ID: 1144099034 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:11927796-11927818 |
| Sequence | GATCCTCGAGGCTGCCCCAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 121 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 8, 4: 110} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1144099034_1144099037 | -5 | Left | 1144099034 | 17:11927796-11927818 | CCTGTGGGGCAGCCTCGAGGATC | 0: 1 1: 0 2: 2 3: 8 4: 110 |
||
| Right | 1144099037 | 17:11927814-11927836 | GGATCTCTGAATCCACCCCAGGG | 0: 1 1: 0 2: 3 3: 9 4: 170 |
||||
| 1144099034_1144099036 | -6 | Left | 1144099034 | 17:11927796-11927818 | CCTGTGGGGCAGCCTCGAGGATC | 0: 1 1: 0 2: 2 3: 8 4: 110 |
||
| Right | 1144099036 | 17:11927813-11927835 | AGGATCTCTGAATCCACCCCAGG | 0: 1 1: 0 2: 0 3: 20 4: 206 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1144099034 | Original CRISPR | GATCCTCGAGGCTGCCCCAC AGG (reversed) | Intronic | ||