ID: 1144107224

View in Genome Browser
Species Human (GRCh38)
Location 17:11997233-11997255
Sequence CCATGGCTGGGAGTGGACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144107224_1144107241 28 Left 1144107224 17:11997233-11997255 CCACGGTCCACTCCCAGCCATGG 0: 1
1: 0
2: 3
3: 21
4: 232
Right 1144107241 17:11997284-11997306 CCCGCGCGCTCCCAGACGCATGG 0: 1
1: 0
2: 1
3: 9
4: 72
1144107224_1144107243 29 Left 1144107224 17:11997233-11997255 CCACGGTCCACTCCCAGCCATGG 0: 1
1: 0
2: 3
3: 21
4: 232
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144107224 Original CRISPR CCATGGCTGGGAGTGGACCG TGG (reversed) Intronic
900207756 1:1438881-1438903 CCTTGGCTGGGGGAGGACGGAGG - Intronic
900269395 1:1779153-1779175 CCAAGGCTGGCAGTGGAGGGAGG + Intronic
900679000 1:3905864-3905886 CCAGGGCTGGGTGTGAACCTGGG - Intergenic
900712380 1:4122572-4122594 CCATGGCTGAGAGGGTACCCCGG - Intergenic
900877214 1:5351491-5351513 CCTTGGCTGGGCGTGCATCGAGG + Intergenic
901221444 1:7586124-7586146 GCCTGGCTGGGAGTGGAGCCTGG - Intronic
901447049 1:9314875-9314897 CCAGGGCAGGGAGAGGACTGCGG + Intronic
901787300 1:11633133-11633155 GCAGAGCTGGGAGTGGACGGAGG - Intergenic
901811143 1:11767271-11767293 CCATGGCTGGGTGGGGACAGGGG + Intronic
902391741 1:16111061-16111083 CCCAGGCTTGGAGTGGATCGGGG - Intergenic
903000954 1:20265439-20265461 TCTTGGCTGGGAGTGGAACTGGG - Intergenic
903515955 1:23911222-23911244 CCTTGGCTGGGAGGGGACCGAGG + Intronic
903733843 1:25517479-25517501 CTATGGCTGGGACTGGACTTGGG + Intergenic
904028675 1:27520587-27520609 CCATGGCTGGCTGGGGACCTTGG + Intergenic
905017304 1:34786458-34786480 CCATGGCTCGGGGTGGAGCTAGG + Intronic
907303111 1:53500506-53500528 CCATGGTTTGGAGGGGGCCGAGG - Intergenic
907920491 1:58906735-58906757 CTCTGGCTGGGAGTGGAGCTGGG - Intergenic
908002657 1:59695727-59695749 CCAGTGCTGGGCCTGGACCGTGG + Intronic
915265270 1:154712325-154712347 CCTGGGGTGGGAGTGGAACGTGG - Intronic
915431643 1:155871466-155871488 CCAAGGCTGGGAGTAGAACATGG + Intronic
916560562 1:165931133-165931155 CCATGGCTGGGGCTGGGCCTTGG + Intergenic
916924439 1:169502914-169502936 CCATGGCTGGCCGGGGACCTTGG - Intergenic
918704328 1:187641638-187641660 CCCTGGCAGGGAGGGGACAGTGG - Intergenic
919701845 1:200639025-200639047 CCCTGCGTGGGAGTGGACTGTGG + Intronic
920070768 1:203301447-203301469 CCTTGGGTGGGAGTGGAGGGAGG + Intergenic
921172520 1:212561785-212561807 CCATGGCTTGGACTGGATTGTGG + Intergenic
921316980 1:213901322-213901344 CCATGGCTGGAAGAGGACCTGGG - Intergenic
921822033 1:219628306-219628328 CCAAGGCTTGGTGTGGACGGTGG - Intergenic
922399725 1:225239409-225239431 CCTTGGCTGGGGGTGGAAGGGGG + Intronic
