ID: 1144098462

View in Genome Browser
Species Human (GRCh38)
Location 17:11922994-11923016
Sequence CTTTGGGAATTAAGTGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 277}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144098462 Original CRISPR CTTTGGGAATTAAGTGAAGA GGG Intronic
903434706 1:23338542-23338564 CTCAGGGAATTTAATGAAGAAGG - Exonic
904808124 1:33145950-33145972 ATTTGGGAACTGAGTGAAGTGGG + Exonic
906732945 1:48098869-48098891 CTTTGGAAATCCAGTGAGGAGGG - Intergenic
908133177 1:61097629-61097651 ATTTGAAAATTAAATGAAGATGG - Intronic
909045777 1:70707332-70707354 CTTTGTGAGATAAGTAAAGAAGG + Intergenic
909875949 1:80803504-80803526 CTTGGGGAAATAATTGAAAATGG - Intergenic
910279985 1:85489142-85489164 CTTTGTGAATAAAGTTAAAATGG + Intronic
910596105 1:88982736-88982758 CTGTAGGAATCACGTGAAGAAGG + Exonic
911335766 1:96578276-96578298 CTTTTGGAATAAAGAAAAGAAGG + Intergenic
911524135 1:98964060-98964082 CTTTGGGAATCTAGTGAAAATGG - Intronic
911724133 1:101223908-101223930 CTTTGGGAAGTGATTGAGGATGG + Intergenic
912258081 1:108081574-108081596 CTTTGGCAAGTGGGTGAAGATGG - Intergenic
912869279 1:113289245-113289267 CAATGGGAAGTAAGTGGAGAGGG - Intergenic
913077588 1:115354065-115354087 CTTTGGGCCTTAAGTGAAAAAGG + Intergenic
914828722 1:151155101-151155123 GTTTGAGAGATAAGTGAAGAAGG - Intergenic
917300538 1:173569982-173570004 CCTTGGGCCTTAAGTGAACATGG - Intronic
918203893 1:182292025-182292047 CCTTGGGAATCAAGTGACCAAGG - Intergenic
918928604 1:190822175-190822197 CTTTAGGAATTTAGAGAAAATGG + Intergenic
923297340 1:232607724-232607746 ATATGGGAAATAAGTGCAGATGG - Intergenic
923448837 1:234097657-234097679 CTGTGGGAATTAAGAGGAGGAGG + Intronic
923886580 1:238164394-238164416 CTTTGAGCCTTAAGTGAACATGG - Intergenic
924175258 1:241385129-241385151 CCTTGGGAAGTAATTGAATATGG - Intergenic
924226860 1:241929031-241929053 CTTTGGGAAGTGACTAAAGATGG + Intergenic
924272725 1:242350524-242350546 CTTTGGTGATAAAGTGAAGCCGG - Intronic
1062896709 10:1108877-1108899 CTTTGAGAATTGGGTGAAGAGGG + Intronic
1064212074 10:13368285-13368307 TTTTGGAAATTTAGTGGAGACGG + Intergenic
1065276990 10:24095483-24095505 TTCTGGAAATTAAGAGAAGAAGG - Intronic
1066711986 10:38246123-38246145 CTTTGGTGATCAAGTGAAGCCGG + Intergenic
1068061852 10:52078151-52078173 CTAAGGGAATTAAGTGCATATGG - Intronic
1068830426 10:61487993-61488015 TTTTGAGAATTCAGTGAAGAGGG - Intergenic
1071377055 10:85017305-85017327 ATTGGGGAATGAAGAGAAGATGG - Intergenic
1073358321 10:102875070-102875092 CTTTGGGAAGTTACAGAAGATGG + Intronic
1073821119 10:107265159-107265181 CTTTGGGGATTAAAGGAAGCAGG - Intergenic
1074099221 10:110340801-110340823 CTTTGGGAGTTAACTCAGGATGG - Intergenic
