ID: 1144107228

View in Genome Browser
Species Human (GRCh38)
Location 17:11997245-11997267
Sequence GGGCCGGGGCAGCCATGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 383}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144107228_1144107241 16 Left 1144107228 17:11997245-11997267 CCCAGCCATGGCTGCCCCGGCCC 0: 1
1: 0
2: 5
3: 53
4: 383
Right 1144107241 17:11997284-11997306 CCCGCGCGCTCCCAGACGCATGG 0: 1
1: 0
2: 1
3: 9
4: 72
1144107228_1144107245 23 Left 1144107228 17:11997245-11997267 CCCAGCCATGGCTGCCCCGGCCC 0: 1
1: 0
2: 5
3: 53
4: 383
Right 1144107245 17:11997291-11997313 GCTCCCAGACGCATGGGCAAGGG 0: 1
1: 0
2: 0
3: 7
4: 101
1144107228_1144107244 22 Left 1144107228 17:11997245-11997267 CCCAGCCATGGCTGCCCCGGCCC 0: 1
1: 0
2: 5
3: 53
4: 383
Right 1144107244 17:11997290-11997312 CGCTCCCAGACGCATGGGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 74
1144107228_1144107243 17 Left 1144107228 17:11997245-11997267 CCCAGCCATGGCTGCCCCGGCCC 0: 1
1: 0
2: 5
3: 53
4: 383
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144107228 Original CRISPR GGGCCGGGGCAGCCATGGCT GGG (reversed) Intronic
900002697 1:23521-23543 GGGACAGGGCAGGGATGGCTTGG + Intergenic
900022416 1:194046-194068 GGGACAGGGCAGGGATGGCTTGG + Intergenic
900095599 1:938886-938908 AGGCTGGGGCTGCCAGGGCTGGG + Intronic
900115935 1:1027949-1027971 GGGCCGGGGCGGCCGTGGGCCGG - Intronic
900297167 1:1957624-1957646 AGGCCGGGGCAGCTCTGGCCAGG + Intronic
900344196 1:2203372-2203394 TGGGCAGGGCAGCCATGGGTGGG - Intronic
900389815 1:2429009-2429031 GTGCCGGGCCAGCCAAGTCTAGG + Intronic
900397043 1:2457319-2457341 GGGCCTTTCCAGCCATGGCTGGG + Intronic
900777551 1:4596046-4596068 GGCCCAGGGCTGCCACGGCTGGG + Intergenic
900934820 1:5758629-5758651 GGGCCAGGGCAGCCAGAGCCCGG + Intergenic
900990217 1:6095247-6095269 CTGCCGGGGCAGCCATGGAGAGG - Intronic
901739051 1:11330392-11330414 GGGCAGGGGCGGCCAGGGGTGGG + Intergenic
902220152 1:14959457-14959479 GGACAAGGGCAGCCCTGGCTGGG - Intronic
902410433 1:16208658-16208680 GCGCCGGGCCAGCCACGGCTCGG - Exonic
903063469 1:20685541-20685563 CAGCCGGGGCAGCCCTGGCTAGG - Intronic
904480082 1:30788039-30788061 GGGCAGGGGCCGCCAGGGCTGGG - Intergenic
904495460 1:30884095-30884117 TGGCCAGGGCAGCTGTGGCTGGG - Intronic
906106135 1:43293773-43293795 GGGCCCAGGCAGGCAGGGCTGGG - Intergenic
906290678 1:44617573-44617595 GGGCAAGGGCAGCCAAGGCTGGG - Intronic
907200997 1:52726667-52726689 AGGCCGGCGCAGCCATGGTGAGG + Exonic
908427086 1:64017762-64017784 GGGCTGGGGCAGCGGTTGCTGGG - Intronic