922553844 1:226518191-226518213 CCATTGCTGGGAGTGGAAGCAGG + Intergenic
1063240307 10:4162742-4162764 CCAGGGCTGGGAGTGAACCCAGG - Intergenic
1063422761 10:5926641-5926663 CCATGGTTTGGAGTGGAGAGAGG + Intronic
1063909696 10:10817059-10817081 ACATGGCGGGCAGTGGACGGTGG + Intergenic
1064175022 10:13067183-13067205 CCCTGGCTGGGAGGGGAGCGGGG - Intronic
1068811143 10:61257203-61257225 ACATGGATGGGAGTGGCCAGAGG + Intergenic
1069910184 10:71754196-71754218 CCATGGCTGGGGGTGGGTGGGGG - Intronic
1070919076 10:80172739-80172761 CAGTGGCTGGGAGTGGAGAGGGG - Intronic
1071945163 10:90635565-90635587 CCAAGGCAGGGAGTGCACAGAGG - Intergenic
1072259066 10:93650042-93650064 CTAGGGCTGGGAGTGGACAGTGG - Intronic
1073133420 10:101205520-101205542 CCAAGGCTCGGCGTGGACCTAGG - Intergenic
1074130311 10:110567941-110567963 CCAGGGCTGGGCGGGGACTGTGG + Intronic
1075443161 10:122494986-122495008 CAGTGGCGGGGAGTGGACTGGGG + Intronic
1075719362 10:124575909-124575931 CCAGGGCTGGGTGAGGACCTGGG + Intronic
1076727715 10:132421268-132421290 CCATGGCTGGGGGTGGGGCTGGG - Intergenic
1077249682 11:1555477-1555499 GCATGGCTGGGAGGGGGGCGGGG + Exonic
1077329958 11:1979817-1979839 CCATGGCTGGGAGGGGGCCACGG + Intronic
1077354586 11:2109222-2109244 CCATGGCTGGGAGAGGGTCAGGG + Intergenic
1077510431 11:2957978-2958000 CCGAGGCTGGGAGTGGTCCCCGG + Intronic
1078033434 11:7777778-7777800 CCAGGGTTTGGAGTGGACAGAGG + Intergenic
1078762327 11:14261226-14261248 ACAGGACTGGGAGTGGAGCGGGG - Intronic
1079245609 11:18750115-18750137 CCTTGGCTGGCTGTGGACCTGGG - Intronic
1083174050 11:60938440-60938462 CCAGGGCTGGGGTTGGACCCAGG - Intronic
1083730081 11:64648159-64648181 CTATGGCTGGGAATGGACCCTGG + Intronic
1084187699 11:67483557-67483579 CCAGGGCCGGGAGTGGTCCTCGG + Intronic
1089571030 11:119409911-119409933 ACATGGCTGGCAGTGGATGGTGG + Intergenic
1089806232 11:121093361-121093383 ACATTGCATGGAGTGGACCGTGG - Intergenic
1202812935 11_KI270721v1_random:34996-35018 CCATGGCTGGGAGGGGGCCACGG + Intergenic
1091743236 12:2974714-2974736 CCAGGGCAGGGCGTGCACCGAGG + Intronic
1096500423 12:52061134-52061156 CCAGGGCTGGGAGTGGAGTGGGG + Intergenic
1096596296 12:52697911-52697933 CCATGGCCTGGGGTGGACTGGGG - Intronic
1096636655 12:52964732-52964754 CAAGGGCTGGGAGTGGAGAGAGG + Intergenic
1100004034 12:89872635-89872657 CCATGGCTTGGATTAGACGGTGG + Intergenic
1102404795 12:112663993-112664015 CCATGGTTGGGAGTGGGATGGGG + Intronic
1103953693 12:124565549-124565571 CTTTGGCTGGGGGTGGACAGTGG - Intronic
1105256972 13:18750155-18750177 TCATGGATGGGAGGGGGCCGGGG - Intergenic
1105281122 13:18963096-18963118 CCAGAGCTGGGACTGGACCCCGG + Intergenic
1105290325 13:19049108-19049130 CCAGAGCTGGGACTGGACCCCGG + Intergenic