1074273226 10:111975704-111975726 CTTTAGGAGTCAAGTGATGAAGG + Intergenic
1076094654 10:127721173-127721195 CTTTGGGCCTTAAGGGAACATGG + Intergenic
1077835813 11:5927121-5927143 CTTTGGGAATGCAGTGATTATGG - Intronic
1078321016 11:10334656-10334678 CCTTGGGAATAAAGGGAAGATGG + Intronic
1078590573 11:12637358-12637380 CTTGGGGAATTAAAAGAAGAAGG + Intergenic
1078841498 11:15079782-15079804 CTATGGGAATAAAGAGAAGAAGG + Intronic
1081035168 11:38135016-38135038 CTTTGGGAATTTGGTGATTATGG + Intergenic
1081157029 11:39705717-39705739 ATTTGGGAATTTAAGGAAGAGGG - Intergenic
1081234135 11:40625519-40625541 CTTTGGGAGGTAAGTGAATCAGG - Intronic
1083263839 11:61537186-61537208 CTTTGGGAATCATGGGAGGAGGG - Intronic
1085488847 11:76894589-76894611 CTTTGGGAATTAAATGTTAATGG + Intronic
1085674047 11:78498526-78498548 CTTTTGGAACTTAGAGAAGAGGG - Intronic
1087081455 11:94174718-94174740 CTTAGGGGATTAAGTGCAGATGG - Intronic
1087582166 11:100071219-100071241 TTTTGGGAAGTGAGTGAAAATGG + Intronic
1088127585 11:106447510-106447532 TTTTTGCAATAAAGTGAAGAGGG + Intergenic
1089181181 11:116583879-116583901 CATTGGGAGTTGGGTGAAGATGG - Intergenic
1093547856 12:20369251-20369273 CACTGGGAATTCAGTGAAGAGGG + Exonic
1093563230 12:20568814-20568836 TTTTGGGAATTTAGAGAATATGG + Intronic
1095615822 12:44187054-44187076 CCTTGAGAATTAAGTAAGGATGG - Intronic
1097512133 12:60556759-60556781 CTTTCTGAATGAAGTGAATAGGG + Intergenic
1098077965 12:66753660-66753682 CTCTGGGAACAAAATGAAGAGGG - Intronic
1098406694 12:70133954-70133976 GTTTGTAAATTAACTGAAGATGG - Intergenic
1098878700 12:75893681-75893703 CTCTTGGAAATAAGTGAAGGAGG - Intergenic
1101325936 12:103716047-103716069 CTTTGGGAATGAGGTGAAATGGG + Intronic
1103510355 12:121469283-121469305 CTTTGGGAATGGAGTGATGTGGG - Intronic
1103640859 12:122350800-122350822 CATTATGAATTAGGTGAAGAAGG + Intronic
1105315635 13:19259342-19259364 CATTGGGAATTTGGGGAAGATGG - Intergenic
1106465308 13:30008730-30008752 CTAGGGGAATTAGTTGAAGAAGG - Intergenic
1106571771 13:30934105-30934127 CTTTGAGAGTTCAGTTAAGAGGG + Intronic
1107511600 13:41091202-41091224 CTTTGGGGATTCAGTGGGGAAGG + Intergenic
1107987144 13:45785381-45785403 CTTTGGGAATGAACTGAAGCAGG - Intronic
1109421648 13:62120267-62120289 TTTTGGGAATTAAATGTTGAGGG + Intergenic
1111123478 13:83882327-83882349 CTTTCGGAATTACGTGGAGGGGG + Exonic
1112398450 13:99054912-99054934 GTTAGGAAAGTAAGTGAAGAAGG - Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112856641 13:103778794-103778816 CTATGGGAATTAACTGCAGGTGG - Intergenic
1113063545 13:106350878-106350900 TTTTGGGATGTAAGTGAAGATGG - Intergenic
1113389113 13:109878761-109878783 CGTTGGGAAATAACGGAAGAAGG - Intergenic
1114848573 14:26354326-26354348 CTTTTGGTATTAAGTGATGCTGG + Intergenic