910138397 1:83999078-83999100 CGCCCGTGGCAGCCACGGCTCGG + Exonic
911193635 1:94972260-94972282 GGGCCTGGGCAGCCAGAGTTTGG + Intergenic
912527487 1:110294579-110294601 TGGCCGGGGCAGTCCTGGCGTGG - Intergenic
912569027 1:110608033-110608055 GGGCCCGGGCAGGGAAGGCTGGG + Intronic
913284007 1:117210840-117210862 GCCCCAGGGAAGCCATGGCTGGG + Exonic
914980319 1:152409582-152409604 GAGTCGGGGAAGTCATGGCTTGG + Exonic
915319341 1:155047722-155047744 GGGGCAGGGCAGCCCTGGGTTGG - Intronic
918820636 1:189250090-189250112 GGTCCGGGGCAGCCATGGGTAGG - Intergenic
918905719 1:190490267-190490289 GGGCCTTGGCAGTCATGGCAAGG - Intergenic
920364680 1:205441865-205441887 GGGCCGGGTCAGCCAGAGGTGGG - Intronic
920654832 1:207867664-207867686 GGGCCGAGGCAGCCAGGGCCTGG - Intergenic
922809187 1:228406546-228406568 GGTCGGGGGCGGCCATGGCGCGG + Exonic
923372478 1:233327684-233327706 GGGGCGGGGCGGCCCTGGCGCGG + Intergenic
923685527 1:236150847-236150869 GCAGCGGGACAGCCATGGCTGGG - Intronic
924557284 1:245129025-245129047 GGGGAGGGGCAGCCAGGACTGGG + Intergenic
1064010323 10:11730267-11730289 GTGCATGGGCAGCCATGGGTGGG - Intergenic
1064354454 10:14604480-14604502 GGGGCGGGGCTGCCAGGGCGGGG - Intronic
1067508655 10:46877320-46877342 GGGCTGGGGCAGCCAGAGCCAGG - Intergenic
1067653594 10:48174530-48174552 GGGCTGGGGCAGCCAGAGCCAGG + Intronic
1069694676 10:70377767-70377789 GGGCTTGGCCAGCCCTGGCTTGG - Intronic
1069857799 10:71451290-71451312 GGGCAGGGCCATCCATGGCTGGG - Intronic
1070139901 10:73731606-73731628 GGGCCCGCGCAGCCAAGGCAGGG - Intergenic
1070161706 10:73870846-73870868 GGGCCAGGGTAGCCATGGGCTGG - Intronic
1070842196 10:79494996-79495018 GGGAAGGCGCAGCCATGGGTGGG - Intergenic
1073443110 10:103564473-103564495 GGGGCTGGGCAGCCCAGGCTAGG - Intronic
1074105637 10:110387995-110388017 GGGCTGGGGCAGCCTGAGCTAGG - Intergenic
1074346446 10:112690895-112690917 GGGCAGGGGCACCTATGGCTAGG - Intronic
1074761491 10:116670178-116670200 TGGCTGGGGCAGCCAAGGCGCGG - Intronic
1076161967 10:128251351-128251373 GGGCCTGGTCAGCCCTGCCTGGG + Intergenic
1076291346 10:129348394-129348416 GGGCCGTGGCAGCCCCGGCTCGG - Intergenic
1076291363 10:129348445-129348467 GGGCCGTGGAAGCCCCGGCTCGG - Intergenic
1076291377 10:129348496-129348518 GGGCCGTGGCAGCCCTGGCTCGG - Intergenic
1076291407 10:129348597-129348619 GTGCCATGGCAGCCCTGGCTCGG - Intergenic
1076690640 10:132222421-132222443 GGGCAGGGACAACCAGGGCTGGG - Intronic
1076723666 10:132403781-132403803 GGGCAGGAGCAGCCACTGCTGGG - Intronic
1076733259 10:132448578-132448600 GGGCGGGGCCAGCCAGGGTTGGG - Exonic