1105585419 13:21738659-21738681 GCAGGGCTGGGACTGGAACGAGG + Intergenic
1105685421 13:22776218-22776240 CAAAGGCTCGGAATGGACCGTGG + Intergenic
1112193602 13:97202837-97202859 CCATGGCTGGGTTTGAACTGGGG + Intergenic
1112599183 13:100838569-100838591 GCATGGCTGGGAGTGGAGTGGGG + Intergenic
1113345970 13:109478879-109478901 CCAGAGCTGGGAGCGGACCCAGG + Intergenic
1113458923 13:110468314-110468336 CCATGGATGGAATTAGACCGGGG - Intronic
1113766901 13:112887603-112887625 CCAGGGCTGGGAGTGGCAGGGGG - Intergenic
1114734687 14:25032337-25032359 CCAGGGCTGAGTGTGGACTGAGG - Intronic
1115075829 14:29389254-29389276 CCATGGGTGGCAGTGGCCTGCGG + Intergenic
1115486754 14:33917797-33917819 CCAGGGCTGGGTGTGGACAAGGG - Intergenic
1117200033 14:53380719-53380741 CCGTGAATGGGAGTGGACTGGGG + Intergenic
1117327897 14:54685701-54685723 CCATGGTTGGGAGTGGTGTGTGG + Intronic
1119091762 14:71789468-71789490 CCATGGCTGGGATTAGAGCAAGG - Intergenic
1121639300 14:95474688-95474710 CCCTTTCTGGAAGTGGACCGTGG - Intronic
1121656850 14:95603414-95603436 CCCTGTCTGGGAGTGGGCAGGGG + Intergenic
1122087677 14:99318801-99318823 CCTTGGCTGGGAGTGGCCTGTGG - Intergenic
1123114449 14:105888209-105888231 CAATGGCTGGGAGTGAGCCCAGG - Intergenic
1123118660 14:105906865-105906887 CAATGGCTGGGAGTGAGCCCAGG - Intergenic
1123120885 14:105916483-105916505 CGATGGCTGGGAGTGAGCCCAGG - Intergenic
1124404244 15:29379772-29379794 CCAGGGCTGGGGGTGGCGCGCGG + Intronic
1125479214 15:40069178-40069200 CCAGGGCTGGGAGGCGACAGCGG - Intergenic
1125748015 15:42010472-42010494 TCATTGCTGGGGGTGGACAGGGG - Intronic
1129061909 15:72867153-72867175 CCATGGCTGGGAGAAGCCAGAGG - Intergenic
1129230855 15:74196509-74196531 CCTGGGCTGGGTGTGGACCCGGG + Intronic
1130045529 15:80441474-80441496 CCATGGCTGGGAGGGGGGTGAGG - Intronic
1130653171 15:85773747-85773769 CCAGGGCTGGGAGTGGGAAGGGG + Intronic
1130908869 15:88257449-88257471 TCTTGGCTGGGAGGGGACTGCGG + Intergenic
1132382952 15:101379239-101379261 CCACGGCTGGGGGTAGACAGAGG + Intronic
1132582438 16:691191-691213 CCATGGCTGGAGGTGGGCAGGGG - Intronic
1132722232 16:1322108-1322130 CCATTGCTGGAAGTGGCTCGTGG + Intronic
1132863283 16:2081893-2081915 ACACGGCTGGGAGTGGTCCCTGG + Intronic
1134691300 16:16192415-16192437 CTCTGGCTGGGAGTGGAGAGAGG + Intronic
1135499055 16:22978042-22978064 CAATGGCAGAGAGTGGTCCGGGG - Intergenic
1136577569 16:31133496-31133518 CCATGCCTGGGAGGGGACAAAGG - Intronic
1138141221 16:54570279-54570301 CCTTTGCTGGGAGTGGGCAGTGG + Intergenic
1138585790 16:57969877-57969899 CCATGGCTGGGAGAGGGGTGGGG - Intronic
1138658031 16:58501788-58501810 CCAGGGCTGGGAGAAGACAGTGG + Intronic