1115012142 14:28561797-28561819 TTTTGGGAGTTTAGGGAAGAGGG + Intergenic
1116515112 14:45795767-45795789 ATTTGGCAATTAATTCAAGATGG - Intergenic
1117447020 14:55813818-55813840 CTTTCTGAATTAAGTCATGAAGG + Intergenic
1117568550 14:57021973-57021995 CTTTGGGAGTACAGTGCAGAAGG - Intergenic
1118490644 14:66255898-66255920 CTTTGAGAATGAAGTGGAAAGGG + Intergenic
1118896306 14:69948704-69948726 CTTTGGAATTTAATTGAAGGGGG - Intronic
1121510697 14:94510923-94510945 CTTTGGGGACTCAGGGAAGAAGG + Intronic
1122481184 14:102048533-102048555 CTTTGAGAGAGAAGTGAAGATGG + Exonic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1123633228 15:22276325-22276347 CTTTGGGAGATAGGTGATGAAGG - Intergenic
1124009372 15:25824606-25824628 GTTTAGGAAGTCAGTGAAGATGG + Intronic
1124460237 15:29883244-29883266 CCTTGGGACTTAAGTGACGCTGG + Intronic
1124994613 15:34710829-34710851 CTTTGGGAATCCAATGGAGAAGG + Intergenic
1125902144 15:43358478-43358500 TATTAGGAATTAAGGGAAGATGG - Exonic
1126177486 15:45750709-45750731 CTTTGGGAAGTAAGTAAAGTTGG - Intergenic
1126342725 15:47661015-47661037 CTTAGAAAATTAAGTGAATATGG - Intronic
1126394599 15:48201135-48201157 TTTTGTGAGTTAAGTCAAGAAGG + Intronic
1128255645 15:66194649-66194671 CTTTGGGGACTCAGGGAAGAAGG + Intronic
1128408785 15:67371572-67371594 CTCTGGATATTAAGAGAAGATGG + Intronic
1128846309 15:70899405-70899427 ATTTGGAAATCAAGTCAAGATGG - Intronic
1128899241 15:71404623-71404645 CTTTTGGAATTAAGTCATGAGGG + Intronic
1132791776 16:1694117-1694139 TTCTGGGATGTAAGTGAAGAAGG + Intronic
1133145910 16:3786489-3786511 ATTTGGAAATTCAGTGAAAACGG + Intronic
1134200630 16:12195679-12195701 TTTAGCGAATTAAGTGAACAGGG - Intronic
1134344699 16:13379033-13379055 CACTGGGAATTGAGTGATGAAGG - Intergenic
1135100190 16:19598538-19598560 CTTTGGGAAGCCAGTGCAGAAGG + Intronic
1141131853 16:81442935-81442957 CTTTAGGAATCAAGTAAAGAAGG - Intergenic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1144098462 17:11922994-11923016 CTTTGGGAATTAAGTGAAGAGGG + Intronic
1144476674 17:15594954-15594976 CTTTGGGATTCATCTGAAGAAGG - Intronic
1144875781 17:18396457-18396479 CTTTGGGAAGGAAGGAAAGAAGG - Intergenic
1145156447 17:20547964-20547986 CTTTGGGAAGGAAGGAAAGAAGG + Intergenic
1147186928 17:38717972-38717994 CTTTGGGAAGAAAGGGGAGAGGG - Intronic
1148103366 17:45106210-45106232 CTTTGAGAAGGAAGGGAAGATGG + Exonic
1151082341 17:71343329-71343351 GTTTGAGAATCAAGGGAAGAAGG + Intergenic
1151229971 17:72677454-72677476 CTTTAGGAAAAAAGAGAAGAGGG + Intronic
1151254015 17:72861092-72861114 CTTTTGGATTTAAGTTAAAATGG - Intronic
1153175835 18:2371915-2371937 CTCTGGGAATTTAGAGGAGAGGG - Intergenic