1077012811 11:386323-386345 GTGCATGGGCAGCCATGGGTGGG - Intergenic
1077844821 11:6013139-6013161 GGGCAGCTGCAGCCATGCCTGGG + Intergenic
1078633703 11:13029669-13029691 AGGACGGGGCAGCCATGGACAGG + Intergenic
1078993701 11:16674653-16674675 AGGCCAGGGCAGCCAAGGCTGGG + Intronic
1081854560 11:46295488-46295510 GGGCCGAGGCAGAAATGGCCTGG - Intronic
1083713100 11:64560628-64560650 GGGCTGGGACAGTCATGCCTGGG - Intronic
1083763926 11:64833240-64833262 GGGCCTGGGCCGCCAGGGCCTGG - Exonic
1084165562 11:67373381-67373403 GGGCCGGGGGAGGCACGGCTGGG - Intronic
1084279392 11:68077408-68077430 GGGGCTGGACAGACATGGCTGGG + Intronic
1084284076 11:68120708-68120730 GGGCCGGGGGAGCCGGGGCCGGG - Intronic
1084335889 11:68457700-68457722 AGGAGGGGGCAGCCAGGGCTGGG - Intergenic
1084611161 11:70203760-70203782 GGGCCGGGGGAGCCAGGGCCTGG + Intronic
1084694338 11:70744753-70744775 GGGCTGTGGGAGCCCTGGCTGGG + Intronic
1084699280 11:70776040-70776062 GGGTCTGGTCAGCCAGGGCTGGG - Intronic
1087022226 11:93615116-93615138 AAGCCTGGGCAGCCAAGGCTAGG - Intergenic
1088075147 11:105839056-105839078 GGGCCGGTGCATGCATGGATGGG - Intronic
1088916215 11:114229838-114229860 GGGCCGGGGCAGGCAGGGGTTGG + Intronic
1089063166 11:115642735-115642757 GGGCTGGGGAAGCGAGGGCTGGG + Intergenic
1089077156 11:115747405-115747427 GGGCCTGGAGAGCCAAGGCTAGG + Intergenic
1089171814 11:116517241-116517263 GGCCTGGGGCAGTCATGACTAGG + Intergenic
1089401250 11:118166007-118166029 GGGCAGGGGCAGCCAAGGCTGGG - Exonic
1089650142 11:119907575-119907597 GGGCCTGGGTAGGCAAGGCTGGG + Intergenic
1089927205 11:122271201-122271223 GGGGCGGGGCCTCCATGGCTAGG - Intergenic
1090627548 11:128619594-128619616 GGGCCGCAGCAGCCTAGGCTGGG + Intergenic
1091376114 12:25584-25606 GGGACAGGGCAGGGATGGCTTGG + Intergenic
1091390840 12:125390-125412 GGGAAGGGGCAGCTATGGCCAGG - Intronic
1091917967 12:4282782-4282804 GGGGCAGGGCTGCCATGGCAAGG - Intronic
1092280244 12:7092666-7092688 GGGCCCGGGGAGCCTTGGGTTGG + Intronic
1096513907 12:52146098-52146120 GGGCCTGGGAAGGCAAGGCTTGG + Intergenic
1098155134 12:67589754-67589776 GGAAAGGTGCAGCCATGGCTGGG + Intergenic
1101444986 12:104731235-104731257 GGGCGGGGGCAGCCGTGTCTGGG - Intronic
1101605792 12:106247261-106247283 GGGCCTGGGCAGGCAGCGCTAGG + Intronic
1101987379 12:109458167-109458189 GAGATGGGGCAGTCATGGCTGGG + Intronic
1102937712 12:116911377-116911399 GGGCCGGCGCAGGCATGGGCGGG - Intronic
1104854764 12:131896399-131896421 GGCCCAGGGCAGGCAGGGCTGGG + Intronic
1104859791 12:131918042-131918064 GGCCAGGGGCTGCCATCGCTGGG + Intronic
1104982819 12:132581802-132581824 GGGCCTGGGCAGCCATGCACTGG + Exonic