1141655749 16:85415554-85415576 CCCTGGCTGGTAGGGGACGGGGG - Intergenic
1142216523 16:88832637-88832659 CCATGTCTGGGAGTGAGCCAGGG - Intronic
1142618463 17:1150595-1150617 CTAGGACTGGGAGTGGACGGCGG - Intronic
1143642479 17:8206989-8207011 CCAGGGCTGGGAGTGGTAAGGGG + Intronic
1143642569 17:8207539-8207561 CCAAGCCTGGGGGTGGACGGGGG - Intronic
1144107224 17:11997233-11997255 CCATGGCTGGGAGTGGACCGTGG - Intronic
1146058134 17:29591186-29591208 CCATAGCTGGGGGTCGATCGGGG - Intronic
1146183471 17:30710826-30710848 CCATGGCTGGGGGTGGATGGGGG - Intergenic
1146446374 17:32936131-32936153 GCATGGCTGGGAGAGGACCTGGG - Intronic
1146669088 17:34724521-34724543 CCAGAGCTGGGACTGGACCTTGG - Intergenic
1147050879 17:37794055-37794077 CCATGGCTGTGAGATGACCCAGG + Intergenic
1148865597 17:50626578-50626600 CCAGGGCTGGGCGGGGTCCGAGG - Exonic
1148878577 17:50707731-50707753 CCATGGCCGGGAGCGGGCCGCGG - Exonic
1151585479 17:75005831-75005853 CCATGGCTGGGCGTGACGCGAGG - Intergenic
1152005089 17:77675661-77675683 CCATGGCTGGGAGGGGAGGAGGG - Intergenic
1152281112 17:79385311-79385333 CCATGGCTGGTAGTGGACATGGG - Intronic
1152573619 17:81130931-81130953 ACAGGGCTGGGAGTGGCCTGTGG - Intronic
1154349665 18:13572413-13572435 CCTGGGCTGGGAGTGGAAGGAGG + Intronic
1154429118 18:14294867-14294889 TCATGGATGGGAGGGGGCCGGGG + Intergenic
1154501562 18:15000216-15000238 CCATCGCAGGGAGAGGACGGGGG - Intergenic
1155998331 18:32356886-32356908 CCATGGTTGGGGGTGGAGGGTGG - Intronic
1157298862 18:46465402-46465424 CCATGGCAGGAAGTGGGCAGAGG - Intergenic
1158053582 18:53253841-53253863 GCATGGCTGGGAGTGGAGGAAGG - Intronic
1160682469 19:418096-418118 CCATGGTAGGGTGTGGACGGAGG - Intronic
1162026824 19:7899088-7899110 CCATGGCAGGGACCGGGCCGGGG + Exonic
1162402283 19:10453458-10453480 CCAGGGCTGGGCGTGGATGGCGG + Intronic
1162975320 19:14204934-14204956 GCATGGCTGGGGGTGGATGGGGG + Intronic
1163275786 19:16283494-16283516 CCCAGGCTGGGAGGGGACCCCGG - Intergenic
1163695321 19:18760821-18760843 CCATGTCTGGGAAAGGACAGAGG - Intronic
1166296486 19:41892531-41892553 CCAAGGGTGGGTGGGGACCGTGG + Intronic
1167204016 19:48087642-48087664 CCATGCCTGGCTGTGCACCGTGG - Intronic
1168398452 19:56068222-56068244 CCAGGGCTGGGAGAGGAGCAGGG + Intergenic
925018037 2:546430-546452 CCATGGCAGGGACGGGCCCGTGG + Intergenic
929412452 2:41712315-41712337 CCATGTCTTCGAGTGCACCGAGG - Intergenic
930427861 2:51234299-51234321 CCATGGCCAGGAGTGTACCTTGG + Intergenic
933450325 2:82441358-82441380 CCATGGATGGGAGTGGGGCGGGG - Intergenic
934856322 2:97732581-97732603 CCGTGGCTGGGTGTCCACCGTGG + Intronic
936656029 2:114488787-114488809 CCAGGGCTGGGACTGGACTTTGG - Intronic
937294249 2:120800114-120800136 ACAGGGCTGGGTGTGGACAGTGG + Intronic
