ID: 1144107226

View in Genome Browser
Species Human (GRCh38)
Location 17:11997240-11997262
Sequence GGGGCAGCCATGGCTGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 853
Summary {0: 1, 1: 0, 2: 9, 3: 96, 4: 747}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144107226_1144107245 28 Left 1144107226 17:11997240-11997262 CCACTCCCAGCCATGGCTGCCCC 0: 1
1: 0
2: 9
3: 96
4: 747
Right 1144107245 17:11997291-11997313 GCTCCCAGACGCATGGGCAAGGG 0: 1
1: 0
2: 0
3: 7
4: 101
1144107226_1144107241 21 Left 1144107226 17:11997240-11997262 CCACTCCCAGCCATGGCTGCCCC 0: 1
1: 0
2: 9
3: 96
4: 747
Right 1144107241 17:11997284-11997306 CCCGCGCGCTCCCAGACGCATGG 0: 1
1: 0
2: 1
3: 9
4: 72
1144107226_1144107243 22 Left 1144107226 17:11997240-11997262 CCACTCCCAGCCATGGCTGCCCC 0: 1
1: 0
2: 9
3: 96
4: 747
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107226_1144107244 27 Left 1144107226 17:11997240-11997262 CCACTCCCAGCCATGGCTGCCCC 0: 1
1: 0
2: 9
3: 96
4: 747
Right 1144107244 17:11997290-11997312 CGCTCCCAGACGCATGGGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144107226 Original CRISPR GGGGCAGCCATGGCTGGGAG TGG (reversed) Intronic
900095600 1:938891-938913 GGGGCTGCCAGGGCTGGGCAAGG + Intronic
900104068 1:974749-974771 GGGGCAGGGAAGGGTGGGAGGGG + Exonic
900245021 1:1632668-1632690 GGGGTGCCCAGGGCTGGGAGCGG - Intronic
900256252 1:1699827-1699849 GGGGTGCCCAGGGCTGGGAGCGG - Intronic
900389886 1:2429227-2429249 AGAACAGCCAGGGCTGGGAGGGG - Intronic
900396710 1:2456084-2456106 GGGGCAGCATTGGCTGTGGGTGG + Intronic
900410916 1:2512233-2512255 GGGGCAGCCATGGTTGGAGGCGG + Intronic
900457223 1:2783171-2783193 GTGGCAGACATGGCTGGCCGAGG + Intronic
900461473 1:2804071-2804093 GGGGCAGGCATGGCTGCAGGCGG + Intergenic
900626961 1:3612730-3612752 GAGGGAGCCCTGGCTGGGAGGGG + Intergenic
900637842 1:3674622-3674644 GGGGCAGGCAATGCTGGCAGAGG + Intronic
900777554 1:4596051-4596073 AGGGCTGCCACGGCTGGGTGTGG + Intergenic
900908032 1:5574698-5574720 GTGGCAGCCATGGATAGGAGAGG - Intergenic
900934706 1:5758066-5758088 GGGGCAGCCCTGGGCAGGAGAGG - Intergenic
900984519 1:6065724-6065746 TGGGCAGCCAGGGCTGGTTGAGG + Intronic
901151093 1:7102302-7102324 GGGGCAGCCACGTCCGGGAGGGG + Intronic
901161068 1:7177109-7177131 GGAGCCTCCATGGGTGGGAGGGG - Intronic
901607689 1:10472272-10472294 GGGGGAGCCAGGGCCGGGTGAGG - Intronic
901702645 1:11053837-11053859 GTGGCTGCCTCGGCTGGGAGTGG + Intergenic
901811139 1:11767264-11767286 GGTGAGGCCATGGCTGGGTGGGG + Exonic
902378565 1:16041933-16041955 AGGGCAGGTATGGGTGGGAGCGG - Intergenic
902513069 1:16976610-16976632 GGGTCTGCCAGGGCTGGGAGAGG - Intronic
902798657 1:18815881-18815903 GTGGGAGCCAGGGCTGGGGGTGG - Intergenic
902821741 1:18947651-18947673 GGGGCTGGCAGGGCTGGCAGGGG - Intronic
902863259 1:19260790-19260812 GGCGGGGCCATGGCTGGGAGGGG - Intergenic
903018857 1:20379651-20379673 GGGGAAGCCAAAGCTGGGTGAGG + Intergenic
903213500 1:21831152-21831174 GGGCCAGCCATGGCTAGGGGTGG + Intronic
903618425 1:24679744-24679766 GGTGCAGCTGTGGCTGGGTGCGG - Intergenic
903777061 1:25800145-25800167 GGGGCGGCCGGGGCGGGGAGGGG - Intergenic
904197158 1:28794457-28794479 GGGGCAGCCATGGTGGGGAATGG - Intergenic
904480081 1:30788034-30788056 GGGGCCGCCAGGGCTGGGTTTGG - Intergenic
904495456 1:30884090-30884112 AGGGCAGCTGTGGCTGGGTGGGG - Intronic
904923695 1:34029149-34029171 GGGGCAGCCTAGGCTGGAAGTGG + Intronic
905032654 1:34897985-34898007 GCGGCAGCCAGGGGCGGGAGGGG + Intronic
905235236 1:36542007-36542029 GGAGGGGCCCTGGCTGGGAGAGG + Intergenic
905538535 1:38742440-38742462 GTGGCAGTCCTGGCTGGGATGGG + Intergenic
905806524 1:40881394-40881416 GGGAAAGCCAAGGCTGGAAGTGG - Intergenic
905909824 1:41646108-41646130 GGGGATGCCAAGGTTGGGAGAGG + Intronic
906106130 1:43293768-43293790 CAGGCAGGCAGGGCTGGGAGGGG - Intergenic
907273596 1:53304799-53304821 GGGACAGACATGGCTGTGGGAGG + Intronic
907319882 1:53595552-53595574 GTGGCATCCAGGGCTGGGTGGGG - Intronic
908258981 1:62324886-62324908 GGTACAGCCATGGCTGGGCATGG - Intergenic
908512725 1:64862104-64862126 GGGAATCCCATGGCTGGGAGGGG + Intronic
909151562 1:72012326-72012348 CAGGCAGCCATAGCTGGGTGAGG + Intronic
909282313 1:73770873-73770895 TGGGCAGCCATGGGTGGGCCTGG - Intergenic
910376920 1:86582569-86582591 GAGGCAGCCCTGTATGGGAGAGG + Intergenic
910772772 1:90846682-90846704 TGAGCAGTCATGGCTGGGTGCGG + Intergenic
912516154 1:110217753-110217775 GGGGCACCCATGGAGGGGAGAGG + Intronic
912771015 1:112464539-112464561 GGAGCAGCCAGGGCTGGGCTAGG - Intergenic
913053239 1:115134978-115135000 GGGGCAAGCATGGCGGGTAGGGG + Intergenic
913284012 1:117210845-117210867 AGGGAAGCCATGGCTGGGGAAGG + Exonic
914335736 1:146713757-146713779 GGGGCAGGCATGACAGGAAGGGG - Intergenic
915139799 1:153760346-153760368 GTGGCAGTGATGGCTGGGTGGGG - Exonic
915185099 1:154098698-154098720 TGGGCAGCCATGGGTGGGTCTGG + Intronic
915239412 1:154509463-154509485 GAGGCAGCCAAGGCTCTGAGAGG + Intronic
915474831 1:156147330-156147352 GGGCCAGGCATGGCAGGGAGGGG - Intergenic
915551538 1:156638258-156638280 GGGGCAGAAATGGCTGAGTGTGG - Intergenic
915601052 1:156923641-156923663 GCGGAAGCCCGGGCTGGGAGTGG + Intronic
915891948 1:159781240-159781262 GGGGCAGCTGTCGCTGTGAGGGG - Exonic
915911474 1:159918254-159918276 GGGGCAGCCTTCCCTGGCAGGGG - Exonic
916605234 1:166335821-166335843 GAGGAAACCAAGGCTGGGAGAGG - Intergenic
917056303 1:170985730-170985752 GGGGTAACCAAGGCTTGGAGAGG - Intronic
917707553 1:177649412-177649434 GGGGCAGGGATGGATGGGAGAGG + Intergenic
917856902 1:179108505-179108527 GGGGCAGCCTTGGCTGGAGAAGG + Exonic
917904417 1:179575347-179575369 GGGCCAGCCTTGGATGGGACTGG - Intronic
918095430 1:181330296-181330318 GAGGTGGCCATGGCAGGGAGGGG - Intergenic
918820634 1:189250085-189250107 GGGGCAGCCATGGGTAGGCCTGG - Intergenic
920115531 1:203618153-203618175 AGAGAAGCCCTGGCTGGGAGGGG - Intergenic
920180127 1:204127337-204127359 GGGGCAGGGCTGGGTGGGAGAGG - Exonic
920316649 1:205080624-205080646 GGGTCAACCTTGGCTGGGCGCGG + Intergenic
920450984 1:206060913-206060935 GGGGCAGTCTTGTCGGGGAGGGG + Intronic
920723589 1:208412937-208412959 GAGACAGCCTGGGCTGGGAGGGG + Intergenic
921070962 1:211657076-211657098 GGGGCTGCCATGGGGGAGAGGGG - Intergenic
922417407 1:225433898-225433920 GGGGCTGTCAGGGATGGGAGTGG + Intergenic
922785600 1:228280946-228280968 GGGGGAGCCATGGCTTGATGTGG + Intronic
923337662 1:232984453-232984475 GGGGCTCACATGGCTCGGAGAGG + Exonic
924033094 1:239907520-239907542 GGGGCAGCCCTGCATCGGAGGGG - Exonic
1062832668 10:616576-616598 GAGGAAGCCCTGGCTGGGCGAGG - Intronic
1062902574 10:1157045-1157067 GGGGCGGCCTTGGGTGGAAGAGG + Intergenic
1063477374 10:6340813-6340835 GTGGCAGCAATCGCTGGGGGAGG + Intergenic
1063506975 10:6608465-6608487 GGTGCAGCCATACCTAGGAGAGG + Intergenic
1064008505 10:11716327-11716349 GAGGGAGCCATGGCTGGCGGTGG + Intergenic
1064029947 10:11877387-11877409 AGGGCAGCCTTGGCAGGAAGAGG + Intergenic
1064196418 10:13247449-13247471 GGAGCTGCCAGGGCTGTGAGGGG - Intergenic
1064247336 10:13679562-13679584 GGGGCAGCTATGGTTGGAGGTGG + Intronic
1064327429 10:14364166-14364188 GGGGCAGCCCTGGCTGGCAGCGG - Intronic
1065723943 10:28652347-28652369 GGGGAACCCATAGCAGGGAGAGG + Intergenic
1065981436 10:30902133-30902155 AGGGTTGCCATGGCTGGGACTGG + Intronic
1066755086 10:38703441-38703463 GTGGCAGCCTGGGCTGGGAGAGG + Intergenic
1067078258 10:43200135-43200157 TGGGCAGACAGGGCTGGCAGGGG + Intronic
1067258692 10:44667161-44667183 TGGGCAGCCATGGGTGGGCCTGG + Intergenic
1067346190 10:45440711-45440733 GGGGGACCTGTGGCTGGGAGTGG + Intronic
1068287660 10:54961529-54961551 TGGGCAGCCATGGGTGGGCCTGG - Intronic