1153373656 18:4351008-4351030 CTTTAGGAGTTTAGTGAAAATGG + Intronic
1153892084 18:9526656-9526678 CTTTGGAAATGTAGTGATGAGGG + Intronic
1155098041 18:22579117-22579139 TTCTGTGAATGAAGTGAAGAGGG + Intergenic
1155548749 18:26942400-26942422 CTTTAGGATTTAACTGAAGAGGG - Intronic
1156231318 18:35156440-35156462 TTTTGAAAAATAAGTGAAGATGG + Intergenic
1156731499 18:40198808-40198830 CTATGGGAATTCAGTGAAAGAGG - Intergenic
1157942601 18:51945512-51945534 CTCTGGGAACTCAGTGAAAATGG + Intergenic
1158843303 18:61411829-61411851 CTTTGGGACTTGGGTGGAGAGGG + Intronic
1159510287 18:69389495-69389517 CTTTGGGACTTAAGGAAAAATGG + Intergenic
1160502623 18:79409950-79409972 GTTTGGGGTTTAAATGAAGATGG + Intronic
1162084193 19:8238575-8238597 CTGTGGGAAGGAAGTAAAGAGGG - Intronic
1165572440 19:36786627-36786649 CTTTGGTAATTAAGCCAAAAAGG + Intergenic
1167563854 19:50243794-50243816 CTTAGGGAAATGAATGAAGAAGG - Intronic
1167887206 19:52510527-52510549 CGTTTGCAATTAAGTGCAGATGG - Intronic
926426713 2:12744852-12744874 CTTTTGGAAGTAAGTCATGAGGG + Intergenic
926555854 2:14357003-14357025 TTTTGGGAAGGAAGTGAAAAGGG - Intergenic
928959841 2:36912778-36912800 CTTAGGTAACCAAGTGAAGATGG - Intronic
930041433 2:47128350-47128372 CTTTGGGCCTTGAGTGAACATGG - Intronic
933097934 2:78211083-78211105 CCTTGGGCATTAAGTGAAATCGG + Intergenic
933344329 2:81064690-81064712 CTATGAGAATAAACTGAAGATGG + Intergenic
933863528 2:86495033-86495055 CTTTGGAAAGTAAGTTACGAGGG + Intergenic
935723599 2:106001585-106001607 TTTTGTGTATGAAGTGAAGAAGG + Intergenic
936462511 2:112723444-112723466 CTTGGAGAAATATGTGAAGAAGG + Exonic
937866532 2:126755785-126755807 CTATCTGAATTAAGTGATGAAGG + Intergenic
939676952 2:145084450-145084472 CCTTGGGAATAAAGTGCAGGAGG - Intergenic
940253840 2:151708451-151708473 CGTTGGGAAGCAAGTGAAGGGGG - Intronic
941767384 2:169313196-169313218 CTTTGAGAGTTGAGAGAAGAAGG - Intronic
942718545 2:178922923-178922945 CTGTGGGTATTAAATGAAGCTGG + Intronic
943971593 2:194415398-194415420 CTTTGGGATTTAAGAGGAAATGG + Intergenic
946880642 2:224173979-224174001 CTTTGGGAATTCAATGATAAAGG - Intergenic
947673374 2:231956500-231956522 GTTGGGGAATTCACTGAAGAGGG - Intergenic
1169112213 20:3041593-3041615 GTGTGGGAATGAAGTGAGGAAGG - Intergenic
1171228172 20:23458746-23458768 CTTTGGGACTTTGGTTAAGATGG + Intergenic
1171792099 20:29536668-29536690 GTTTGGGATTAAAGAGAAGAAGG + Intergenic
1172086154 20:32384545-32384567 CTTTGGGAATTAGTCAAAGAAGG - Intronic
1172203543 20:33145677-33145699 CCTTGGGCTTTAAGTGAACATGG - Intergenic
1175004649 20:55669494-55669516 CTTTGTTAATTACCTGAAGAAGG + Intergenic
1176162387 20:63654292-63654314 CTTTGGGAGTTATGAGGAGAGGG - Intergenic
1176916271 21:14629465-14629487 CTGTGAGAATAAAATGAAGAAGG + Intronic
