ID: 1144107223

View in Genome Browser
Species Human (GRCh38)
Location 17:11997232-11997254
Sequence CATGGCTGGGAGTGGACCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144107223_1144107241 29 Left 1144107223 17:11997232-11997254 CCCACGGTCCACTCCCAGCCATG 0: 1
1: 0
2: 0
3: 21
4: 150
Right 1144107241 17:11997284-11997306 CCCGCGCGCTCCCAGACGCATGG 0: 1
1: 0
2: 1
3: 9
4: 72
1144107223_1144107243 30 Left 1144107223 17:11997232-11997254 CCCACGGTCCACTCCCAGCCATG 0: 1
1: 0
2: 0
3: 21
4: 150
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144107223 Original CRISPR CATGGCTGGGAGTGGACCGT GGG (reversed) Intronic
901103609 1:6738129-6738151 CATGGCTGGGAGTAGGGGGTGGG + Intergenic
901470713 1:9454495-9454517 CATGGGTGGGAGGGCACAGTAGG + Intergenic
903000953 1:20265438-20265460 CTTGGCTGGGAGTGGAACTGGGG - Intergenic
903241265 1:21984189-21984211 CTTGTCTGGGAGTGGCCCGTTGG - Exonic
903244772 1:22007373-22007395 CTTGTCTGGGAGTGGCCCATTGG - Exonic
906073365 1:43034119-43034141 CAGGGCTGGGACTGGAACCTTGG + Intergenic
907237317 1:53061621-53061643 CAGGGATGGGAGTGGAGGGTGGG + Intergenic
907330447 1:53667519-53667541 CAAGGTTGGGAATGGACCTTGGG - Intronic
912681472 1:111731965-111731987 CGTGGCTGGGAGTGGGCAGGAGG - Intronic
915265269 1:154712324-154712346 CTGGGGTGGGAGTGGAACGTGGG - Intronic
919701847 1:200639026-200639048 CCTGCGTGGGAGTGGACTGTGGG + Intronic
920546190 1:206820666-206820688 CATGGCTGGGTGAGAACAGTGGG + Intronic
921822032 1:219628305-219628327 CAAGGCTTGGTGTGGACGGTGGG - Intergenic
1062976180 10:1685023-1685045 CATGGGTGGGTGGGGACTGTGGG + Intronic
1063909697 10:10817060-10817082 CATGGCGGGCAGTGGACGGTGGG + Intergenic
1068942873 10:62697641-62697663 CATGGCTTGGAGTGCCCCATGGG - Intergenic
1070649895 10:78227788-78227810 CATGGCTGGGAATGGCACGGTGG + Intergenic
1070829076 10:79407752-79407774 CAGAGCTGGGAGTGGAGCGCAGG + Intronic
1072259065 10:93650041-93650063 TAGGGCTGGGAGTGGACAGTGGG - Intronic
1073448385 10:103594503-103594525 CATGGCTGGGTGGGGACTGGTGG - Exonic
1074130312 10:110567942-110567964 CAGGGCTGGGCGGGGACTGTGGG + Intronic
1076274344 10:129184071-129184093 CTTAGCTGGGAGTGGGCAGTTGG - Intergenic
1077329959 11:1979818-1979840 CATGGCTGGGAGGGGGCCACGGG + Intronic
1078563300 11:12391633-12391655 CATGGCTGGAAGTGTAGCTTGGG - Intronic
1078874961 11:15384202-15384224 CATGGCTGGGACTGGAGCCCTGG + Intergenic
1086413929 11:86570089-86570111 CATGGCTGTGTGTGTGCCGTGGG - Intronic
1090602277 11:128385859-128385881 CATGGCAGGGAGTGGAAATTAGG - Intergenic
1202812936 11_KI270721v1_random:34997-35019 CATGGCTGGGAGGGGGCCACGGG + Intergenic
1093522076 12:20062782-20062804 CATGTCTGGCAGTGGACGCTTGG - Intergenic
1095863550 12:46947038-46947060 CATGGCTGGGAGCAGCCCATGGG - Intergenic
1096101282 12:48971785-48971807 CAAGGCTGGGAGTGGAGGGTAGG - Intergenic
1097964336 12:65562999-65563021 CAGGACTGGGAGTTGACCTTCGG + Intergenic
1103953692 12:124565548-124565570 TTTGGCTGGGGGTGGACAGTGGG - Intronic
1104375608 12:128263559-128263581 GATGGATGGGTGTGGACTGTGGG - Intergenic
1105256971 13:18750154-18750176 CATGGATGGGAGGGGGCCGGGGG - Intergenic
1105585420 13:21738660-21738682 CAGGGCTGGGACTGGAACGAGGG + Intergenic