1068354838 10:55897548-55897570 GCTCCAGCCATGGCTGAGAGGGG - Intergenic
1069456774 10:68560377-68560399 GGGGCTGACCTGGCGGGGAGTGG + Intergenic
1069569187 10:69484269-69484291 GGAGCAGCCCCGGCTGGCAGGGG - Intronic
1069629454 10:69888956-69888978 GGGCCAGGCATGGCTGTGAGTGG - Intronic
1069706834 10:70464078-70464100 GGGGCAACACTGACTGGGAGCGG - Intergenic
1069797313 10:71061697-71061719 GTGGCAGCAAAGGCTGAGAGAGG - Intergenic
1069878359 10:71576701-71576723 TGGGCAGGCATGGCTGGCACTGG + Intronic
1069932208 10:71890422-71890444 AGGGCTCCCATGGCTGGGTGTGG - Intergenic
1070140047 10:73732265-73732287 CGGGCAGGCAGGGCTGGGAGAGG - Intergenic
1070150423 10:73801708-73801730 GAGACAGCCCTGTCTGGGAGGGG + Exonic
1070365901 10:75736933-75736955 GGGGAAGGCAGGGCTGGGATGGG + Intronic
1070523444 10:77274927-77274949 GGGGCAGCCTTGGCTGGCCATGG + Intronic
1070693213 10:78542971-78542993 GGAACAGCAAGGGCTGGGAGTGG + Intergenic
1070711478 10:78686264-78686286 GGGGCCGGGAGGGCTGGGAGTGG - Intergenic
1070787609 10:79171056-79171078 GGGGCTGCCCTGGCTGGGGTGGG - Intronic
1070835481 10:79444922-79444944 AGGGCTGCCCTGGCAGGGAGAGG + Intronic
1070890027 10:79936297-79936319 GGGGCAAACAAGGCTGGGCGTGG - Intergenic
1072804327 10:98415122-98415144 GGGGCAGAAATGGCTGCAAGTGG - Exonic
1073061402 10:100735789-100735811 GGGGCGGCCATGGCCGGGGCGGG + Intronic
1073559964 10:104488170-104488192 GAAGCAGCCAGGGCTTGGAGTGG + Intergenic
1074618256 10:115092670-115092692 GGGTCAGCGAGGGCTGGGAGGGG - Intergenic
1075589217 10:123679347-123679369 GTGGTAGGAATGGCTGGGAGAGG + Intronic
1075718652 10:124572071-124572093 GGGGAAGCATTGGCAGGGAGAGG + Intronic
1076291342 10:129348389-129348411 GTGGCAGCCCCGGCTCGGAGGGG - Intergenic
1076291403 10:129348592-129348614 ATGGCAGCCCTGGCTCGGAGGGG - Intergenic
1076300420 10:129421508-129421530 GAGGCAGCCATGGCTGGAGGGGG - Intergenic
1076328920 10:129650894-129650916 GCGGGAGCCATGGCAGGCAGGGG - Intronic
1076510932 10:131013071-131013093 GGGGCAGCCTTGCCACGGAGAGG - Intergenic
1076596396 10:131625279-131625301 GGGGCAGCGAGGGCTGGGTGCGG - Intergenic
1076826915 10:132973817-132973839 AGGGCAGGCATGGCTGGCAGAGG - Intergenic
1076886033 10:133262804-133262826 GGGGCAGGTGTGGCTGGGAGGGG + Exonic
1077012810 11:386318-386340 TGGGCAGCCATGGGTGGGCCCGG - Intergenic
1077020594 11:415600-415622 GGGGGAGCTATGTCTGGGAGAGG - Intronic
1077218469 11:1404911-1404933 GGGGCAGCGAGGGCTGGGGAGGG - Intronic
1077250583 11:1558960-1558982 CAGGCAGGCAGGGCTGGGAGAGG + Exonic
1077395831 11:2320745-2320767 GAGGCAGACATGGAGGGGAGGGG - Intergenic
1077467961 11:2742579-2742601 GGGGCAGAAATGCCTGGCAGGGG + Intronic
1077584027 11:3436746-3436768 GGGGCAGCATTGGTTGGGCGGGG + Intergenic
1077601405 11:3577445-3577467 GGGGTAGCCATAGCTGGGAGGGG + Intergenic
1078390250 11:10931000-10931022 AGGGCGGCCAGGGCTGGGACAGG + Intergenic
1078421881 11:11219346-11219368 AGGGAAGCCATGGCGTGGAGGGG - Intergenic
1078993686 11:16674575-16674597 AGGGCAGCCAAGGCTGGGCATGG + Intronic
1078993703 11:16674658-16674680 AGGGCAGCCAAGGCTGGGCATGG + Intronic
1081411917 11:42769457-42769479 TAGGCAGCAAGGGCTGGGAGAGG - Intergenic
1081527507 11:43936789-43936811 GGGGGAGTCATGGCTGGGGAGGG + Intronic
1081647309 11:44799027-44799049 GGGGCGGCACTGCCTGGGAGGGG - Intronic
1081736712 11:45409506-45409528 GAGGCAGCCATTCCTGTGAGAGG - Intergenic
1081848024 11:46254397-46254419 GTGGCAGGCAGGGCTGGAAGGGG - Intergenic
1083105964 11:60359044-60359066 TTTACAGCCATGGCTGGGAGTGG - Intronic
1083196854 11:61093345-61093367 GGGCCAGGCCTGGCCGGGAGGGG + Intergenic
1083309219 11:61775970-61775992 GGGCCAGGCCTGGCTGAGAGGGG + Intronic
1083596800 11:63921432-63921454 GGGGCAGGCCTTGCTGGGGGTGG - Intergenic
1083720562 11:64601672-64601694 GGGGCAGCCCTGGGGGAGAGTGG - Exonic
1083730644 11:64650702-64650724 GGAGGAGCTATGGCTGGCAGGGG + Intronic
1083855016 11:65389020-65389042 GGGGCAGCTATGGTGGTGAGGGG + Intronic
1083860819 11:65419073-65419095 GGGGGAAGCAAGGCTGGGAGGGG + Intergenic
1083889704 11:65589716-65589738 GGGCCAGTGAGGGCTGGGAGGGG - Intronic
1084183527 11:67458326-67458348 GAGGCAGCTTTGGGTGGGAGGGG + Intronic
1084240935 11:67819415-67819437 GGGGCAGCATTGGTTGGGCGGGG + Intergenic
1084544298 11:69806649-69806671 AGGACAGACATGGCTGGGCGCGG - Intergenic
1084831504 11:71773291-71773313 GGGGCAGCATTGGTTGGGCGGGG - Intergenic
1084870354 11:72094672-72094694 GGGGCAACTAAGGCTGAGAGAGG + Intronic
1084913760 11:72412070-72412092 CTGCCAGCCAGGGCTGGGAGGGG + Intronic
1084942080 11:72618291-72618313 GGAGGAGCAAAGGCTGGGAGTGG - Intronic
1086172431 11:83851332-83851354 GAGACAGCCAGGGCTGGGCGGGG + Intronic
1087279946 11:96198905-96198927 GGGGTAGTCCTGGCTGGGTGCGG + Intronic
1088920680 11:114258069-114258091 GTGGCAGCCGGGGCTGGCAGGGG - Intronic
1089256733 11:117198156-117198178 GGGGCTGCCAGGCCTGGCAGAGG - Intergenic
1089343897 11:117777989-117778011 CTGGCAACCATGGCAGGGAGAGG - Intronic
1089496555 11:118911160-118911182 GGGGGAGCCAGGGCTGGGGGCGG - Intronic
1090461094 11:126892216-126892238 GGGGCTGCCATGCCTGAGGGTGG + Intronic
1090627588 11:128619764-128619786 AGGGCAGGCAGGGCTGGGGGAGG + Intergenic
1090858748 11:130634392-130634414 GGGGAAGGCATGGATGAGAGGGG + Intergenic
1091232689 11:133998909-133998931 GGGGCAGTGAAGGATGGGAGTGG + Intergenic
1091403081 12:192662-192684 GGGGCAGCCATGGGTAAGATAGG + Intronic
1091456666 12:613118-613140 GGGCCAGCCAGGGATGGCAGGGG - Intronic
1092657196 12:10698661-10698683 AGGGGCACCATGGCTGGGAGGGG + Intergenic
1092792552 12:12082347-12082369 GAAGAAGCCATGGCTGGGTGAGG - Intronic
1093824507 12:23667052-23667074 GGGGCAGCGAGGACTGAGAGAGG + Intronic
1095252601 12:39996644-39996666 GCTTCAGCCATGGCTGGAAGGGG + Intronic
1095714415 12:45326743-45326765 GGGGCAGCAGCTGCTGGGAGTGG - Intronic
1095850295 12:46796605-46796627 GTGGCAGCTGTGTCTGGGAGTGG - Intronic
1096500419 12:52061127-52061149 GGAGGGGCCAGGGCTGGGAGTGG + Intergenic
1096678917 12:53242053-53242075 GGGACAGCCATGGCAGGGGAAGG - Intergenic
1096691719 12:53325643-53325665 GGGGCTGCTACGGGTGGGAGGGG - Intergenic
1096744764 12:53718818-53718840 GGGAGGGCCATGGCTGGGCGTGG - Intronic
1096771737 12:53939679-53939701 GGGGCAGGCAGGGCGGGGAGGGG - Intronic
1096844279 12:54396974-54396996 GAGGCAGCCATGGCCAGGTGTGG - Intronic
1097129940 12:56804602-56804624 TGGGCAGCCATGGATGGGCCTGG + Intergenic
1097147340 12:56950854-56950876 GTGGCAACAAGGGCTGGGAGAGG + Intergenic
1097450709 12:59733993-59734015 TGGGCAGCCATGGGTGGGCCTGG + Intronic
1097870015 12:64594040-64594062 GGGAGGGCCATGGCTGGGCGTGG + Intergenic
1098155135 12:67589759-67589781 GGTGCAGCCATGGCTGGGCACGG + Intergenic
1098326800 12:69311942-69311964 GGGGCAGCCACAGCTGAAAGAGG - Intergenic
1098731496 12:74040951-74040973 GGCACCACCATGGCTGGGAGAGG - Intergenic
1100273686 12:93050289-93050311 AGGGCATCCCTGGCTGTGAGGGG + Intergenic
1101716753 12:107318932-107318954 GGCGCAGCGATGGCCAGGAGAGG + Exonic
1102216462 12:111164942-111164964 GGGCCAGCCATGGGGGGGAGAGG + Intronic
1102953728 12:117046401-117046423 GGGACAGGAAGGGCTGGGAGAGG + Intronic
1103146380 12:118598518-118598540 GGGACAGCCTTGGCTATGAGAGG + Intergenic
1103764729 12:123271870-123271892 GGGGCGGCCGGGGCCGGGAGGGG + Exonic
1104042595 12:125140134-125140156 GGGACAGCCATGGCTGCCTGAGG - Intronic
1104498864 12:129265832-129265854 GGGACAGCTGTGCCTGGGAGGGG - Intronic
1105719618 13:23100883-23100905 TTGGGAGCCATGGCTGGGTGGGG - Intergenic
1106506350 13:30373844-30373866 GGGGATTCCACGGCTGGGAGAGG - Intergenic
1106519468 13:30484167-30484189 GGGGCAGCTCAGGCTGGGATGGG - Intronic
1107351325 13:39517933-39517955 GGCCCACCCATGGCTGGGGGTGG - Intronic
1107710486 13:43146009-43146031 AAGGCAGCCAGGCCTGGGAGGGG - Intergenic
