ID: 1144099034

View in Genome Browser
Species Human (GRCh38)
Location 17:11927796-11927818
Sequence GATCCTCGAGGCTGCCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144099034_1144099037 -5 Left 1144099034 17:11927796-11927818 CCTGTGGGGCAGCCTCGAGGATC 0: 1
1: 0
2: 2
3: 8
4: 110
Right 1144099037 17:11927814-11927836 GGATCTCTGAATCCACCCCAGGG 0: 1
1: 0
2: 3
3: 9
4: 170
1144099034_1144099036 -6 Left 1144099034 17:11927796-11927818 CCTGTGGGGCAGCCTCGAGGATC 0: 1
1: 0
2: 2
3: 8
4: 110
Right 1144099036 17:11927813-11927835 AGGATCTCTGAATCCACCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144099034 Original CRISPR GATCCTCGAGGCTGCCCCAC AGG (reversed) Intronic