1105685422 13:22776219-22776241 AAAGGCTCGGAATGGACCGTGGG + Intergenic
1112599184 13:100838570-100838592 CATGGCTGGGAGTGGAGTGGGGG + Intergenic
1120272705 14:82334938-82334960 CATGGCTGGGGGTGGGCCTCAGG + Intergenic
1120969388 14:90194638-90194660 CAAGGCTGGGATTGGAGCATTGG - Intergenic
1121266294 14:92604483-92604505 CCTGGCTAGGAGGGGACCTTTGG - Intronic
1121357792 14:93230378-93230400 CATTGCTGAGAGTGGACCGCAGG + Intergenic
1121639298 14:95474687-95474709 CCTTTCTGGAAGTGGACCGTGGG - Intronic
1121887919 14:97561724-97561746 GCTGGCTGGGAGTGGAGGGTGGG - Intergenic
1122087676 14:99318800-99318822 CTTGGCTGGGAGTGGCCTGTGGG - Intergenic
1124357768 15:29009547-29009569 TATGGCTGGGAGAGGACCCTAGG - Intronic
1130908870 15:88257450-88257472 CTTGGCTGGGAGGGGACTGCGGG + Intergenic
1131540664 15:93272393-93272415 CAAGGCTAGCAGTGGACCCTGGG - Intergenic
1132145926 15:99429871-99429893 CCTGGCTAGGAGTAGTCCGTTGG - Intergenic
1132149827 15:99451619-99451641 GCTGGATGGGAGAGGACCGTGGG - Intergenic
1132722233 16:1322109-1322131 CATTGCTGGAAGTGGCTCGTGGG + Intronic
1132892655 16:2211857-2211879 CCAGGCTGGGAGTGGGCAGTTGG + Exonic
1138658032 16:58501789-58501811 CAGGGCTGGGAGAAGACAGTGGG + Intronic
1141985444 16:87576848-87576870 CATGTCAGGGAGTGGACAGCAGG + Intergenic
1143720033 17:8802958-8802980 CTTGGGTGGGAGAGGACAGTGGG + Exonic
1144013787 17:11174643-11174665 CATGGCAGAGAGTGGAGTGTGGG + Intergenic
1144107223 17:11997232-11997254 CATGGCTGGGAGTGGACCGTGGG - Intronic
1146446373 17:32936130-32936152 CATGGCTGGGAGAGGACCTGGGG - Intronic
1146669087 17:34724520-34724542 CAGAGCTGGGACTGGACCTTGGG - Intergenic
1150009151 17:61488418-61488440 CAGGGCTGGGACTGGGCCGGTGG + Intergenic
1152281111 17:79385310-79385332 CATGGCTGGTAGTGGACATGGGG - Intronic
1152286741 17:79417012-79417034 CATGGCAGGGAGTGGAAAGGCGG + Intronic
1152555975 17:81053508-81053530 CATGGCTGGGATTTGAACTTGGG + Intronic
1152573618 17:81130930-81130952 CAGGGCTGGGAGTGGCCTGTGGG - Intronic
1154429119 18:14294868-14294890 CATGGATGGGAGGGGGCCGGGGG + Intergenic
1154431389 18:14311212-14311234 CATGGATGGGAGGGGGCCGGAGG + Intergenic
1154434066 18:14330518-14330540 CATGGATGGGAGGGGGCCGGAGG + Intergenic
1156026621 18:32662226-32662248 CTTGGCTGGGAGTAGTCTGTGGG - Intergenic
1158053581 18:53253840-53253862 CATGGCTGGGAGTGGAGGAAGGG - Intronic
1161732592 19:5970528-5970550 CATGACTGGGAGTGGATGGGTGG + Intronic
1162760989 19:12887933-12887955 CCTGGGTGGGATAGGACCGTTGG + Intergenic
1162783876 19:13022300-13022322 CGTGGCTGGGTGTGGGCCGAAGG + Intronic
1163894933 19:20050599-20050621 CATGGCTGGAGGTGGGCGGTCGG + Intergenic
1165864315 19:38926826-38926848 CATGGCTGGGTGTGGCACTTTGG + Intronic
1165893339 19:39127575-39127597 CATTGCTGGGGGTTGACTGTTGG + Intronic
1166901579 19:46067913-46067935 CATTGCTGGAAGTGGAGCATAGG - Intronic
926698045 2:15784423-15784445 GATGGCTGGGAGGGGACTGCTGG + Intergenic
931124009 2:59253526-59253548 CAAGGCTGGCAGTGGACTATAGG + Intergenic
932008817 2:67954927-67954949 CATGGCTAGCAGTTGACAGTAGG - Intergenic
932385530 2:71329091-71329113 CCTGGCTGGGAGTTCACCCTCGG + Intronic
933450324 2:82441357-82441379 CATGGATGGGAGTGGGGCGGGGG - Intergenic