1107788624 13:43978595-43978617 GCAGCAGCCATGTCTGGGAAGGG + Intergenic
1108095683 13:46898157-46898179 GTGGCAGGCATGGCAGTGAGGGG - Intergenic
1108681604 13:52785387-52785409 GTGGTGGCCATGGCAGGGAGAGG - Intergenic
1108682314 13:52790695-52790717 GGTGCAGGCAGGGCTGGAAGAGG - Intergenic
1109260715 13:60142635-60142657 GGGGCAACCATGGCTGGTGCTGG - Intronic
1109287908 13:60433758-60433780 GGGGCAGCCATGTCTGCACGAGG - Intronic
1110539674 13:76694120-76694142 GTGGCAGGAAAGGCTGGGAGGGG - Intergenic
1111064478 13:83072646-83072668 GCTGCAGCCATGGCTAAGAGGGG + Intergenic
1111683732 13:91476199-91476221 TGGGCTGTCATGGCTGGGAACGG - Intronic
1112390914 13:98983494-98983516 GTGGCAGCCAGTGGTGGGAGGGG + Intronic
1112441212 13:99426327-99426349 GGGGCTGCCTTTGGTGGGAGAGG + Intergenic
1113339151 13:109404815-109404837 TGGGCAGCCATGGGTGGGGCTGG - Intergenic
1113371988 13:109733003-109733025 GCGGGAACCAGGGCTGGGAGCGG - Intergenic
1113466096 13:110514129-110514151 GGTCCAGCCATGGCTTGGAAAGG + Intergenic
1113781890 13:112981846-112981868 GAGACAGCCAGGGCTGGGAGGGG - Intronic
1113810896 13:113141775-113141797 GGGCCAGCTATGAGTGGGAGTGG - Intronic
1113907558 13:113826853-113826875 GGGGCAGGGATGGGTGGGCGGGG - Intronic
1114271285 14:21101867-21101889 GAGCCAGCTATGGCTGGCAGTGG + Exonic
1114677511 14:24453617-24453639 GCGGCAGCCCGGGCTGGGGGAGG - Intergenic
1114687582 14:24548539-24548561 GCTCCAGCCATGGCTGAGAGAGG - Intergenic
1115328747 14:32170804-32170826 GGGGCAGCTTTGGCAGGGCGCGG + Intergenic
1115486757 14:33917804-33917826 GCTGCAGCCAGGGCTGGGTGTGG - Intergenic
1115767143 14:36634696-36634718 GGGGCTGCCATAGATGGGGGTGG - Intergenic
1115919360 14:38355443-38355465 GTTCCAGCCATGGCTGAGAGGGG + Intergenic
1115994887 14:39186116-39186138 GGGACAGTCATGGCAAGGAGTGG - Intergenic
1116957851 14:50943270-50943292 GGGGAGGACATGGCAGGGAGAGG - Intronic
1117181937 14:53200366-53200388 GCCCCAGCCATGGCTGGAAGGGG + Intergenic
1117365330 14:55021674-55021696 GTAGCAGACATGGCTGGGCGCGG - Intronic
1117422777 14:55563751-55563773 GGGGCAGCATTGACTAGGAGGGG - Intronic
1118209800 14:63754816-63754838 TGGTCAACCATGGCTGGGTGTGG - Intergenic
1118326193 14:64782897-64782919 GGGTTAGACATGGCTGGTAGGGG + Intronic
1118496828 14:66315623-66315645 GGTGCAACCTTGACTGGGAGGGG - Intergenic
1119738640 14:76999759-76999781 GGGGCAGGCCTGGCTGGGCCTGG - Intergenic
1120338050 14:83184367-83184389 GGGGCAGGGATTGCTGGCAGAGG - Intergenic
1120537450 14:85714353-85714375 CAGGCAGCCATGGCTGGGTGAGG - Intergenic
1120856644 14:89218149-89218171 GGTGCAGGCATGGCGGAGAGGGG - Intronic
1121017217 14:90556156-90556178 GCGGCAGCGCTGGCTGGGTGGGG + Intronic
1121027988 14:90630650-90630672 GTGGTTGCCAGGGCTGGGAGGGG - Intronic
1121357790 14:93230370-93230392 GGTGGAGCCATTGCTGAGAGTGG + Intergenic
1121566295 14:94912485-94912507 GGGGCAGTCTTGGCAAGGAGGGG - Intergenic
1121695346 14:95907984-95908006 TGGGCAGCCATGGGTGGGCCTGG + Intergenic
1122039428 14:98973333-98973355 GAGGGACCCATGTCTGGGAGCGG - Intergenic
1122208409 14:100159729-100159751 GGGGCACCTCTGGCTGGGCGGGG + Exonic
1122284911 14:100645145-100645167 GCAGTGGCCATGGCTGGGAGTGG - Intergenic
1122386061 14:101349094-101349116 TGGGCAGCCATGGGTGGGTGTGG + Intergenic
1122437816 14:101711561-101711583 GGGGCAGCCAGTGTGGGGAGGGG + Intergenic
1122548029 14:102535514-102535536 GGGGCAGGCAGGGAGGGGAGAGG + Intergenic
1122758411 14:104001213-104001235 GGGGCAGGTATGGCTGCAAGGGG - Intronic
1122798165 14:104216706-104216728 GGGGCAGCCTAGACTGGGAGAGG - Intergenic
1122886051 14:104710909-104710931 GGGGCAGCCAGGGCTGGAGAGGG - Intronic
1122974107 14:105164064-105164086 GCGGCAGGCCTGGGTGGGAGGGG - Intronic
1123425213 15:20165160-20165182 GGGGCAGCAGTGCCTGGGAGAGG - Intergenic
1123534437 15:21171694-21171716 GGGGCAGCAGTGCCTGGGAGAGG - Intergenic
1123700326 15:22909971-22909993 GGGGCAGGCATAGCCCGGAGGGG - Intronic
1125484564 15:40103339-40103361 ATGGCTGCCAAGGCTGGGAGAGG - Intronic
1125885141 15:43223687-43223709 GGTGCAGCCTCGGCTGGGCGCGG + Intergenic
1128554754 15:68623719-68623741 AGGGCAGGCAGGGCTGGGTGAGG + Intronic
1128758424 15:70198567-70198589 GGGGCAGGCATTTCTGGCAGTGG + Intergenic
1128977918 15:72166935-72166957 TGGGCTGTCAGGGCTGGGAGCGG + Intronic
1129256895 15:74338867-74338889 TGGGCAGCCATGCTGGGGAGTGG - Intronic
1129676361 15:77634058-77634080 GGGGCAGCTGAGGCTGGGGGAGG + Intronic
1130296198 15:82648159-82648181 GGGGCAGCTGTGGCTAGCAGCGG - Intronic
1131050209 15:89342846-89342868 AGGGTAGCCAGGGCTGGGAGCGG - Intergenic
1131157424 15:90083849-90083871 GGGGCTGCCACGGCAGGGAAGGG - Exonic
1131437039 15:92431357-92431379 GGGGAAGCCAAGGCTCAGAGGGG - Intronic
1132090954 15:98947784-98947806 TGGGCTGCACTGGCTGGGAGGGG - Intronic
1132563376 16:609176-609198 GGTGCTGCCACGGCTGGGTGAGG + Intronic
1132582443 16:691198-691220 GAGGCTGCCATGGCTGGAGGTGG - Intronic
1132584317 16:699757-699779 GGGGCAGGGTGGGCTGGGAGAGG - Intronic
1132701115 16:1222527-1222549 GGGGCGGCCTTGGCTGGGTGTGG + Intronic
1132992677 16:2805087-2805109 GGAGCAGCAACAGCTGGGAGGGG - Intergenic
1133008001 16:2895278-2895300 GGCGCTGCCCTGGCTGGGTGGGG - Exonic
1133149494 16:3816944-3816966 GGGTCAGCAATGGCTGGAGGGGG + Intronic
1133172842 16:3992529-3992551 CGGGCAGTCAGGGCTGGGATTGG - Intronic
1133230015 16:4361955-4361977 GGGGCAGCCCTGGTGGGGTGGGG + Intronic
1133352407 16:5110313-5110335 GGGGCAGCATTGGTTGGGCGGGG + Intergenic
1133370691 16:5243574-5243596 GGGGTAGCCATAGCTGGGAGGGG - Intergenic
1133744391 16:8675544-8675566 GGGGCAGCCAGGTGTGGGAGTGG - Intronic
1134451233 16:14364946-14364968 GGGCCAGGGAAGGCTGGGAGTGG + Intergenic
1134456602 16:14399880-14399902 GGGGAAGCGAGGGCTCGGAGAGG - Intergenic
1135078041 16:19410912-19410934 GTGGCAGCACGGGCTGGGAGCGG + Exonic
1135973170 16:27087084-27087106 AGGGCAGTCAAGGCTGGGCGCGG - Intergenic
1136114731 16:28087496-28087518 GGGGCAGCTTTGTCAGGGAGGGG - Intergenic
1136230496 16:28882900-28882922 GGGGAAGCCAGGCCCGGGAGGGG - Intronic
1136378181 16:29877511-29877533 GGGGCAGAGCTGGATGGGAGGGG - Intronic
1136382238 16:29901077-29901099 GGGGCAGCCATGGAAGGGACAGG + Exonic
1136570666 16:31094694-31094716 GGGGGAGCCCTGGCTGGGTGCGG - Exonic
1136727593 16:32373403-32373425 GTGGCAGCCTGGGCTGGGGGAGG - Intergenic
1136859648 16:33690583-33690605 GGGGCAGCAGTGCCTGGGAGAGG + Intergenic
1137573056 16:49579217-49579239 GGGGCAGCAGTGGGTGGGGGTGG - Intronic
1138260379 16:55615846-55615868 GTGGCAGCCTGGGCTGGGGGAGG + Intergenic
1138332444 16:56225942-56225964 GGGGCAGCCATGGAAAGGTGTGG + Intronic
1138497414 16:57416705-57416727 GGCGCAGCCAGGGCCGGGTGGGG - Intergenic
1138501472 16:57447584-57447606 GGGGCTGCCAAGCCGGGGAGAGG + Intronic
1138585797 16:57969884-57969906 GGGTTGCCCATGGCTGGGAGAGG - Intronic
1139377555 16:66509711-66509733 TGGGGGGTCATGGCTGGGAGGGG - Exonic
1139784989 16:69385695-69385717 GGGGGAGGCACGGCTGGAAGAGG - Exonic
1139914282 16:70418669-70418691 GGGGAAGCCAGGGCTTGGGGAGG - Intronic
1139950382 16:70665403-70665425 GGGGAGGGCATGGATGGGAGGGG + Intronic
1139997888 16:70997471-70997493 GGGGCAGGCATGACAGGAAGGGG + Intronic
1140413475 16:74756123-74756145 GGGGCAGCCATGATTGCTAGGGG - Intronic
1140475574 16:75237963-75237985 GGGGCAGGCGCGGCAGGGAGGGG - Intronic
1140509749 16:75498618-75498640 GGAGCAGAGATGGCTGGAAGGGG - Intergenic
1140515546 16:75538826-75538848 GGAGCAGAGATGGCTGGAAGGGG - Exonic
1141243735 16:82287347-82287369 TGGGCAGACATTGCTGGGTGAGG + Intergenic
1141423659 16:83932337-83932359 TGGGCAGCCATGGGTTGTAGTGG - Intronic
1141693925 16:85611325-85611347 CAGGCGGCCAGGGCTGGGAGGGG - Intergenic
1141771882 16:86094449-86094471 AGTGCAGCCATGTATGGGAGGGG + Intergenic