1179225610 21:39450487-39450509 CTCTGGGACTCAGGTGAAGAGGG + Intronic
1181681236 22:24497149-24497171 CTATGTGTATTAAGTGAAAAAGG + Intronic
1182806467 22:33074783-33074805 ATCTGGGAAGTAAGTGAAGGGGG + Intergenic
1183758166 22:39790221-39790243 CTTTGGCTTTTATGTGAAGAGGG + Intronic
950117367 3:10460109-10460131 CTCTGGGAATGAAGTGCTGATGG + Intronic
950300273 3:11871081-11871103 CTGTGGGAAATAGGTCAAGACGG + Intergenic
950487046 3:13280049-13280071 TTTTGAGAATTAAGCAAAGATGG - Intergenic
951117127 3:18877311-18877333 CTTAAGGAAATAATTGAAGAAGG - Intergenic
951379872 3:21969688-21969710 CCTTGGGCTTTAAGTGAACACGG + Intronic
951926339 3:27912657-27912679 CATTGGTAATTAAGTGGAAATGG - Intergenic
952057680 3:29468551-29468573 CTTTGAGAAATAACTTAAGATGG + Intronic
952672232 3:35983767-35983789 CTTTGAGAATCTAGGGAAGAAGG - Intergenic
953537206 3:43785549-43785571 CTTTGGGAATAGAATCAAGAAGG - Intergenic
953712401 3:45285612-45285634 TTTTGGGAATTTAGTGATGGTGG + Intergenic
954767813 3:52936213-52936235 CTTTGGTTAGTAAATGAAGAAGG - Intronic
957428375 3:80069700-80069722 TTTTGGGAGATAAGTTAAGAGGG - Intergenic
958175435 3:89990351-89990373 CATTGGGAAATAATTGAATATGG + Intergenic
959317847 3:104831824-104831846 GTTTGGGAATAGAGTGAAGGTGG + Intergenic
960465451 3:117992374-117992396 CTTTGGGAAACAAATGCAGAAGG - Intergenic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
963855322 3:150247528-150247550 GTTTGGCAAATAAGTGATGATGG - Intergenic
964382966 3:156116291-156116313 CATTGGGAGTCAAGGGAAGAAGG - Intronic
966828594 3:183986621-183986643 CTTTGCGAATAAAGTGATCATGG - Intronic
967328332 3:188265013-188265035 TTTGGGGAACTAAATGAAGAAGG - Intronic
967588021 3:191237970-191237992 CTTTGGGATTTTTGTCAAGAAGG - Intronic
969546635 4:7834342-7834364 CTTTGGGGATTCAGGGAAAAAGG + Intronic
970225273 4:13850932-13850954 CTTTTGTAATGAAGTCAAGAGGG - Intergenic
970695676 4:18674099-18674121 TTCTGGGAATTAAGGCAAGATGG + Intergenic
970837384 4:20426616-20426638 TTTTGGAAATTGATTGAAGAGGG + Intronic
971105240 4:23517438-23517460 CCTTGGGCTTTAAGTGAATATGG - Intergenic
971378790 4:26077824-26077846 ATTTGGGAATTTAGAGAAGATGG + Intergenic
971666976 4:29499955-29499977 CTGTGGGAATTCTGTGAACATGG - Intergenic
972153656 4:36129160-36129182 CATTGGAAATAAGGTGAAGATGG - Intronic
973663827 4:53137291-53137313 CTTTGGGAAAGAAGTGAGGAAGG - Intronic
973877939 4:55240509-55240531 TTTTGGGAATGGTGTGAAGAAGG - Intergenic
974015843 4:56648303-56648325 CTTAGGGAAGTAAGTTCAGAAGG + Exonic
974709767 4:65575315-65575337 GTTTGGACATCAAGTGAAGAAGG - Intronic
975110395 4:70617015-70617037 GTTTGAGAATAAACTGAAGAGGG + Intergenic
975566844 4:75765888-75765910 CTGAGGGTATTAAGTGAAGGTGG - Intronic