934856323 2:97732582-97732604 CGTGGCTGGGTGTCCACCGTGGG + Intronic
936060949 2:109295448-109295470 CAGGGCAGGGAGAGGACCCTGGG + Intronic
937294250 2:120800115-120800137 CAGGGCTGGGTGTGGACAGTGGG + Intronic
938391813 2:130912582-130912604 CATGCCTGGGAGGGGCCGGTGGG + Intronic
938778542 2:134563194-134563216 CCTGGCTGGCAGTGGAGCCTTGG - Intronic
938976764 2:136486151-136486173 CATGGGTGGGAGTTGAACGGCGG - Intergenic
941712552 2:168729458-168729480 CATGGATGGGAGTGGAAAGTTGG - Intronic
943392947 2:187293267-187293289 CATAGATGGGATTGGAACGTAGG - Intergenic
946210581 2:218144109-218144131 TATGGCTGAGAGTGGATCCTGGG + Intergenic
946264202 2:218524385-218524407 GATGGCTGGGAGTGGAGCAGTGG - Intronic
946526919 2:220530614-220530636 CAGTGCTGGGAGTGGGCAGTGGG - Intergenic
1169001807 20:2173354-2173376 CATGTGTGGGAGTGGACATTTGG + Intronic
1170456353 20:16537287-16537309 AATGGTTGGGAGTTGACCGTGGG - Intronic
1171777887 20:29387806-29387828 AATGCCTGGGACTGGACCTTTGG + Intergenic
1172287812 20:33753360-33753382 CCTGGCTGGGAGTGGAACGGTGG + Exonic
1175989233 20:62779258-62779280 CATGGCAGGGAGGGGACCTGTGG - Intergenic
1176848389 21:13894106-13894128 CATGGATGGGAGGGGGCCGGGGG - Intergenic
1179171502 21:38976555-38976577 CAGGGCTGGGAGTAGAGTGTAGG - Intergenic
1179449903 21:41461266-41461288 CATGGCTGGGAATGGAGGGGTGG - Intergenic
1180190165 21:46159094-46159116 CTTGGCTTGGAGTGGCCCCTGGG - Intergenic
1181542562 22:23581271-23581293 CTGGGCTGGGAGAGGACCGGGGG - Intergenic
1181582331 22:23835171-23835193 CAGGGCTGGGAAGGGACCCTGGG - Intronic
1181734581 22:24871654-24871676 CATGGCTGGGATTTGAACGCTGG + Intronic
1184297644 22:43535243-43535265 CCTGGCTGGGGCTGGACTGTGGG + Intronic
1184415373 22:44349122-44349144 CACAGCTGGGAGTTGACCTTGGG - Intergenic
1184932199 22:47689769-47689791 CATGCCTAGGAGTGGAGAGTTGG + Intergenic
1185368857 22:50449791-50449813 CATGGCTGGAAGTTGACAGTTGG - Intronic
950426580 3:12927739-12927761 ACTGGCTGGGAGTAGGCCGTGGG + Intronic
950645339 3:14373618-14373640 CATGGCTGGGGAAGGACAGTGGG + Intergenic
950704259 3:14770132-14770154 AATGGCAGGGACTGGACCATAGG + Intronic
954404829 3:50339875-50339897 AACTGCTGGGAGTGGACCCTAGG - Intronic
961380595 3:126494331-126494353 CATGGCTGAGAAGGGGCCGTGGG - Intronic
962284672 3:134075903-134075925 CATGTCTGGGAGTGGAGCCTGGG - Intronic
964478307 3:157117076-157117098 CATTGCTGGGGGTGGAGGGTGGG + Intergenic
966769953 3:183494653-183494675 CAAGGCTGGGCGGGGACAGTGGG + Intronic
967521289 3:190435803-190435825 CCTGTCTGGGAGAGGTCCGTGGG - Intronic
968452580 4:682216-682238 CAGGGCCGGGTGTGGACCGAGGG - Exonic
968914719 4:3492410-3492432 GATGGCTGGGTATGGAGCGTGGG + Intronic
969092383 4:4704525-4704547 CATGGCTGGCTGTGGAACCTCGG - Intergenic
969201664 4:5611223-5611245 CATGCCTGGTGGTGGACCCTGGG + Intronic
969398438 4:6938190-6938212 CTTGTCTGGGGGAGGACCGTGGG + Intronic
970928872 4:21485404-21485426 CATGGATGGGAGTGGGGAGTAGG - Intronic
973764734 4:54152690-54152712 CAAGCCTGGAAGTGGACTGTAGG - Intronic
976002454 4:80388050-80388072 CCTGGCTGGGAGTGGAATGGTGG - Intronic
985058652 4:186057032-186057054 GATGGCTGGGGGTGGATGGTGGG - Intergenic
985058857 4:186057543-186057565 GATGGCTGGGAGTGGATGGCGGG - Intergenic