1141858929 16:86703518-86703540 GTGGGTGCCAGGGCTGGGAGAGG + Intergenic
1141894516 16:86950270-86950292 TGGGGAGCCAAGGCTGGGAGAGG + Intergenic
1142069199 16:88081066-88081088 GGGGCAGCCATCTCAGGGAACGG - Intronic
1142110704 16:88329580-88329602 GGGGCAGAAGTGGCTGGCAGAGG - Intergenic
1142126823 16:88414558-88414580 GAGCAAGCTATGGCTGGGAGCGG + Intergenic
1142174397 16:88638607-88638629 GGGGCAGGCTGGGCTTGGAGCGG - Exonic
1142224972 16:88872796-88872818 GGGGCGGCCCTGGCAGGCAGAGG + Intergenic
1142232885 16:88907991-88908013 GCTGCAGCCAGGGCTGGGGGAGG - Intronic
1142321056 16:89383301-89383323 CAGGCAGGCATGGCTAGGAGGGG - Intronic
1142349741 16:89574715-89574737 GGGGCTGGCAGGGCCGGGAGAGG - Intergenic
1202998839 16_KI270728v1_random:144347-144369 GTGGCAGCCTGGGCTGGGGGAGG + Intergenic
1203121154 16_KI270728v1_random:1538762-1538784 GGGGCAGCAGTGCCTGGGAGAGG + Intergenic
1203130438 16_KI270728v1_random:1680755-1680777 GTGGCAGCCTGGGCTGGGGGAGG + Intergenic
1142504596 17:354814-354836 GGGGCAGGCATGGCAGCAAGAGG + Intronic
1143118428 17:4593293-4593315 GGGGCTGACATGGCAGGCAGAGG - Intronic
1143175741 17:4953894-4953916 GGGCCAACCCTGGCTGGGCGGGG - Intronic
1143642475 17:8206982-8207004 GGGGACACCAGGGCTGGGAGTGG + Intronic
1143724872 17:8837932-8837954 GAGGCAGTCTAGGCTGGGAGTGG + Intronic
1144107226 17:11997240-11997262 GGGGCAGCCATGGCTGGGAGTGG - Intronic
1144699352 17:17326682-17326704 AGGGCACCCAGGGCTGGGTGTGG - Intronic
1144798212 17:17907000-17907022 GGGGCAGACACGGCCGGGAGTGG - Intronic
1144945970 17:18969599-18969621 GGGACTGCCCTGGCTGGTAGAGG + Exonic
1145081387 17:19897377-19897399 GAAGCAGCACTGGCTGGGAGTGG + Intergenic
1145250242 17:21293445-21293467 GGGGCAACCATGGCTGCCAGAGG - Intronic
1145784959 17:27587758-27587780 GGGGAATCCCAGGCTGGGAGAGG + Intronic
1146183476 17:30710833-30710855 GCAGCTGCCATGGCTGGGGGTGG - Intergenic
1146644446 17:34567788-34567810 GATGCAGCCATGGATGGGGGAGG - Intergenic
1147148482 17:38499501-38499523 GGGACAACCATGGCGGGGGGAGG - Intronic
1147320395 17:39642425-39642447 GAGGCAGCCTGGGCAGGGAGGGG + Intronic
1147429445 17:40362713-40362735 GGGGCAGGCCGGGCTGGGGGCGG - Intronic
1147586567 17:41656623-41656645 GGGGCAGGGATGGCTTGGGGAGG + Intergenic
1147718279 17:42522360-42522382 GGGCCAGCCCAGCCTGGGAGAGG - Exonic
1148348717 17:46923069-46923091 CGGGCAGCCCTGGCCGGCAGGGG + Intergenic
1148490822 17:48023378-48023400 GGGCCAGCCAGGCCTGGGTGTGG - Intergenic
1148583910 17:48763258-48763280 GGGGAAACCAAGGCTGAGAGAGG - Intronic
1148750060 17:49940464-49940486 GAGGCAGCCAAGGTTGGGGGTGG + Intergenic
1148784278 17:50137871-50137893 GGGGCATTCCTGGCAGGGAGAGG - Intronic
1148809973 17:50284053-50284075 GGGGCAGCCATCACTGAGAGAGG - Intergenic
1148852547 17:50561832-50561854 GGGGCTGCCAGGGAGGGGAGGGG + Intronic
1150001448 17:61443310-61443332 GGCTCAGCCTTGGCAGGGAGGGG + Intergenic
1150212638 17:63449814-63449836 GAGGAAGCCATTGCTGGGAGGGG - Intergenic
1151532504 17:74715685-74715707 GGGGAGGCCAGGTCTGGGAGAGG - Intronic
1151568952 17:74916477-74916499 GGGGCCCCCATGGCTGGGGCAGG - Exonic
1151668454 17:75558653-75558675 GGGTCAGGCTGGGCTGGGAGTGG - Intronic
1151757704 17:76083969-76083991 TGGGCAGCACAGGCTGGGAGGGG + Intronic
1151785445 17:76272823-76272845 GGGGCAGGCTTGGCTGGGTCGGG - Intergenic
1151877734 17:76876883-76876905 GGGGCAGAGCTGCCTGGGAGGGG - Intronic
1151895160 17:76975080-76975102 TGGGCAGCCATGGGTGGGCTCGG - Intergenic
1151955929 17:77380263-77380285 GAGGCAGGCATGGGTGGGGGGGG - Intronic
1152005094 17:77675668-77675690 TCAGCACCCATGGCTGGGAGGGG - Intergenic
1152091646 17:78250749-78250771 GGGGCAGCTCTGGGAGGGAGTGG + Intergenic
1152269067 17:79313241-79313263 AGGGCAGGCAGGGCTGGGGGAGG + Intronic
1152587737 17:81196530-81196552 AGGGCATGCATGGCTGGGAATGG + Intronic
1152780907 17:82227101-82227123 GGGGAAGCCATGCCTAAGAGGGG + Intergenic
1152837733 17:82545237-82545259 TGGGAGGCCCTGGCTGGGAGAGG - Intronic
1152983971 18:305511-305533 GGCGCATCCTTGGCTGGGAGAGG + Intergenic
1153814250 18:8779256-8779278 AGGGCAGGCATGGCCAGGAGGGG - Intronic
1155170059 18:23260535-23260557 GAGGCAGCCAGGGCTGGGGAGGG - Intronic
1155170463 18:23263326-23263348 GGGCCAGCAGTGGCTGGGAAGGG - Intronic
1156027334 18:32669946-32669968 GTGGCTGCTATGGCTGGGTGAGG + Intergenic
1156039977 18:32809748-32809770 GGAGGAGAGATGGCTGGGAGCGG + Intergenic
1156414233 18:36870981-36871003 GGGGCAGCCACAGCTGGAAATGG - Intronic
1156473334 18:37390939-37390961 GGGGCAGCCGCTGCAGGGAGCGG + Intronic
1156684000 18:39622332-39622354 CAGGCAGCCAAGGCTGGGTGAGG - Intergenic
1157552522 18:48591317-48591339 TGGGCAGCCATTGCCTGGAGCGG - Intronic
1157580623 18:48771906-48771928 GCGGCAGCCACGGCAGGTAGAGG - Intronic
1157717140 18:49895696-49895718 GGGCAAGCCATGGCTGACAGGGG - Intronic
1159882690 18:73874202-73874224 AGGGCAGCCATGGCTCTGAAAGG + Intergenic
1160142631 18:76339104-76339126 GGGGCACACATGGCGGGCAGGGG - Intergenic
1160239789 18:77114896-77114918 GGGGCAGACGTGCCTGGGCGAGG + Intronic
1160243121 18:77136993-77137015 GGGGCAGCAGAAGCTGGGAGAGG + Intergenic
1160389243 18:78517821-78517843 GGGGCCGTCAGGGCTGGAAGGGG + Intergenic
1160391144 18:78534174-78534196 GGGGCTGCCCTGACTGGGAGTGG - Intergenic
1160419357 18:78733444-78733466 AGGGCAGCCAGTGCTAGGAGGGG - Intergenic
1160537821 18:79604337-79604359 GGGGCCTCCAGAGCTGGGAGAGG - Intergenic
1160703396 19:518450-518472 GGAGAGGCCAGGGCTGGGAGGGG + Intronic
1160878817 19:1310445-1310467 CGGGCAGCGAAGGCTGGGGGTGG + Intergenic
1161090944 19:2359964-2359986 GGGGTAGCCAGGGATGGGAGTGG - Intergenic
1161207202 19:3047270-3047292 GGGGCGGCCGCGGCGGGGAGGGG + Intronic
1161260797 19:3336808-3336830 GAGGCAGCCAGGGCAGGCAGTGG + Intergenic
1161328715 19:3676080-3676102 GGGGAAACCGAGGCTGGGAGAGG + Intronic
1161566236 19:5004409-5004431 GGGGCAGCAAGGGCTGAGAAGGG - Intronic
1161572921 19:5040183-5040205 GGGTCAGCCCAGGCCGGGAGAGG - Intronic
1161704724 19:5814276-5814298 AAGGCACCCATGGCTGGGGGTGG + Intergenic
1161898244 19:7098961-7098983 GGAGAAGCCAAGGCTGGGCGAGG + Intergenic
1162042868 19:7980881-7980903 GGGGCACCCTGGGCGGGGAGTGG + Intronic
1162235958 19:9309727-9309749 GGGGCAGGCAGGGCGGGGCGGGG + Intronic
1162769997 19:12943658-12943680 GGGGCGGGCAGGGCTGGCAGGGG + Intronic
1162906065 19:13824888-13824910 GGGGCAGCCAGGGCACAGAGAGG + Intronic
1162930673 19:13956035-13956057 GGGGGAGCCTTGGCTGGTTGGGG + Intronic
1162965963 19:14156217-14156239 GGGGCAGGCTGGGCTGAGAGTGG + Intronic
1163304076 19:16466475-16466497 GGGGCTGACATCGTTGGGAGGGG - Intronic
1163378268 19:16947517-16947539 GAGGCAGCCCTGGCTGGAACTGG - Intronic
1163420633 19:17211942-17211964 GGGGCGGCCACGGTGGGGAGGGG - Exonic
1163423075 19:17226134-17226156 GGGGCTGACCTGGCTGGGCGTGG - Intergenic
1163469698 19:17489150-17489172 GGGTGAGGCCTGGCTGGGAGGGG - Intronic
1163478320 19:17539778-17539800 GGCGGAGCCTGGGCTGGGAGGGG + Intronic
1163584856 19:18157946-18157968 TGGGAAGCCAGGGCTGGGAGGGG + Intronic
1163598510 19:18234029-18234051 GGGGCTCCCATGTCTGGGATGGG + Intronic
1163635401 19:18434964-18434986 GGTGCAGCCATTGGTGGCAGCGG + Exonic
1163714428 19:18865754-18865776 GGGACAGCTCCGGCTGGGAGAGG - Exonic
1163718764 19:18887918-18887940 GGGGGTGCCAGGGCTGGGGGAGG - Intronic
1164011143 19:21204287-21204309 AGGGCAGACATGACTGGGAGAGG - Intergenic
1164050815 19:21584890-21584912 GGCACAGCCAGGGCTGGGCGCGG + Intergenic
1164150043 19:22542652-22542674 GGGCCAGTCATGGCCGGGCGCGG - Intergenic
1165077929 19:33291091-33291113 GGGGCAGCGCTGCCTGGGGGCGG - Intergenic
1165364929 19:35359531-35359553 GGGGCAGCCACCGCCGGCAGAGG + Exonic
1165366747 19:35372000-35372022 GGGGCAGCCACCGCCGGCAGAGG + Exonic