938391812 2:130912581-130912603 CCATGCCTGGGAGGGGCCGGTGG + Intronic
939576442 2:143900957-143900979 CCCTGGCTGTGAGGAGACCGGGG + Intergenic
940878463 2:158922111-158922133 CCATAGCTTGGAGTGGATGGGGG + Intergenic
942925918 2:181432130-181432152 CAATGGCTGGGAGTGGGGTGAGG - Intergenic
946543032 2:220706841-220706863 CCAGGGCTGGTAGAGGACAGAGG - Intergenic
947496967 2:230644779-230644801 CCAGGGCTGGGACTGGAATGAGG - Intergenic
947700966 2:232233610-232233632 CCATTGCTGAGACTGGACAGTGG - Intronic
947826293 2:233107975-233107997 CCATGCCTGGGAGAGGCCAGTGG + Intronic
1169143118 20:3237206-3237228 CCAGGGCTGGGTGAGGACAGAGG + Intronic
1170456354 20:16537288-16537310 GAATGGTTGGGAGTTGACCGTGG - Intronic
1173739007 20:45382812-45382834 CCAGGGCTGGGAGTGGGAAGAGG - Intronic
1175094541 20:56531071-56531093 CCAAGGCTGGGAATGAACCTAGG - Intergenic
1175913317 20:62414699-62414721 CCATGGCAGGTAGTGGAGGGAGG + Intronic
1176107776 20:63397690-63397712 CGATGCCTGGGAGGAGACCGTGG - Intergenic
1176848390 21:13894107-13894129 TCATGGATGGGAGGGGGCCGGGG - Intergenic
1179485232 21:41705771-41705793 CCATGTCTGTCAGTGGCCCGTGG - Intergenic
1179799593 21:43804720-43804742 CCAGGGCTTGGAGTGGGCCTGGG + Exonic
1180106055 21:45618849-45618871 AGATGGCTGGGAGTGGGCAGGGG + Intergenic
1181542563 22:23581272-23581294 GCTGGGCTGGGAGAGGACCGGGG - Intergenic
1183077697 22:35437151-35437173 CCATGGCTGGGAATTGACCAGGG + Intergenic
1183475742 22:38034854-38034876 CCAGGGCTGGGAGTGGTGGGAGG + Intronic
1183623083 22:38986161-38986183 CCATGGCTGGGGGTGTCCCAGGG + Intronic
1183629641 22:39025419-39025441 CCATGGCTGGGGGTGTTCCAGGG + Intronic
1183633094 22:39045290-39045312 CCATGGCTGGGGGTGTCCCAGGG + Intronic
1184229437 22:43150866-43150888 CCCTGCATGGGAGTGGACCTGGG + Intergenic
1184415374 22:44349123-44349145 CCACAGCTGGGAGTTGACCTTGG - Intergenic
1184905906 22:47486613-47486635 CCATGGTGGGGTGGGGACCGAGG - Intronic
1184943026 22:47782650-47782672 ACAGGGCTGGGAGGGGACAGGGG + Intergenic
950031399 3:9856274-9856296 CGATGGCTGGGAGTGGTGTGTGG + Intergenic
950426579 3:12927738-12927760 CACTGGCTGGGAGTAGGCCGTGG + Intronic
950431660 3:12954420-12954442 CCAGGGCTGGGAGAGGCCCTGGG + Intronic
950645338 3:14373617-14373639 CCATGGCTGGGGAAGGACAGTGG + Intergenic
953032851 3:39189355-39189377 CCAGGGCTGGGGGTGGAGGGAGG + Exonic
954576198 3:51677678-51677700 CCTAGGCTGGGTGTGGACCCAGG + Intronic
957119807 3:76075246-76075268 CCAAGGCTGAGAGTGGCCAGGGG + Intronic
960943249 3:122948191-122948213 CCCTGGCTGGGGGTGGCCAGGGG - Intronic
962284673 3:134075904-134075926 CCATGTCTGGGAGTGGAGCCTGG - Intronic
966395456 3:179498388-179498410 CCATTGATGGGAGTGGAACTGGG + Intergenic
