ID: 1144099036

View in Genome Browser
Species Human (GRCh38)
Location 17:11927813-11927835
Sequence AGGATCTCTGAATCCACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 206}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144099024_1144099036 13 Left 1144099024 17:11927777-11927799 CCAACCCAAGCCCATCAACCCTG 0: 1
1: 0
2: 0
3: 38
4: 272
Right 1144099036 17:11927813-11927835 AGGATCTCTGAATCCACCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 206
1144099023_1144099036 14 Left 1144099023 17:11927776-11927798 CCCAACCCAAGCCCATCAACCCT 0: 1
1: 0
2: 1
3: 13
4: 225
Right 1144099036 17:11927813-11927835 AGGATCTCTGAATCCACCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 206
1144099033_1144099036 -5 Left 1144099033 17:11927795-11927817 CCCTGTGGGGCAGCCTCGAGGAT 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1144099036 17:11927813-11927835 AGGATCTCTGAATCCACCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 206
1144099031_1144099036 2 Left 1144099031 17:11927788-11927810 CCATCAACCCTGTGGGGCAGCCT 0: 1
1: 0
2: 2
3: 13
4: 202
Right 1144099036 17:11927813-11927835 AGGATCTCTGAATCCACCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 206
1144099026_1144099036 9 Left 1144099026 17:11927781-11927803 CCCAAGCCCATCAACCCTGTGGG 0: 1
1: 0
2: 2
3: 33
4: 286
Right 1144099036 17:11927813-11927835 AGGATCTCTGAATCCACCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 206
1144099034_1144099036 -6 Left 1144099034 17:11927796-11927818 CCTGTGGGGCAGCCTCGAGGATC 0: 1
1: 0
2: 2
3: 8
4: 110
Right 1144099036 17:11927813-11927835 AGGATCTCTGAATCCACCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 206
1144099030_1144099036 3 Left 1144099030 17:11927787-11927809 CCCATCAACCCTGTGGGGCAGCC 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1144099036 17:11927813-11927835 AGGATCTCTGAATCCACCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 206
1144099028_1144099036 8 Left 1144099028 17:11927782-11927804 CCAAGCCCATCAACCCTGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 185
Right 1144099036 17:11927813-11927835 AGGATCTCTGAATCCACCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144099036 Original CRISPR AGGATCTCTGAATCCACCCC AGG Intronic