:76537181-76537203 CGCGGTGTTCACCAGGATCTAGG - Intronic
1153074597 18:1148211-1148233 CGAGCTGTGCACCTGGGTTTAGG - Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1155841669 18:30652533-30652555 AGAGCTGCTTTCCTGGTTCTGGG + Intergenic
1157391899 18:47310021-47310043 AGAGCTGGTCACCTGGGACTTGG - Intergenic
1157781232 18:50441010-50441032 CCAGGAGCTCCCCTGGATCTGGG + Intergenic
1160440271 18:78884262-78884284 GCATCTGCTCACCTGGATCAGGG + Intergenic
1160815015 19:1031103-1031125 AGAGCTCCGCACCTGGATCGAGG + Exonic
1163584438 19:18156191-18156213 CTTGCTGCTCACCTGGCTCAGGG - Exonic
1163586494 19:18167168-18167190 CGTGCGGCTCTCATGGATCTCGG - Exonic
1166694956 19:44846957-44846979 CGAGTAGTTCACCCGGATCTGGG + Intronic
1166944252 19:46387443-46387465 CGCGCTGCTCACCTGAATCTGGG - Exonic
1167569869 19:50280373-50280395 AGGGCTGCTCACCTGGGCCTGGG - Exonic
1167660227 19:50791942-50791964 CACGCTGCTCTCCTGGATCTGGG + Intronic
1168707482 19:58478171-58478193 GGGGCTGCTCACCTGAATCCTGG - Exonic
925964930 2:9055872-9055894 AGCGCTGCTCAGCTGGAGCTGGG - Intergenic
926054863 2:9768554-9768576 CGCTCTGCTCACCTGCCTCTCGG - Intergenic
927501150 2:23584193-23584215 CCAGCTGCTCCCCTGGGCCTGGG + Intronic
929881429 2:45840541-45840563 GGAGCTGCTCACCTGAGTTTGGG - Intronic
930301222 2:49618475-49618497 CAAGGTGCTTTCCTGGATCTGGG - Intergenic
937141598 2:119606431-119606453 CGGGCTGCTCCCCTGTCTCTGGG + Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
940312947 2:152297698-152297720 AGAGCTGCTTGCCTGAATCTAGG - Intergenic
1170600346 20:17836777-17836799 GGAGCAGCACAGCTGGATCTTGG + Intergenic
1170613560 20:17932575-17932597 CCAGCTGCCCGCCTGGCTCTGGG + Intergenic
1171427395 20:25057553-25057575 CGAGCTGGGCACGTGGATCTGGG + Intronic
1172056521 20:32158107-32158129 CAACCTGGTCACCTTGATCTTGG - Intronic
1175760695 20:61560722-61560744 CGAGGTGGTCACCAGGACCTGGG - Intronic
1176371637 21:6065920-6065942 CACGATGCTCACCTGGACCTGGG + Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1176839393 21:13826792-13826814 AGAGCTCCGCAGCTGGATCTAGG + Intergenic
1177036005 21:16043717-16043739 CCATCTGCTCCCCTGGTTCTTGG - Intergenic
1179751882 21:43472619-43472641 CACGATGCTCACCTGGACCTGGG - Intergenic
1180144218 21:45910314-45910336 CTAGCTGGTCACATGGTTCTGGG + Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1183530889 22:38352699-38352721 CGTGGTGCTCTCCTGGCTCTTGG + Intronic
1185041572 22:48507040-48507062 CCAACTGCACACCTGGCTCTTGG - Intronic
1185085564 22:48738968-48738990 TGAGCATCTCACCTGGATCCTGG + Intronic
950005784 3:9690133-9690155 GGAGCTCCTCACCTGGGTTTGGG - Exonic
951803556 3:26623085-26623107 CGAGCTGCCCACCTGGGACCGGG - Exonic
952841981 3:37654296-37654318 CTATCTGCTCACTTGGATCAGGG - Intronic
954284881 3:49611849-49611871 GGAGCTGCTGACCTAGGTCTTGG + Intronic
968922612 4:3530542-3530564 CGAGCTGCTCACCTCCACTTTGG - Intronic
970104979 4:12571947-12571969 CAAGCTGCTCACCTGCATCTTGG + Intergenic
972995264 4:44871017-44871039 AGAGCTGATCACCTCAATCTAGG + Intergenic
976745836 4:88402249-88402271 CCAGCTTCTCACCTGTATCTAGG + Intronic
982435162 4:155376759-155376781 GGAGCTGCTCACCTTGGTCTGGG + Exonic
988094958 5:26594424-26594446 TGAGCTGCTCACCTGGAAGCTGG + Intergenic
997926298 5:138033411-138033433 TGTGCTCCTCACCTGGATATGGG - Intronic
1000341371 5:160279645-160279667 CCCGCTGCCCACCTGGTTCTGGG - Intronic
1003138999 6:3456241-3456263 CGTGCTGCTCACCTGGATCCCGG - Exonic
1003940994 6:11026428-11026450 CATGCTGCCCACCTGTATCTTGG - Intronic
1004546722 6:16604880-16604902 CCAGCTGACCACCTGGATTTTGG + Intronic
1007592963 6:43034428-43034450 AAAGCTTCTCACCTGGATTTGGG + Intergenic
1017802615 6:157911303-157911325 TGAGATGCTCACCTGAACCTAGG + Intronic
1018934826 6:168266869-168266891 CGAGCAACTCACCTGGTTTTTGG + Intergenic
1022349028 7:29549154-29549176 CTAGCTGATCACCTGGTTCCAGG - Intergenic
1023594009 7:41809983-41810005 CCTGCTGATCACCTTGATCTTGG + Intergenic
1028120318 7:87050042-87050064 GGAGGCCCTCACCTGGATCTTGG + Intronic
1028246190 7:88480487-88480509 CCATCTGCTCTCCTGGTTCTCGG + Intergenic
1028830585 7:95323165-95323187 CTAGCTACTCAACTGGGTCTGGG - Intronic
1033062559 7:138122538-138122560 CAAGCTGCTTACCTCAATCTCGG + Intergenic
1037882540 8:22579997-22580019 CTAGCTGCCCACCTCGTTCTTGG - Intronic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1041522655 8:58772525-58772547 CGTGGTGCTCACCTGCAACTTGG - Intergenic
1045163076 8:99571072-99571094 TGAGCTGCCTACCTAGATCTGGG - Intronic
1046968034 8:120189294-120189316 AGAGCTGCTAACCTGGATTTAGG + Intronic
1051693373 9:19741485-19741507 GGAGCTGCTCAGCTGGTACTTGG - Intronic
1056798714 9:89676565-89676587 CGAGCTGCACACCTGCCTCGCGG - Intergenic
1061094661 9:128448691-128448713 CCAGCTGCTCATTTGGATATAGG + Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1186052393 X:5612081-5612103 AGAGCTGCACACCTTTATCTAGG + Intergenic
1187993167 X:24897432-24897454 CGAACTGCACACCTGGCCCTTGG - Intronic
1189083048 X:37994613-37994635 TGAGCAGCTCAGATGGATCTTGG + Intronic
1189262441 X:39688467-39688489 CGAGCTGAGAACCTGGGTCTGGG - Intergenic
1190708892 X:53051164-53051186 GGAGCTGCTCACCTAGAGCCTGG + Intronic
1198422083 X:136478304-136478326 AGAGCTTCTTACCTGGCTCTAGG - Intergenic
1199849357 X:151714565-151714587 ACAGCTGCTCCACTGGATCTGGG + Intergenic