966905881 3:184525670-184525692 CCCTGGCTGTGTGTGGCCCGCGG - Intronic
968452581 4:682217-682239 TCAGGGCCGGGTGTGGACCGAGG - Exonic
968491456 4:892613-892635 CGGTGCCTGGGAGTGGACCCTGG + Intronic
968807789 4:2786819-2786841 CCATCCTTGGGAGTGGACCTTGG - Intergenic
968893406 4:3384848-3384870 CCAGGGCTGGCAGTGGACCCCGG + Intronic
969512074 4:7623829-7623851 CCAGGGCTGGGGGTGGAGCAAGG - Intronic
973712398 4:53642831-53642853 CCATGGCTGGGAGGGATCTGGGG - Intronic
973789031 4:54361747-54361769 ACATGGCTGGGGCTGGACAGTGG + Intergenic
981573519 4:146178321-146178343 CCATGACTGAGAGTGGAAAGAGG + Intronic
982478137 4:155877713-155877735 CCCTGGCAGGGAGGGGAGCGAGG + Intronic
985058858 4:186057544-186057566 GGATGGCTGGGAGTGGATGGCGG - Intergenic
985511220 5:315326-315348 GCAGCGCTGGCAGTGGACCGAGG - Intronic
985764511 5:1769611-1769633 CCGTGGGTGGGAATGGAACGTGG + Intergenic
986568775 5:9143918-9143940 CCATGGCTAGGATTGTACCAGGG + Intronic
988594993 5:32583048-32583070 CCAAGGCTTGGAGTGGAAAGTGG + Intronic
989568641 5:42925139-42925161 CTATGGCTGGGAGTGGGAAGGGG - Intergenic
995022373 5:107381033-107381055 CCAGGGCTGGGGGTGGGGCGGGG + Exonic
997425758 5:133801631-133801653 CCCTGGCTGGCAGTGGGGCGGGG - Intergenic
998372395 5:141670385-141670407 CCATGCCTGGGAATGGGCTGGGG - Intronic
1001992892 5:176132860-176132882 GCATGGGTGGGAGTGGAGTGCGG + Intergenic
1006514967 6:34540790-34540812 CCAGGGCTGGGAGTGGGTTGGGG + Intronic
1006982196 6:38155518-38155540 CCATGGGTGGGAGTGGGCCGTGG + Intergenic
1007686357 6:43669501-43669523 CCATGGTTGGAGGTGGCCCGTGG + Intronic
1010083185 6:71887044-71887066 CCGTGGGTGGGCGAGGACCGCGG - Exonic
1011720472 6:90150788-90150810 CAATGGCTGGGAGTAGCCCTTGG + Intronic
1016020510 6:139232132-139232154 ACATGGCTGGGACTGGACATGGG + Intergenic
1019441306 7:1048745-1048767 CCATAGCAGGGTGTGGACAGGGG - Intronic
1019896545 7:3987817-3987839 CCAAGGCTGTGAGTGGCCCACGG - Intronic
1022669323 7:32441079-32441101 CCAATGCTGGAAGTGGACCGTGG - Intergenic
1026018978 7:66693671-66693693 CCAGGGCTGGGAGTGCAGCCTGG + Intronic
1026396817 7:69963787-69963809 GCATGGCTGGGATTGGAACCAGG + Intronic
1026881416 7:73909005-73909027 CCAGGGCTGGGAGTGCAGCCTGG - Intergenic
1028482797 7:91326070-91326092 CCATGAGTGGGAGTGGAAGGAGG + Intergenic
1032057923 7:128698400-128698422 GCATGGCTGGGATTGAACCAGGG - Intergenic
1036773117 8:11592438-11592460 CCAGGGCAGGGAGTGAGCCGAGG - Intergenic
1037766002 8:21772638-21772660 TCATGGCAGGGAGTGGTCCCTGG + Intronic
1037906094 8:22716857-22716879 CCATGCCTGGCAGAGGACCAGGG - Intronic
1038347095 8:26742486-26742508 ACAAGGCTGGGAGTGGAGCCAGG - Intergenic