975748776 4:77501113-77501135 CTTAAGGAATTAAGTAAAGCAGG - Intergenic
977136053 4:93305946-93305968 CTATGGGAATTAATTTCAGATGG - Intronic
977622827 4:99156324-99156346 CTTTGGGAAATACCAGAAGAGGG + Intronic
977894797 4:102351328-102351350 GATTAGGAATTAAGTTAAGAGGG - Intronic
978263255 4:106789280-106789302 ATTTGGGAAATGAGTGAAGCAGG + Intergenic
978981362 4:114950192-114950214 TGTTGGGAATTAGGAGAAGATGG - Intronic
979292507 4:118993166-118993188 TTTTCGGAATTAATTAAAGAAGG + Intronic
979453131 4:120896172-120896194 ATTGGTGAATCAAGTGAAGAAGG + Intronic
979841241 4:125443393-125443415 CTGAGGGAATGTAGTGAAGACGG - Intronic
980467224 4:133201934-133201956 CTTTGGGAGCAGAGTGAAGAAGG + Intronic
981543990 4:145875464-145875486 CTTTGGAAAATAAGTGATGTGGG + Intronic
982637430 4:157914733-157914755 TTGTGGGAATTAAATGAAGTAGG - Intergenic
985276374 4:188241853-188241875 CTTTGTGTATTTAGTAAAGATGG + Intergenic
987323439 5:16791290-16791312 CTGTGGGAATTAAGAGAAAATGG - Intronic
987962264 5:24824980-24825002 CTTTCGGCATTAATTCAAGAAGG - Intergenic
988716107 5:33829817-33829839 CTTTGGGAATTGAGGAAAGCTGG - Intronic
988876378 5:35451462-35451484 CTTTGGGAACTCAGAGAAAAGGG + Intergenic
989152309 5:38312017-38312039 CTTTGAGAATTAAATGACGATGG - Intronic
990540505 5:56768048-56768070 CTATAGGAATTAAGTTAATATGG + Intergenic
990542676 5:56790235-56790257 CTTTGGGTACTTAGTGGAGAAGG + Intergenic
990587995 5:57230756-57230778 TTTTTGGAAATAAGTGAAGTTGG + Intronic
990753438 5:59041744-59041766 CTTTGGGAACTTGGTGAAGATGG - Intronic
990775060 5:59297323-59297345 CATTGGGATTTATGTGAAGTTGG - Intronic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991181187 5:63752917-63752939 CTTTGGGATTCCATTGAAGATGG + Intergenic
992710974 5:79455699-79455721 TTTTAGCAATTAAATGAAGAAGG - Intronic
993173082 5:84445791-84445813 GTTTGGAAATTCAGTAAAGATGG - Intergenic
994677784 5:102846764-102846786 CTTTGTAAATCAAGAGAAGAAGG - Intronic
994733853 5:103527331-103527353 TTTTGGGTATTATGTGAAGTAGG + Intergenic
995233285 5:109795854-109795876 CTTGGTCAATTAAATGAAGATGG - Intronic
995798466 5:115965109-115965131 CTGTGAGAATTAAATGAAAAAGG + Intronic
996853407 5:127977882-127977904 CATTGGGAAAGAAGTGAAGTGGG - Intergenic
996964822 5:129295266-129295288 CTTTGGTAATTAATAGAAGGAGG - Intergenic
997047463 5:130335644-130335666 GTTTGTGATTGAAGTGAAGAAGG - Intergenic
997479036 5:134169099-134169121 TTTTGGGAACCAAGTCAAGAGGG + Intronic
997843279 5:137262135-137262157 CTTTGGGGATTCATTGAATAGGG - Intronic
999481171 5:151949466-151949488 TTTTGGGAAGTAAGTCATGAGGG + Intergenic
1000510198 5:162171917-162171939 CTTTAGGAAGTAAGTAATGAGGG + Intergenic
1001001449 5:168011221-168011243 CTGTGGGAATGATGTGCAGATGG + Intronic