1165472997 19:36014220-36014242 GGGGCGGAAATGGCTGGGAGGGG - Exonic
1165475240 19:36026557-36026579 AGGAGAGCCCTGGCTGGGAGGGG - Intronic
1165738567 19:38192751-38192773 AGGGCAGGCCTGGCTGGGAGGGG - Intronic
1165739726 19:38198032-38198054 GCGGCCCCTATGGCTGGGAGAGG - Intronic
1166380686 19:42353686-42353708 GGGCCAGCCAGGGCTGGGTAGGG + Intronic
1166397493 19:42452539-42452561 GGGTCAGGAATGGCTGGGAAAGG - Intergenic
1166677418 19:44748485-44748507 GGGGCAGCCAGGCCTCGGCGGGG - Intronic
1166864044 19:45825587-45825609 AGGGCAGGCATGGCTGGGATTGG - Intronic
1167087994 19:47323809-47323831 GGGGCAGCCATGGAAGAGACCGG - Intergenic
1167153609 19:47724632-47724654 TGGGAACCCATGGCTGGGATGGG + Intronic
1167263195 19:48470264-48470286 GGGGCGGACAGAGCTGGGAGAGG - Intronic
1167697579 19:51024349-51024371 GGGGGAGACATGGGTGGGAGAGG + Intronic
925004502 2:430571-430593 GGATGGGCCATGGCTGGGAGTGG - Intergenic
925221403 2:2144256-2144278 TGGGGAGCCATGACTGTGAGTGG - Intronic
925226619 2:2189059-2189081 GGGGAAGCAATGGATTGGAGAGG - Intronic
925325073 2:3012437-3012459 GTGGCAGCAATGGGTGGGGGAGG - Intergenic
926075372 2:9938390-9938412 CGGGCTGCCCCGGCTGGGAGAGG + Intergenic
926151350 2:10427240-10427262 GGGGCAGCCATGCACGGGAGGGG - Exonic
926162045 2:10495982-10496004 GGTTCAGCCATGGCTGGAAATGG - Intergenic
926331605 2:11830135-11830157 GGGCCGGCCCAGGCTGGGAGGGG + Intergenic
926706989 2:15843961-15843983 GGGCCAGCCAAGGCTGCAAGGGG + Intergenic
926741607 2:16115946-16115968 GGGCCAGCCAAGTCTTGGAGGGG + Intergenic
926829031 2:16940149-16940171 GGGTCACCCTTGGCAGGGAGAGG - Intergenic
927154476 2:20213608-20213630 AGGGCAGACAGGGCTGGGGGAGG - Intronic
927285891 2:21356308-21356330 GAGGCAGGCATGGCTGGGGTTGG + Intergenic
927491521 2:23524312-23524334 GGGCCGGCCTTGGCTCGGAGGGG + Exonic
927698058 2:25251199-25251221 GGGGCAGCCGGAGCTGGGTGGGG + Intronic
927887013 2:26724898-26724920 GGGGCCGGCTTGGCTGGGTGTGG + Intronic
928333733 2:30377805-30377827 GGGACAGGGATGGCTGAGAGGGG - Intergenic
928354321 2:30595790-30595812 GGGCCTGCCGTGGGTGGGAGTGG - Intronic
928435342 2:31251291-31251313 TGAGCTGCCATGGCTGGGAGTGG + Intronic
929124670 2:38512397-38512419 TGGGCAGCAAAGGCTGGGGGTGG - Intergenic
929560243 2:42952031-42952053 GAGGCAGCCATGGCTGAGGTAGG - Intergenic
929564139 2:42974360-42974382 GGAGCATACATTGCTGGGAGAGG + Intergenic
929714566 2:44297277-44297299 GGAGCAGGCCTTGCTGGGAGAGG + Intronic
929788910 2:45009938-45009960 TGGGCAGCTTTGGCTAGGAGAGG + Intergenic
930244422 2:48968721-48968743 GGCACAGCAATGGCTGGGATAGG + Exonic
931300491 2:60973796-60973818 TGGGCAGCCATGGGTGGGCCTGG - Intronic
931688092 2:64811896-64811918 GGGGCAGGCATGGCTGGTTCAGG - Intergenic
931937976 2:67219179-67219201 GAGACAGCCATGGCTGGGTAAGG + Intergenic
932614539 2:73223554-73223576 GGGGTCGCCATGGCTGGGTGAGG - Intronic
932802333 2:74751912-74751934 TAGGAAGCCATGGCAGGGAGTGG + Intergenic
933774188 2:85761895-85761917 GCTGCAGCCAGGGCTGGGAGTGG + Intronic
933777217 2:85778535-85778557 GGGGCACCCGTGGCTTGGAGAGG - Intronic
933839385 2:86274369-86274391 GCTGCAGCCATGGCAGAGAGGGG + Intronic
934318379 2:91947674-91947696 GTGGCAGCCTGGGCTGGGGGAGG + Intergenic
934458008 2:94191693-94191715 GGGGCAGCAGTGCCTGGGAGAGG + Intergenic
934474942 2:94587523-94587545 GAAGGAGCCCTGGCTGGGAGTGG + Intergenic
934517144 2:94995727-94995749 GGGGCAGCCTTGGCTGTGCATGG - Intergenic
935245574 2:101216318-101216340 TGAACAGCCAGGGCTGGGAGTGG + Intronic
935654335 2:105409030-105409052 GGGGTAGGAATGGCTGAGAGAGG + Intronic
936060947 2:109295440-109295462 GGGGCACGCAGGGCAGGGAGAGG + Intronic
936064762 2:109322316-109322338 AGGGCAGCCAGGGCCGGCAGAGG + Intronic
936079684 2:109423742-109423764 GGTGCCGCCATGCCTGGAAGGGG - Intronic
936516229 2:113183119-113183141 GGGCCAGGCATGGCTGAGAGAGG + Exonic
937135230 2:119545924-119545946 GGGACAGCCATGTGTGGGAATGG + Intronic
937624195 2:124025214-124025236 GGGGCGGGCCTGGCTGGGGGCGG + Intergenic
938096672 2:128468408-128468430 GAGGGAGGCCTGGCTGGGAGAGG + Intergenic
938391809 2:130912574-130912596 TGGGAAACCATGCCTGGGAGGGG + Intronic
939179602 2:138788739-138788761 GGGCCTGCCCGGGCTGGGAGTGG - Intergenic
940851175 2:158689588-158689610 GGGGGATTCCTGGCTGGGAGAGG - Intergenic
940961882 2:159795644-159795666 GGGGCAGCCATGCCAAGGACTGG + Intronic
941356315 2:164497066-164497088 GGTGAAACCATGGCTGGGACCGG + Exonic
942151167 2:173076670-173076692 GGGGCAGGAAGGGCGGGGAGCGG - Intronic
942208678 2:173648959-173648981 GGGGCAGCCATGGCCTGGCCGGG + Intergenic
943151275 2:184116447-184116469 GTGGCAGTGATGGCTGGGTGTGG + Intergenic
945688867 2:213007726-213007748 CAGGCAGCTATTGCTGGGAGAGG + Exonic
946164725 2:217857129-217857151 GAGGCAGCCGTGGGTGGGAGGGG - Intronic
947288040 2:228539844-228539866 GAGGCAGCCATGGCCAGGTGTGG - Intergenic
947528510 2:230893999-230894021 GGGACAGCTCTGGTTGGGAGGGG - Intergenic
947605563 2:231483404-231483426 GGGGCAGCCATGGGGAGGAGGGG + Intronic
948238543 2:236409036-236409058 GAGGGACCCATGTCTGGGAGTGG + Intronic
948370752 2:237487661-237487683 GGTGCAGGCACGGGTGGGAGTGG + Intronic
948461781 2:238133112-238133134 GGGGCAGGCAGGGCCGGGAAGGG + Exonic
948671479 2:239571368-239571390 AGCACAGCCTTGGCTGGGAGTGG + Intergenic
948766597 2:240225290-240225312 GGGTCGGCCATGTCTGGGTGGGG - Intergenic
948809963 2:240469405-240469427 GAGCCAGCCCTGGCTGGAAGGGG - Intergenic
948856890 2:240734386-240734408 GGGGCAGGCAAGGCTGGGGCAGG + Intronic
948860275 2:240749566-240749588 GGGGCAGGCAGGGAAGGGAGTGG + Intronic
1168959989 20:1862388-1862410 AGGACAAGCATGGCTGGGAGTGG - Intergenic
1168990919 20:2095172-2095194 GGGGCAGCCAGCCCTGGGGGTGG - Intergenic
1169204170 20:3730788-3730810 GGGGCAGGCATGAGTGTGAGGGG + Intergenic
1169441217 20:5635507-5635529 TGGGCAACCAGGGCTGGGCGCGG + Intergenic
1170490260 20:16865197-16865219 GGGACAGCCAAGGGTTGGAGAGG + Intergenic
1170495022 20:16915614-16915636 AGGGCAGCCATGGGTGGGGCTGG - Intergenic
1170607660 20:17885871-17885893 GGAACAGGCAAGGCTGGGAGGGG + Intergenic
1171364023 20:24611499-24611521 GGTCCAGCTATGGGTGGGAGGGG - Intronic
1171427976 20:25060264-25060286 GAGGCTGCCTTGGCTGGGACAGG - Intergenic
1172347042 20:34209914-34209936 TGGGCAGCCATGGGTGGGCTGGG - Intronic
1172869945 20:38129729-38129751 GGGACAGCCAGAGCTGGGTGGGG - Exonic
1173234817 20:41235136-41235158 TGTGCACACATGGCTGGGAGTGG + Intronic
1173617788 20:44414173-44414195 GAGGCAACCATGGCTCAGAGAGG - Intronic
1173926262 20:46783644-46783666 GGGACAACGATGGCTTGGAGTGG - Intergenic
1174301846 20:49588163-49588185 CTGGGAGCCATGCCTGGGAGTGG + Intergenic
1175519095 20:59588353-59588375 GGGGCAGCCTGGACTGGGACAGG - Intronic
1175633415 20:60560704-60560726 GGGGCCGGCAGGGCAGGGAGGGG + Intergenic
1175823930 20:61926414-61926436 GAGGCAGCGCTGGCTGGGGGAGG - Intronic
1176058536 20:63161521-63161543 GGGGCACCCAGGGCAGGGAATGG - Intergenic
1176285851 21:5019126-5019148 GGGCCACCCAGAGCTGGGAGAGG + Intergenic
1176287494 21:5026032-5026054 GGGGCTGCCATGGGGAGGAGCGG - Intronic
1178344003 21:31809497-31809519 TGGGCAGCGATGGCTGGGGTGGG + Intergenic
1178499866 21:33116841-33116863 TAGGTAGCCATGGCTTGGAGGGG + Intergenic
1178663090 21:34522956-34522978 AGGGCACCCACGGCAGGGAGAGG - Intronic
1178845398 21:36170139-36170161 GAGGGACCCATGTCTGGGAGTGG + Intronic
1179035006 21:37752208-37752230 GGGCCAGCCATGCTTTGGAGGGG + Intronic
1179063708 21:38004427-38004449 GGGGAAGAGATGACTGGGAGTGG + Intronic
1179149474 21:38797515-38797537 AGAGCAGCCCTGGCTGGGTGCGG - Intergenic
1179631265 21:42680094-42680116 GGGGCAGCGGAGGCTGTGAGAGG - Intronic
1179814990 21:43899799-43899821 GGAGAACCCATGACTGGGAGTGG + Intronic
1179869687 21:44237443-44237465 GGGGCTGCCATGGGGAGGAGCGG + Intronic