985638996 5:1054434-1054456 CCTGCCTAGGAGGGGACCGTGGG - Intronic
986038494 5:3963408-3963430 AATGGTTGGGAGTGGCCCGTCGG + Intergenic
987342416 5:16950593-16950615 CATGGCAGGAAGAGGACCATGGG - Intergenic
988594994 5:32583049-32583071 CAAGGCTTGGAGTGGAAAGTGGG + Intronic
990979746 5:61591995-61592017 CAGGGCTGGTAGCTGACCGTTGG + Intergenic
996321469 5:122222174-122222196 CTTGGCTGGGAGTGGGGAGTTGG - Intergenic
997303205 5:132821482-132821504 CATGGTTGGGCGTGGGCAGTTGG - Intergenic
1001603409 5:172943691-172943713 CAGAGCTGGGATTGGACCGCAGG + Intronic
1001773488 5:174312298-174312320 CAGGGCTGGGACTCGACCCTCGG - Intergenic
1001992893 5:176132861-176132883 CATGGGTGGGAGTGGAGTGCGGG + Intergenic
1002995101 6:2275339-2275361 AATGGCTGGGGGTGGAGTGTGGG + Intergenic
1006903588 6:37518354-37518376 CAGGGCTAGGAGTGGAGCCTGGG - Intergenic
1007686358 6:43669502-43669524 CATGGTTGGAGGTGGCCCGTGGG + Intronic
1008275997 6:49545017-49545039 ATTGGCGGGGAGTGGACCTTAGG - Intergenic
1011720473 6:90150789-90150811 AATGGCTGGGAGTAGCCCTTGGG + Intronic
1016004897 6:139079419-139079441 CAGGGCTGGAAGTGGATCATTGG + Intergenic
1016020511 6:139232133-139232155 CATGGCTGGGACTGGACATGGGG + Intergenic
1016985800 6:149895041-149895063 CAGGGTTGGGAGTGGACCACCGG - Intronic
1019166839 6:170102878-170102900 CCTGGCGGGGAGAGGACCGGAGG + Intergenic
1019196642 6:170287028-170287050 CAGGGCAGGGAGTAGACAGTGGG + Intronic
1026396818 7:69963788-69963810 CATGGCTGGGATTGGAACCAGGG + Intronic
1027162614 7:75813588-75813610 CATGGCTGGGATGGCACAGTGGG - Intronic
1029469765 7:100746840-100746862 CATGGCTGGGAGGGCACTTTGGG + Intronic
1036129568 8:6096687-6096709 CATGGCCAGGAGGGGACCTTGGG - Intergenic
1038347094 8:26742485-26742507 CAAGGCTGGGAGTGGAGCCAGGG - Intergenic
1039792614 8:40887774-40887796 CATGGCTGTGAGAGGACCGAAGG - Intronic
1043516786 8:81002002-81002024 CATGGCTGGGAGTAAGCAGTGGG - Intronic
1044712110 8:95067963-95067985 TGTGGGTGGGAGTGGACCATAGG + Intronic
1046752809 8:117942864-117942886 CAGGGCTGGGAGTAGACCCTGGG - Intronic
1047643533 8:126845956-126845978 CAAGGCTGGGACTGGACCTCAGG + Intergenic
1048225042 8:132577107-132577129 CATGGCTGGAAGGGCACAGTAGG - Intronic
1048877790 8:138850618-138850640 CTTGGCTGGGAGAGGACAGATGG - Intronic
1048926663 8:139277898-139277920 GATGACTGGGAGTGGACAGAGGG + Intergenic
1051184261 9:14442121-14442143 CAGGGCTGGGACTGGAGCCTAGG + Intergenic
1056289493 9:85128382-85128404 CCTGGCTGGGAGTGGAGGATGGG + Intergenic
1057403289 9:94743684-94743706 CATGGCTGGGAATGGAGTGGAGG + Intronic
1058495800 9:105558029-105558051 CGAGGCTGGGGCTGGACCGTGGG + Intergenic
1062226513 9:135455501-135455523 CCTGGGTGGAAGTGGACCGGGGG - Intergenic
1062541418 9:137043294-137043316 CAGGCCTGGAAGTGGACCCTGGG - Intronic
1062568042 9:137171902-137171924 CATGGCTGGGAGTGGAGTGCGGG + Exonic
1189516420 X:41717354-41717376 CATGAATGGGAGTGGACTGAGGG + Intronic
1190327602 X:49216285-49216307 AATGGGTGGGAGTGTACCTTGGG - Intronic
1192326223 X:70134418-70134440 CTGGGCTGGGAGTGGACCAGAGG - Intronic
1197148982 X:123198964-123198986 CATGGCTGGGAGAGCCCAGTTGG - Intronic
1200471772 Y:3594638-3594660 CAGGGTTGGGAGTGGACCGCCGG - Intergenic