1002489643 5:179565769-179565791 CCTAGGGAAATAACTGAAGACGG - Intronic
1003253486 6:4454301-4454323 GTTTGGGAATTAGGGGTAGAGGG + Intergenic
1003934607 6:10962458-10962480 CCATGGGTATTAAGTGAAGATGG - Intronic
1004753695 6:18588749-18588771 CTTTGAGAATTAGCTGAACAGGG + Intergenic
1007033097 6:38646917-38646939 CTTTGGGAATTGAGTGGGAAGGG + Intergenic
1007045912 6:38773988-38774010 CTTCGAGGAGTAAGTGAAGAAGG + Intronic
1007331868 6:41117408-41117430 CTTTGTGACTTAAGGGAGGAAGG + Intergenic
1009813276 6:68697249-68697271 CTTTGGGATTTATTTTAAGATGG + Intronic
1010873495 6:81070931-81070953 AATTAGGAATTAAGAGAAGAAGG - Intergenic
1011546963 6:88491946-88491968 GTGTGGGACTTAAGTGAACAGGG - Intergenic
1011816419 6:91196638-91196660 CTTTTGGAATTAACTTAAAATGG + Intergenic
1014296428 6:119624174-119624196 ATATTGGAAATAAGTGAAGATGG - Intergenic
1014429592 6:121352138-121352160 CTTGGGGAGTAAAGTGAGGAGGG + Intergenic
1014755005 6:125292827-125292849 CTTTGGGAAGTAAGTATATATGG - Exonic
1014939430 6:127421074-127421096 CTGTCTGAATTAGGTGAAGATGG + Intergenic
1015237704 6:130989854-130989876 ATTTGGGAATTAAGAGAGCAAGG + Intronic
1015514332 6:134069656-134069678 CTTTGGGACTTTAGAGAAGAAGG + Intergenic
1015696885 6:135990468-135990490 CTTTGGGAAACAAGTGGTGAGGG + Intronic
1017449652 6:154542754-154542776 CTTTGGGAACTAATTCAGGAAGG - Intergenic
1017565147 6:155675986-155676008 CTTTGTGAAATAAGGGAAAATGG - Intergenic
1020390417 7:7651701-7651723 CTTTGGGAATTGAGTGAACCAGG - Intronic
1021384121 7:20007349-20007371 TTATCTGAATTAAGTGAAGAAGG + Intergenic
1021424331 7:20482473-20482495 CTTTGGGAATTAGCTAAACATGG - Intergenic
1022634004 7:32114453-32114475 CCTTTGGAATTAACTCAAGATGG + Intronic
1023085601 7:36567449-36567471 CTCTGTGAATTAAATGAAGATGG + Intronic
1023123632 7:36934066-36934088 CTCTGGGAATGAAGCCAAGAGGG + Intronic
1024224475 7:47315168-47315190 TTGTGGGAATTAAGGGCAGAAGG - Intronic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1025320968 7:58092773-58092795 TTTTGAGAACTACGTGAAGAAGG + Intergenic
1026001487 7:66562195-66562217 CTTTGGGAAGTCAGGGCAGAAGG - Intergenic
1026218055 7:68366993-68367015 CTTTGGGAATTCAGAGGAAAGGG - Intergenic
1026669203 7:72372681-72372703 CTTTGGAAATTAACTGAAATTGG + Intronic
1028629061 7:92913763-92913785 TTTTGGGAATAAAGTTACGAGGG + Intergenic
1029411307 7:100413130-100413152 CTTTGGTGATTAATTGGAGATGG - Intronic
1030797584 7:113807716-113807738 TTTTGGGAATAATGTGAATAAGG - Intergenic
1031763369 7:125742589-125742611 CTTGGCGAAAGAAGTGAAGAAGG + Intergenic
1032720935 7:134550445-134550467 ATTTGGGATATAAGTCAAGAAGG + Intronic
1033928827 7:146498303-146498325 CTCTGTGAAGTAATTGAAGATGG - Intronic
1035093159 7:156331075-156331097 CTCTGGAAATTGAGTTAAGAAGG + Intergenic