1179871330 21:44244349-44244371 GGGCCACCCAGAGCTGGGAGAGG - Intergenic
1180030240 21:45201897-45201919 GGGGCAGCCATGGCTGCCTCTGG + Intronic
1180151611 21:45951013-45951035 GGGGCAGGCATGGTGGGAAGTGG - Intergenic
1180200494 21:46221021-46221043 TGGACAGCCAGGGCTTGGAGAGG + Intronic
1180306561 22:11131357-11131379 GTGGCAGCCTGGGCTGGGGGAGG + Intergenic
1180545080 22:16493540-16493562 GTGGCAGCCTGGGCTGGGGGAGG + Intergenic
1180715829 22:17871696-17871718 GGGGCAAGAAAGGCTGGGAGAGG + Intronic
1180835553 22:18927849-18927871 GGGGCAGCCAGGTCTCAGAGTGG + Intronic
1180941731 22:19663902-19663924 GGGCCAGCCATGGCTGGACAAGG - Intergenic
1180984850 22:19898217-19898239 GGGCCAGCCATGGATGGGTGGGG - Intronic
1181258966 22:21583659-21583681 GGGGCAGACAGGGCTGCCAGTGG - Intronic
1181358203 22:22314735-22314757 GGGGCAGCAGTGCCTGGGAGAGG - Intergenic
1181539584 22:23566255-23566277 GGGGGAGGCCAGGCTGGGAGAGG + Intergenic
1181593102 22:23896577-23896599 GGGCCAGCCAGGGCTTGGTGGGG - Intronic
1181638462 22:24185008-24185030 TGGGCAGCCCAGGCTGGGGGTGG + Intronic
1181695605 22:24591415-24591437 GGGGCAGCCACAGCCAGGAGGGG + Intronic
1181964587 22:26647620-26647642 GGGCCAGCCATGGCAGGGTAAGG + Intergenic
1182012032 22:27009126-27009148 GAGGAAGCCAAGGCTGGGAGAGG - Intergenic
1182041538 22:27242147-27242169 GGGTCAGGCAGGCCTGGGAGGGG + Intergenic
1182110221 22:27717920-27717942 AGGGCAGCCAGGGCAGAGAGTGG + Intergenic
1182664126 22:31944900-31944922 GGGTCGCCCATGGCCGGGAGGGG - Intronic
1182917965 22:34052660-34052682 AGGGGAGCCAAGGGTGGGAGAGG + Intergenic
1183040849 22:35176842-35176864 AGGGCAGCCAGGAATGGGAGGGG - Intergenic
1183303053 22:37067882-37067904 GGGGCAGGCGTGCCTGGGCGAGG - Intronic
1183356063 22:37360247-37360269 GAGGCAGCCAGGCCTGGGATGGG + Intergenic
1183679382 22:39318554-39318576 GAGGGACCCATGTCTGGGAGCGG + Exonic
1183698177 22:39434965-39434987 GGAGCATCCAGGGCTGGGGGAGG - Intronic
1183705502 22:39472897-39472919 GAGGCGGCAATGGCTGGGAGGGG + Intronic
1183749859 22:39713693-39713715 GGGACAGCCATGGCTGTCTGAGG + Intergenic
1184230454 22:43155828-43155850 GGGGCACACATGGCAGGGACAGG - Intronic
1184301454 22:43563155-43563177 GGGCCAGCCTAGGCTGGAAGAGG + Intronic
1184372184 22:44089632-44089654 GGGGAAGCCAAGGGTGTGAGAGG + Intronic
1184431294 22:44442717-44442739 GGAGGAGGCATGGCTGGGGGAGG - Intergenic
1184602988 22:45554438-45554460 GGGGGAGTCCTGCCTGGGAGGGG - Intronic
1184687859 22:46104555-46104577 GGGGCCGGCAGGGCTGGGTGAGG - Intronic
1184849759 22:47113398-47113420 GGGTCAGCCATGCCTGGTGGTGG + Intronic
1185006346 22:48279010-48279032 GGGGCCTCCATGGCTGGGGAAGG + Intergenic
1185043980 22:48519794-48519816 GGTGCAGCCATGACTGGGATGGG - Intronic
1185141433 22:49103907-49103929 AAGGCAGCCATGGCTGGATGTGG + Intergenic
1185153014 22:49177171-49177193 GCTGCAGCCATGGCTGAGGGAGG + Intergenic
1185252394 22:49811224-49811246 GTGGCTGCCAGGGCTGGGGGAGG + Intronic
1185260914 22:49862587-49862609 GAGGCAGCCTCTGCTGGGAGGGG - Intronic
1185272834 22:49936538-49936560 GGTGCAGCCAAGGCTTGGAGGGG + Intergenic
1185395002 22:50582418-50582440 GGGGCCGGCCTGGCCGGGAGGGG - Intronic
1203285641 22_KI270734v1_random:153148-153170 GGGGCAGCCAGGTCTCAGAGTGG + Intergenic
949898050 3:8784999-8785021 GTGGAAGCCCTGGCAGGGAGAGG - Intronic
950215323 3:11154590-11154612 GGGGCCGCCGCGGCTGGGCGAGG + Intronic
950377226 3:12581663-12581685 GGGGCAGCTGAGGCTGGGAGAGG - Intronic
950410188 3:12831146-12831168 GGGGCAGCTCTGGCTGAGTGTGG - Intronic
950460821 3:13121368-13121390 GAGGAACCCACGGCTGGGAGGGG + Intergenic
950630459 3:14278639-14278661 TGGGCAGCCTTGGCCGGGAAAGG - Intergenic
951562455 3:23982162-23982184 CGGGCAGCCATGGGTGGGCCTGG + Intergenic
953410746 3:42689250-42689272 GGGGCTCCCAGGGCTGGGGGAGG + Intronic
953674040 3:44986200-44986222 GGAGCACCCATGGGTGGGGGTGG + Intronic
953906397 3:46870461-46870483 GGGGCCACCATGGCTAGGTGGGG - Intronic
953913598 3:46904854-46904876 AGGGCAGGCAGGGCTGGGTGTGG - Intergenic
954373651 3:50183271-50183293 GGGCCAGCAGTGGCAGGGAGTGG + Intronic
954380221 3:50215322-50215344 GGGGCTACCGTGGCTGGCAGAGG - Intronic
954428746 3:50458026-50458048 GGGGCACCCATGGCTGGGGGAGG - Intronic
954687096 3:52376956-52376978 TGGGCAGCCAGGGATGGGGGAGG - Intronic
955631428 3:60979552-60979574 AGGGCAGACAGGGCTGGCAGCGG + Intronic
957056396 3:75446219-75446241 GGGGCAGCATTGGTTGGGCGGGG + Intergenic
958498398 3:94874775-94874797 TGGGCAGCCATGGGTGGGCCCGG + Intergenic
959398307 3:105868810-105868832 TGGGGAGCCCCGGCTGGGAGTGG + Exonic
960005982 3:112781679-112781701 GGAGCAGCCATGGCTTTTAGAGG - Intronic
961297988 3:125902491-125902513 GGGGCAGCATTGGTTGGGCGGGG - Intergenic
961447220 3:126986522-126986544 GGGCCAGCCAGGTCTGGGTGCGG - Intergenic
961774886 3:129277909-129277931 GGGACAGCGATGACGGGGAGAGG - Intergenic
962808522 3:138943391-138943413 GGGGCAGTGAGGGCTGGGTGCGG + Intergenic
963362236 3:144289149-144289171 GGGGTAGCAATGGCTAGGAGAGG + Intergenic
963437465 3:145289368-145289390 GGAGCAACAATGACTGGGAGGGG + Intergenic
964654537 3:159051990-159052012 GCTCCAGCCATGGCTGAGAGGGG + Intronic
965542063 3:169880344-169880366 TGGGCAGCCATGGGTGGGTCTGG - Intergenic
965929043 3:174019318-174019340 GGGGCTGCCATGGATAGGACTGG + Intronic
966435140 3:179875528-179875550 GGGGGAGCGGTGGCGGGGAGTGG + Intronic
967289318 3:187903708-187903730 GGGGGAGCCACGGCTGTGAATGG - Intergenic
967892130 3:194370988-194371010 GGGGCAGGCACTGCTTGGAGTGG + Intergenic
967939861 3:194757298-194757320 GGGGCAACTATGCCTGTGAGAGG + Intergenic
967947359 3:194814650-194814672 CAGGCAGCCCTGGCTGGGTGGGG + Intergenic
968008053 3:195256241-195256263 GGAGCAGCCAGGCCTGTGAGGGG - Intronic
968078314 3:195829357-195829379 GGCGCAGCCAGGGCTGGGCAGGG - Intergenic
968307004 3:197657236-197657258 GGGGAAACCATGTGTGGGAGAGG - Intergenic
968452901 4:683474-683496 GGGGCCACCCTGGCTGGCAGAGG + Intronic
968621209 4:1604236-1604258 TGGGCAGCCCTGGGTGGGTGCGG - Intergenic
968629914 4:1645030-1645052 AGGGCCGCCTTGGCTGTGAGGGG - Intronic
968649896 4:1756365-1756387 GGCGCAGCAAAGGCTGAGAGGGG + Intergenic
968656215 4:1779529-1779551 GGGGCATCCATGGCTGTAATGGG + Intergenic
968905536 4:3449056-3449078 GGGGCAGCACTGGCTGGGCCAGG - Intronic
969189379 4:5504724-5504746 GGTGCAGACATGCCTGGCAGAGG + Intergenic
969279789 4:6162081-6162103 GGCTCAGCCATGTCTGGGACGGG + Intronic
969285830 4:6201117-6201139 GGGGCAGCCTGGGCTGGTGGGGG - Intergenic
969327445 4:6452098-6452120 GGGGAGGACAGGGCTGGGAGTGG + Intronic
969478206 4:7433054-7433076 AGGGCAGCCTTGGCTGGGTCAGG + Exonic
969814688 4:9678418-9678440 GGGGCAGCATTGGTTGGGCGGGG - Intergenic
970562345 4:17294972-17294994 GGGGCAGGGAAGGTTGGGAGGGG - Intergenic
971116961 4:23659714-23659736 GCAACAGCCATGGCTGTGAGTGG - Intergenic
971309817 4:25515489-25515511 GGGGTGGCCAGGGTTGGGAGAGG - Intergenic
972780007 4:42279277-42279299 GGGGACCCCATGGCTGGCAGAGG - Intergenic
973328810 4:48891428-48891450 GGGGCTGCCATGGCTGGCAGTGG + Intronic
976148074 4:82063214-82063236 GGGACAACCATGGCTGTAAGTGG - Intergenic
976226456 4:82798527-82798549 GGGCCTGGCATGGCTGGGCGAGG + Exonic
976476525 4:85490107-85490129 GGGGCAGAAATGGGAGGGAGAGG + Intronic
976922658 4:90457703-90457725 TGGGCGGCCATGGCTGGGCCCGG + Intronic
978617860 4:110613877-110613899 GGGGCAGGGAAGGGTGGGAGGGG + Intergenic
979868786 4:125790350-125790372 GGGGCAGCAGTGGCTGAGAAAGG - Intergenic
979956156 4:126955979-126956001 TGGGCAGCCATGGGTGGGCCTGG - Intergenic
981286101 4:143020600-143020622 GGTGCAGCCATGACTAAGAGAGG + Intergenic
982313720 4:154010597-154010619 GGGGAAGCCGTGGGAGGGAGAGG - Intergenic
982658639 4:158179317-158179339 GGAGCACCCATGGCTGGGTGTGG + Intergenic