1038584356 8:28775999-28776021 TAATGGCGGGGAGTGGATCGGGG - Intronic
1040997222 8:53414023-53414045 CCCTGGCCGGGAAGGGACCGGGG + Intergenic
1043401775 8:79891648-79891670 CCAGTGCTGGGGGTGGAGCGGGG - Intergenic
1043414617 8:80034101-80034123 CCATAGTTGGGAGGGGGCCGAGG + Intronic
1043882127 8:85555834-85555856 CCCTGGCTGGTAGTGAACAGAGG + Intergenic
1045564432 8:103299005-103299027 CCACGGCTGGGACTGGGCAGGGG + Intronic
1046752810 8:117942865-117942887 TCAGGGCTGGGAGTAGACCCTGG - Intronic
1046910536 8:119621496-119621518 CCGTGGCTGGGAGTGTACTAAGG - Exonic
1048293506 8:133197882-133197904 CCATGGCTGGGAGGGGATGAAGG + Intronic
1048637315 8:136311495-136311517 CCTTGGATGGGAGTGGACTGAGG - Intergenic
1048926662 8:139277897-139277919 GGATGACTGGGAGTGGACAGAGG + Intergenic
1049673637 8:143880297-143880319 CCCTGACTGGGAGTGGCCCAGGG - Intergenic
1050199105 9:3123327-3123349 CCATCTCATGGAGTGGACCGAGG - Intergenic
1052831729 9:33221349-33221371 CCTTGCCTGGGACTGGACCTGGG - Intronic
1056764244 9:89435108-89435130 CCAAGGCGGGGAGTGCACGGGGG + Intronic
1058212095 9:102181763-102181785 CCATGGTTGGGTGTGAACGGAGG - Intergenic
1058495799 9:105558028-105558050 CCGAGGCTGGGGCTGGACCGTGG + Intergenic
1059321100 9:113470675-113470697 ACATGGCTGGGAGTGGTGAGTGG + Intronic
1060027592 9:120186051-120186073 CCAGGGCTGGGATTTGACCTTGG + Intergenic
1061921369 9:133784265-133784287 CCTGGGCTGGGCGTGGAGCGAGG + Intronic
1062219606 9:135408009-135408031 TCATGGCAGGGAGTGGGCTGGGG + Intergenic
1062226515 9:135455502-135455524 ACCTGGGTGGAAGTGGACCGGGG - Intergenic
1062349038 9:136130188-136130210 CCGGGGCTGGGAGGGGACGGGGG - Intergenic
1062383989 9:136301410-136301432 CCGGGGCTGGGAGGGGACGGGGG + Intronic
1062391347 9:136335197-136335219 CAGTGGCTGGGAGTGGGCCCGGG - Intronic
1062435654 9:136545628-136545650 CCACGGCTGGGAGCGGGCGGCGG - Intronic
1062498933 9:136844130-136844152 CCATCGCAGGGAGAGGACGGGGG + Intronic
1062568041 9:137171901-137171923 CCATGGCTGGGAGTGGAGTGCGG + Exonic
1062621097 9:137423000-137423022 CCGTAGCTGGGAGTGAGCCGGGG - Intronic
1186293424 X:8123534-8123556 GACTGGCTGGGAGTGGACAGAGG - Intergenic
1187514615 X:19957105-19957127 CCTTGGCAGGGAGTTGACCCTGG - Intronic
1189360141 X:40343797-40343819 CCAGTGCTGGGAGTGGAGAGAGG - Intergenic
1189510533 X:41657070-41657092 CCCTGCATGGGAGTGGACTGAGG + Intronic
1189516419 X:41717353-41717375 ACATGAATGGGAGTGGACTGAGG + Intronic
1190090246 X:47430950-47430972 ACATGGATGGGGGTAGACCGAGG + Intergenic
1190142206 X:47857720-47857742 CCTTGGCTGGGAGTGGATAAGGG - Intronic
1197479575 X:126966019-126966041 CCCTGGCTGGGAGGGGAGCAGGG - Intergenic
1199760086 X:150898585-150898607 CCATGGCTGGGAGCAGGCGGAGG + Exonic