1035966406 8:4196884-4196906 ATGTGGGAATTTAATGAAGATGG - Intronic
1037159586 8:15751923-15751945 CTTAGGGAACTAAGTGATAAAGG + Intronic
1038196554 8:25373399-25373421 CTTTGGGAACTCAGTGGGGAAGG - Intronic
1038937583 8:32269255-32269277 ATTTGGAAATAAAGTGAAGGAGG + Intronic
1039239432 8:35539233-35539255 CTTTGGGAATTTGGTGACAATGG + Intronic
1039617022 8:38963917-38963939 ATTTAGTAATTTAGTGAAGACGG - Intronic
1041040469 8:53841413-53841435 CTTAGGGAGTTAAGTGTAGTGGG - Intronic
1042008423 8:64209591-64209613 CTTTGGGGATTAAGTTTTGATGG + Intergenic
1044360228 8:91274599-91274621 CTTTAAGAATTAAGTTATGAGGG - Intronic
1044900021 8:96934368-96934390 CTGGGGGAGCTAAGTGAAGAGGG + Intronic
1045238064 8:100373755-100373777 ATTTGGGAAAAGAGTGAAGAAGG + Intronic
1045686840 8:104721330-104721352 CTTTGGGAAATAATTCATGAGGG - Intronic
1045815489 8:106271749-106271771 GTTTGGGATGTAAGTGGAGAGGG - Intronic
1046050510 8:109016255-109016277 TTTTAAGAATTAAGTGAATAAGG - Intergenic
1047074339 8:121382924-121382946 ATATGGGAAGTAACTGAAGAGGG - Intergenic
1048884509 8:138898880-138898902 CATAGGGAATTTAGTGTAGAGGG - Intronic
1049138138 8:140924319-140924341 CTGTGGGAATAAAATGAAGCAGG - Intronic
1049754571 8:144304130-144304152 ATTTGGGAATTGAGGGGAGAAGG + Intronic
1050249616 9:3730975-3730997 ATTAGGAAATGAAGTGAAGAGGG - Intergenic
1052777496 9:32747263-32747285 CTGTGGGAATTAAGTAAGAATGG + Intergenic
1053826701 9:42032366-42032388 CTGTGGATTTTAAGTGAAGATGG - Intronic
1054603858 9:67155057-67155079 CTGTGGATTTTAAGTGAAGATGG + Intergenic
1055185139 9:73442210-73442232 TTCTGGGAAGTAAGTGAATAGGG + Intergenic
1057372164 9:94484012-94484034 CTTTAAAAATTAAGAGAAGATGG + Intergenic
1058211324 9:102173675-102173697 CTTTGCGAGTTGAGAGAAGAAGG - Intergenic
1058416458 9:104794042-104794064 CTTTGAGAATTAGGTGATCAGGG - Intronic
1059048241 9:110894483-110894505 CTTTGCGTATTCACTGAAGAAGG - Intronic
1059526439 9:114995436-114995458 CTTTGGGCATTAATTGAATTTGG + Intergenic
1060865672 9:126994186-126994208 CTTTGAGAGTTGAGAGAAGAAGG + Intronic
1187793674 X:22978356-22978378 CTTTGAGAATTAAGGGAAGTCGG - Intergenic
1189163296 X:38833370-38833392 TTCTGGGAACAAAGTGAAGAGGG - Intergenic
1190420477 X:50225445-50225467 CTGTGGGAAATTACTGAAGAAGG + Intronic
1190504029 X:51108174-51108196 TTTTGAGTGTTAAGTGAAGAGGG - Intergenic
1190605184 X:52134182-52134204 CTCAGGGAATTGAGTGAGGATGG + Intergenic
1192418832 X:71010386-71010408 CTTTGGTGACTAAGTGAATATGG - Intergenic
1196038288 X:111171699-111171721 TTTTGGGAACTAAGGGAAGATGG + Intronic
1197296843 X:124729588-124729610 CATTGGGAATTTTGAGAAGAAGG + Intronic
1197556347 X:127959690-127959712 CTTTGGGAATTCAGGGGATAAGG - Intergenic