983622210 4:169773605-169773627 TGGTTAGCCATGGCTGGGCGTGG + Intergenic
983630892 4:169848246-169848268 AGGGCAGGCATGGCAGGGTGGGG - Intergenic
983734741 4:171043414-171043436 GGGTCAGGCATGGCTGGCTGCGG - Intergenic
984752906 4:183296130-183296152 GGTGCTGCCATAGCTGGGTGAGG + Intronic
985336864 4:188905462-188905484 GGGGCAGAAAAGGCTGGGTGTGG - Intergenic
985530793 5:432966-432988 GGAGCTGCCAGGGCTGGGGGAGG - Intronic
985538239 5:476132-476154 GGGGCAGTCAGGGCTGGGTGTGG - Intronic
985590501 5:762035-762057 TGGGCATCCAGGGCTGTGAGTGG - Intronic
985651319 5:1109073-1109095 GGGGCTCCCTGGGCTGGGAGAGG - Intronic
985727039 5:1522088-1522110 GAGGCAGCCATAGCTGGGGCAGG + Intronic
985805151 5:2038454-2038476 GGGGCAGCCTCGCCAGGGAGAGG - Intergenic
985975355 5:3415869-3415891 TGGGAAACCCTGGCTGGGAGGGG - Intergenic
985991422 5:3565204-3565226 GGGGAAGCGAGGGCTGAGAGGGG - Intergenic
986515676 5:8560834-8560856 GGGGCTCCCATGGATGTGAGTGG - Intergenic
986706207 5:10456589-10456611 GGGGCAGCCATGCCAAGGAGAGG + Intronic
986825046 5:11511408-11511430 GAGGAAGCCAGGGCTGGGAGGGG + Intronic
987035101 5:14011596-14011618 GCGGCGGCCCTGGCTGGGCGTGG + Intergenic
987661812 5:20888003-20888025 GGAGCAGCAAGGGCTGGGGGAGG + Intergenic
987750982 5:22038424-22038446 GATGCAGCAGTGGCTGGGAGGGG - Intronic
988761771 5:34317316-34317338 GGAGCAGCAAGGGCTGGGGGAGG - Intergenic
990244871 5:53854412-53854434 GTGGCAGCCTGGGCTGGGGGAGG - Intergenic
990960835 5:61391830-61391852 GAGGGACCCATGTCTGGGAGCGG + Intronic
991387515 5:66106348-66106370 GCGGCAACCCTGGCTGGGGGAGG + Intergenic
992297221 5:75337347-75337369 GGGGCGGAGATGGGTGGGAGCGG + Intronic
992527643 5:77628316-77628338 GGGGAGGCCGTGGGTGGGAGGGG - Intergenic
993226254 5:85169487-85169509 GAAGCAGCCAAGGCTGGGTGCGG - Intergenic
993309678 5:86313777-86313799 GCAGCAGCCATGGCTGAAAGGGG + Intergenic
994038012 5:95224799-95224821 GAGGCAGCCTAGGCTGGGTGTGG - Intronic
994118513 5:96088340-96088362 CTGGCAGCCATGGCCTGGAGAGG - Intergenic
994792455 5:104247375-104247397 CAGGCAGCCATAGCTGGGTGAGG + Intergenic
995706321 5:114992190-114992212 TGGGCTGCCTTGGCTGGGTGTGG - Intergenic
995927021 5:117386502-117386524 TGGGCAGCCATGGGTGGGCCTGG - Intergenic
996138833 5:119878884-119878906 GGAACAGCTATGCCTGGGAGTGG + Intergenic
996828882 5:127717721-127717743 TGGGCAGCAATGGGTAGGAGGGG + Intergenic
997768023 5:136524668-136524690 GGGGCAGACGAGGCTGGAAGGGG - Intergenic
998102766 5:139448047-139448069 GGGGAAACAATGGCTGGGTGTGG + Intergenic
998902202 5:146868213-146868235 TGGGCAGCCATGACTTTGAGAGG - Intronic
999201703 5:149821289-149821311 GGAGCACACAGGGCTGGGAGAGG - Intronic
1000380225 5:160622367-160622389 GGACCAGCGATGGCTGGGGGAGG - Intronic
1000565425 5:162841074-162841096 AGGGCATCCATGGTGGGGAGAGG + Intergenic
1001016787 5:168149232-168149254 AGGACAGACATGGCTGAGAGTGG - Intronic
1001644639 5:173271100-173271122 GGCGCAGGCATGGGTGGGAGGGG + Intergenic
1001706452 5:173744451-173744473 GGGGAAACCAAGGCTCGGAGTGG - Intergenic
1002193677 5:177491322-177491344 AGGGCAGCCAGGGTGGGGAGGGG + Intronic
1002256151 5:177959666-177959688 GGGGCAGCCATGGGAAGGAAAGG - Intergenic
1002498994 5:179635006-179635028 GGGGCAGCCACAGCTGGGAGCGG - Intergenic
1002499004 5:179635046-179635068 GGGGCAGCCACAGCTGTGCGGGG - Intergenic
1002502672 5:179657478-179657500 GGGGCAGCCACAGCTGTGCGGGG + Intergenic
1002502682 5:179657518-179657540 GGGGCAGCCACAGCTGGGAGCGG + Intergenic
1002538765 5:179892690-179892712 GGGGGTCCCATGGCTGTGAGAGG + Intronic
1002710177 5:181190562-181190584 GGAGCAGGCATGGGTGAGAGAGG + Intergenic
1003227931 6:4223322-4223344 GCTGCAGCCATGGCTGATAGGGG + Intergenic
1003382824 6:5640418-5640440 GGGGAAGCTCGGGCTGGGAGTGG - Intronic
1003402648 6:5803528-5803550 GGGGCAGCCTGGGCTTGGTGGGG + Intergenic
1004294025 6:14394149-14394171 CAGGCAGCCATAGCTGGGTGAGG - Intergenic
1005372798 6:25153057-25153079 GGGGCAGCCTGGGCAAGGAGGGG + Intergenic
1005424948 6:25692783-25692805 GGGGCTGCCTTGGTTGGGGGTGG + Intronic
1006030544 6:31173837-31173859 GCGGCTGGCATGGCTGGGTGGGG + Intronic
1006044150 6:31280336-31280358 GAGGGACCCATGTCTGGGAGTGG - Intronic
1006184161 6:32170891-32170913 AGGGGAGGCATGGCTGGGGGAGG + Exonic
1006456238 6:34133531-34133553 GGGCCTGCCAGGGCTAGGAGTGG - Exonic
1006647207 6:35522939-35522961 GGGCCAGCCCAGGCTTGGAGTGG + Intergenic
1006649273 6:35537456-35537478 GTGGGAGCCCTGGCCGGGAGCGG - Intergenic
1006867649 6:37222304-37222326 GGGGGGGCCATGGATGGCAGCGG - Intronic
1007418628 6:41706392-41706414 GGGGCAGCCAGTGCTGGCAGAGG + Intronic
1007637389 6:43307679-43307701 GGTGCAGCCAGGGCTGGGAGTGG + Exonic
1007693601 6:43718122-43718144 GGGCGCGCCCTGGCTGGGAGAGG + Intergenic
1008222544 6:48873899-48873921 GGGACTGAAATGGCTGGGAGCGG - Intergenic
1008332756 6:50262643-50262665 GCTGCAGCCATGGCTGAAAGGGG - Intergenic
1008633172 6:53383130-53383152 GGGGCAAGCCTGGCTGGGGGAGG + Intergenic
1010102478 6:72125702-72125724 GTGGCAGCCTGGGCTGGGGGAGG - Intronic
1011281950 6:85686563-85686585 GGGATAGACAAGGCTGGGAGCGG + Intergenic
1013255848 6:108384669-108384691 GGGGAAGCAATTGCTGGGAGAGG + Intronic
1013318500 6:108963977-108963999 GGGGGAGCCAACTCTGGGAGTGG + Intronic
1013491461 6:110650529-110650551 GGGACAGGCATTGTTGGGAGTGG + Intronic
1015776770 6:136822635-136822657 GGGGCAGCGAGGGCCGGGGGCGG + Exonic
1016122737 6:140364063-140364085 GCTGCAGCCATGGCTGAAAGGGG + Intergenic
1016848308 6:148591174-148591196 GGTGGAGCCATGGGTGGGAAAGG + Intergenic
1018037401 6:159893240-159893262 GGGGCAGCCACGCCGGGGTGAGG + Intergenic
1018191979 6:161317134-161317156 GGTGCAGCAAGGGCTAGGAGCGG - Intergenic
1018629067 6:165806419-165806441 GGGGCCACCAAGGCTAGGAGAGG - Intronic
1018777834 6:167034585-167034607 GAGGTTGCCATGGCTGGGTGGGG + Intronic
1019144927 6:169970458-169970480 AGGGCAGCCAGGGCTGTGACAGG - Intergenic
1019147946 6:169986815-169986837 GGGGCTGCGAGGACTGGGAGTGG + Intergenic
1019232994 6:170584461-170584483 GCGGCCGGCATGGCTGGGCGCGG - Exonic
1019420423 7:948178-948200 GGGACAGACATGGCTGGGTCAGG - Intronic
1019428717 7:988857-988879 GGAGGACCCAGGGCTGGGAGGGG - Exonic
1019478109 7:1253864-1253886 GGGGCAGGCAGGGCTGGGGGCGG - Intergenic
1020001391 7:4758246-4758268 TGGGCAGCAATGGCTGGGGGAGG - Intronic
1020782718 7:12536361-12536383 GCTCCAGCCATGGCTGGAAGAGG - Intergenic
1021103329 7:16608579-16608601 GAGGAAGCCATGGATGGGACTGG + Intronic
1021929212 7:25562713-25562735 GGGCCACCCAAGGCTGGGAGTGG + Intergenic
1022960228 7:35419160-35419182 GGGTCTGTGATGGCTGGGAGGGG - Intergenic
1023629761 7:42152471-42152493 GGAGCAGCATTGCCTGGGAGAGG - Intronic
1024009945 7:45258969-45258991 AGGGCAGCCAGGGATGGGAGAGG + Intergenic
1024241326 7:47438711-47438733 GGGGCACCAGTGGCTGGGAGAGG - Intronic
1025854984 7:65268926-65268948 GGGGCAGCGGGGGCTGGGAACGG - Intergenic
1025991850 7:66503221-66503243 GGTGCATCCATTGCTGGCAGCGG - Intergenic
1026000344 7:66556237-66556259 GGGGCTGCCATGGCTGAGCGGGG + Intergenic
1026393580 7:69928228-69928250 TGGGCAGCCATGGGTGGGCCTGG + Intronic
1026501455 7:70946517-70946539 GGGGCAGCTATGTTTGGGCGAGG - Intergenic
1026893754 7:73998400-73998422 GGGGCAGCCAGAGGTGGGAGTGG + Intergenic
1026928744 7:74211134-74211156 GGGGCCGGCAGGGCTGGGCGGGG - Intronic
1027129654 7:75581965-75581987 GGGGAGGCCGTGGCTGGGATGGG - Intronic
1027549539 7:79573861-79573883 ACTGCAGCCATGGCTGGAAGGGG + Intergenic
1027798359 7:82720789-82720811 GGCCCAGCCATGGCTGAAAGGGG - Intergenic
1028011401 7:85648914-85648936 GCTCCAGCCATGGCTGAGAGGGG - Intergenic
1028745321 7:94320597-94320619 GCTGCAGCCATGGCTGAAAGGGG - Intergenic
1028872775 7:95787275-95787297 GGGCTAGGCATGGCTGGGACAGG + Intronic
1029080755 7:97972223-97972245 GCGGCGGCCGGGGCTGGGAGCGG - Intergenic
1029117201 7:98243432-98243454 TGGGGAGCCAGGGCAGGGAGAGG + Intronic
1029252996 7:99250377-99250399 GGGGCAGCCAGGGCCTGCAGAGG - Intergenic
1029320658 7:99756649-99756671 AGGGCATCCATGAGTGGGAGGGG - Intergenic
1029642270 7:101828795-101828817 GGGGAAGTGAGGGCTGGGAGAGG + Intronic
1029713804 7:102314731-102314753 TGGGTGGCCATGGCTGGGGGTGG - Intronic
1030087610 7:105830414-105830436 GGGGCAGGGCTGGGTGGGAGGGG - Intronic
1030651662 7:112122559-112122581 GAGGCAGTCTTGGCTGGGCGTGG - Intronic
1033657073 7:143381560-143381582 GGGGCCGCCATGGCCGGGCCGGG - Exonic
1034309881 7:150078058-150078080 GGAGCATCCATGGCAGGAAGGGG + Intergenic
1034796968 7:154022563-154022585 GGAGCATCCATGGCAGGAAGGGG - Intronic
1035458322 7:159023747-159023769 GGTGCAGCCAGGGGTGGGCGTGG - Intergenic
1035945051 8:3953669-3953691 GGGGAAGTGATGGCGGGGAGGGG + Intronic
1036381751 8:8240339-8240361 GGGGCATCCAGGACTGGTAGGGG + Intergenic
1037765028 8:21767459-21767481 CGTGCAGGCATGGGTGGGAGGGG + Intronic
1037817718 8:22120675-22120697 GGGGTGGCCAGGGCCGGGAGGGG + Intronic
1038563669 8:28601657-28601679 GAGGCTGCCAGGGCAGGGAGAGG - Intronic
1039373916 8:37014287-37014309 GGGGGTGCAGTGGCTGGGAGAGG - Intergenic
1039905791 8:41785640-41785662 GGGGCAGCAGTGGTTGGGACTGG - Intronic
1041006750 8:53503193-53503215 GGGGCAGGCGTGGGTGGGACAGG - Intergenic
1041527284 8:58821608-58821630 GTGGTTGCCAGGGCTGGGAGAGG - Intronic
1042246343 8:66712607-66712629 GGGGCAGCCCGTGCGGGGAGGGG - Intronic
1042337037 8:67640103-67640125 TGGGCAGCCATGGGTGGGCGTGG + Intronic
1042506910 8:69570753-69570775 AGGTCAGCGGTGGCTGGGAGTGG - Intronic
1042851066 8:73216743-73216765 GGTGGAGCCTTGGCTGGGCGCGG + Intergenic
1042955756 8:74249020-74249042 GTGGCAGCCATGTCCGTGAGCGG - Intronic
1043294846 8:78649715-78649737 GGGGCTCCCATGGCTGCGACTGG - Intergenic
1043510327 8:80944753-80944775 GGGGCAGGCATTCCTGGCAGAGG + Intergenic
1045200881 8:99979998-99980020 AGGGCAGAGATGGCAGGGAGTGG + Intronic
1045850850 8:106696878-106696900 GGGGCAGCCTTCCCTGGCAGAGG - Intronic
1046071610 8:109262314-109262336 CAGGCAGCCAAGGCTGGGTGAGG + Intronic
1046651438 8:116840546-116840568 GGGGCAGTCATGGCCAGGATTGG - Intronic
1047415477 8:124661591-124661613 GGTGCAGACACTGCTGGGAGAGG + Intronic
1048125775 8:131634455-131634477 GGGACAGGGATGGTTGGGAGGGG - Intergenic
1048265865 8:132985356-132985378 TTGGTAGCCATGGGTGGGAGGGG + Intronic
1048336630 8:133507490-133507512 GTGGAAGCCGTGGCTGGCAGAGG - Intronic
1048577706 8:135706118-135706140 GGGGAAGCCAGGTCTGGAAGGGG + Intergenic
1049203347 8:141352191-141352213 GAGTCAGGCAGGGCTGGGAGGGG + Intergenic
1049318942 8:141985689-141985711 GAGGCAGCCAGGGCTGGGCAGGG - Intergenic
1049387088 8:142348521-142348543 GGGGCAGCCTGGGGCGGGAGCGG - Intronic
1049387116 8:142348589-142348611 GGGGCAGCCTGGGGCGGGAGCGG - Intronic
1049416476 8:142497771-142497793 GGGGCAGCAGGGGCTGGCAGAGG + Intronic
1049420648 8:142515076-142515098 GGAGAAGCCATTGGTGGGAGGGG + Intronic
1049566443 8:143341535-143341557 AGGGCAGCCATTGCTGGGGTGGG - Intronic
1049747255 8:144268262-144268284 AGGCCAGCCCTGGCTGCGAGCGG + Exonic
1049785748 8:144449891-144449913 GGGGAAGGCATGGCTGTGAATGG - Exonic
1049820072 8:144628052-144628074 GGGAGAGCCATGGCTGGCATCGG + Intergenic
1049832743 8:144712849-144712871 GGGGCGGCCCTGGATGGGAGGGG - Intergenic
1051248761 9:15138092-15138114 GGGCCAGCCACACCTGGGAGTGG + Intergenic
1052437153 9:28443950-28443972 TGGACAGCCATGGGTGGGACTGG - Intronic
1052567073 9:30168435-30168457 TAGGCGGCCATGGCTGGGTGAGG - Intergenic
1052597288 9:30575875-30575897 GGGGCAGCGAGGGCTGTGTGAGG - Intergenic
1052973902 9:34398349-34398371 GTGGCAGCCACAGCTGAGAGAGG + Exonic
1053128185 9:35599565-35599587 TGGGCAGCCATGGGTGGGCCTGG - Intergenic
1053688519 9:40567498-40567520 GGGGCAGCAGTGCCTGGGAGAGG + Intergenic
1054275513 9:63063560-63063582 GGGGCAGCAGTGCCTGGGAGAGG - Intergenic
1054299758 9:63368409-63368431 GGGGCAGCAGTGCCTGGGAGAGG + Intergenic
1054399320 9:64701371-64701393 GGGGCAGCAGTGCCTGGGAGAGG + Intergenic
1054432900 9:65185636-65185658 GGGGCAGCAGTGCCTGGGAGAGG + Intergenic
1054497485 9:65836039-65836061 GGGGCAGCAGTGCCTGGGAGAGG - Intergenic
1055460843 9:76518845-76518867 GTAGCAGCAATGGCTGGGCGCGG - Intergenic
1055757194 9:79570495-79570517 GGGGCAGCCATGGCTGAGGAGGG - Intergenic
1056578816 9:87875637-87875659 GGGGCAGCCCAGGCAGAGAGGGG + Intergenic
1056850694 9:90081360-90081382 TGGTCAGCCGTGGCTGGGGGTGG + Intergenic
1056997129 9:91473422-91473444 GTGGCAGCCTAGGCTGGGGGAGG - Intergenic
1057304863 9:93906151-93906173 GGGGAAGCCACGGCTCAGAGAGG + Intergenic
1058053423 9:100427632-100427654 GGCGCGCCCACGGCTGGGAGCGG + Intronic
1058876731 9:109251155-109251177 GTGGCAGGCAGTGCTGGGAGAGG - Intronic
1059389525 9:113990100-113990122 GGGGAAGGCATTCCTGGGAGAGG - Intronic
1059714948 9:116905046-116905068 GAGGCTCCCAAGGCTGGGAGTGG - Intronic
1060159668 9:121349629-121349651 GGGGCAGCTGTGGGTGGCAGGGG + Intronic
1060188417 9:121577616-121577638 GGGACTGACATGGCTGGGGGTGG + Intronic
1060639579 9:125227355-125227377 GGGGCAGGCATGTTTGGTAGTGG + Intronic
1060799095 9:126532344-126532366 CGGGCAGCCATGTCTGGGGAAGG + Intergenic
1061297096 9:129682630-129682652 GGCGAAGCCATTGCTGAGAGGGG - Intronic
1061297485 9:129684858-129684880 GAGGCAGCCAAGGCTCAGAGAGG + Intronic
1061398302 9:130355210-130355232 GGGGCCGGCAGGGCTAGGAGTGG + Intronic
1061565866 9:131439528-131439550 GGTGAAGCCTTGGCTGGCAGGGG - Intronic
1061743232 9:132722468-132722490 TGGGCAGCCATGGGTGGGTCTGG + Intergenic
1061744478 9:132729421-132729443 GTGGCTGCTCTGGCTGGGAGAGG + Intronic
1061904099 9:133687926-133687948 GAGGCAGCCAGGGCGGGAAGAGG - Intronic
1062073486 9:134571976-134571998 GGGGCAACCATGGGTGGGTGTGG - Intergenic
1062101500 9:134730897-134730919 GGGGCCGCCCTGGCTGGGACGGG + Intronic
1062183289 9:135202635-135202657 GGGTCAGCCAAGGCAGGCAGTGG + Intergenic
1062397178 9:136357208-136357230 GGTGCAGCCATTGCTGGGAAGGG + Intronic
1062440460 9:136567274-136567296 GGGTCTGCCAGGGCTGGGGGGGG + Intergenic
1062440538 9:136567444-136567466 GGGTCTGCCAGGGCTGGGGGGGG + Intergenic
1062449934 9:136611037-136611059 GGGGCGGCCATGGGGGGCAGGGG + Intergenic
1062483586 9:136763521-136763543 GGGGCAGGCATGGGTGGGGTCGG - Intronic
1062547543 9:137070432-137070454 GGGGCCGCCATGGCCGAGCGGGG - Exonic
1062568039 9:137171894-137171916 AGGGGAGCCATGGCTGGGAGTGG + Exonic
1062695729 9:137875433-137875455 GGAGCAGCCAGGGCTGTGGGGGG - Intergenic
1185867453 X:3636567-3636589 GGGCCAGCCCTGGCTGGGTGTGG + Intronic
1186852831 X:13597301-13597323 TTGGCAGCAAGGGCTGGGAGTGG - Intronic
1187683370 X:21791793-21791815 GGGGCTGCCATGGTGAGGAGAGG - Intergenic
1188154357 X:26722817-26722839 GCGGCAGCCCTGGCTGGCACTGG - Intergenic
1188429979 X:30095685-30095707 GGGGCAACAAGGGCTGGGGGTGG - Intergenic
1189053554 X:37672804-37672826 CAGGCAGCTATGGCTGGGTGAGG - Intronic
1189941908 X:46133141-46133163 TGGGAAGCCATTGCCGGGAGGGG + Intergenic
1190233476 X:48599473-48599495 GAGGCAGCCAAGGCGGGGGGCGG + Intronic
1190245493 X:48688044-48688066 GTGGCTGACATGCCTGGGAGAGG - Exonic
1191085563 X:56563865-56563887 GCGGCCGCCATGGCTGAGAATGG + Exonic
1196444381 X:115737726-115737748 TGGGCAGCCCTGGCTAGAAGTGG + Intergenic
1197091030 X:122538272-122538294 GAGGGACCCATGTCTGGGAGTGG - Intergenic
1198370597 X:135985494-135985516 GGGGGAGACATGGCTCGGCGCGG + Exonic
1199163329 X:144640732-144640754 AGGGGAGCCAGTGCTGGGAGTGG - Intergenic
1200074829 X:153545802-153545824 GGGTCACACATGGCTGGCAGTGG - Intronic
1200230712 X:154442679-154442701 GGGGCAGCAGGGGCTGGGGGCGG - Exonic