1107999287 13:45891602-45891624 GGGCAGGGGCTGCCAAGGTTAGG + Intergenic
1108340659 13:49496006-49496028 GGGCCGGGGCGGCGACGCCTGGG - Exonic
1108403886 13:50081201-50081223 GGGGGAGGGCAGCCAGGGCTTGG + Intergenic
1112066266 13:95796318-95796340 GGGACTGGGCCGCCGTGGCTTGG + Intergenic
1113581072 13:111429480-111429502 GGGCAGGGGCAGCCCTGGAGTGG - Intergenic
1113665868 13:112141982-112142004 GGCCCAGGGGAGCCGTGGCTGGG - Intergenic
1113820568 13:113209621-113209643 GGGCCTCGTCCGCCATGGCTGGG - Exonic
1114455524 14:22851051-22851073 GGGGCTGGGCAGCCAGGGCCTGG + Intergenic
1115541250 14:34423595-34423617 GGACCCCGGGAGCCATGGCTGGG - Intronic
1118098362 14:62565640-62565662 GGGCCTGGCAAGCTATGGCTAGG + Intergenic
1118817262 14:69322349-69322371 GGACTAGGTCAGCCATGGCTAGG - Intronic
1118992514 14:70809291-70809313 GGGCCCGGGCTGGCAGGGCTGGG + Exonic
1119085837 14:71738191-71738213 TGGCAGGGGCCTCCATGGCTGGG - Intronic
1119427279 14:74543956-74543978 GGGCTGGGGCAGGGGTGGCTAGG - Intronic
1119443132 14:74642288-74642310 GGGCCGGGCCAGGCCAGGCTGGG - Intergenic
1119623711 14:76152259-76152281 GGGCTGGGGCGACCATGGCTCGG - Intronic
1121788945 14:96684194-96684216 GGGCCACGGCAGAGATGGCTGGG + Intergenic
1121818119 14:96943818-96943840 TGGCTGGGGCAGCCAGGGCTAGG - Intergenic
1122208406 14:100159724-100159746 GGGGCGGGGCACCTCTGGCTGGG + Exonic
1122537430 14:102475334-102475356 AGGCCGGGGCAGGGAGGGCTGGG + Intronic
1123084779 14:105712399-105712421 GGGCCGGGTCATCCCTGGTTAGG + Intergenic
1123976491 15:25558875-25558897 GGGCTGGGGCAGAGATGTCTGGG - Intergenic
1124597538 15:31103078-31103100 TGGCCGGCACTGCCATGGCTGGG + Intronic
1125318146 15:38454318-38454340 GGGCCTGGGCGGCCATGTGTAGG + Intronic
1127997607 15:64162791-64162813 GGGCCCGGGCGGCCTTGGCTTGG - Intronic
1128543386 15:68551966-68551988 GGGCCGGGGGAGACCTGGCAGGG + Intergenic
1129253714 15:74322304-74322326 GGGCGGGAGCAGCCAGGGCTGGG + Intronic
1129467986 15:75734509-75734531 GGGCGTGGGCAGAGATGGCTCGG - Intergenic
1129712348 15:77826729-77826751 GGGCCGGGCCAGCCTTACCTGGG - Intergenic
1129762677 15:78139853-78139875 GGGCCAGGTCCCCCATGGCTTGG - Intronic
1130040748 15:80404065-80404087 GTGCGGGGGCAGCCCGGGCTAGG + Intergenic
1130531186 15:84748703-84748725 GGGCCGGGGCAGCCCCAGCCTGG + Intronic
1130959504 15:88650342-88650364 GGGCTGGGGCAGTCACAGCTGGG + Intronic
1131132057 15:89906491-89906513 GAGCCCAGGCAGGCATGGCTGGG - Intronic
1131329193 15:91480474-91480496 GGGCCCGTGCAGCCCAGGCTTGG - Intergenic
1131866559 15:96717479-96717501 GGGCAGGAGCAGCCTTAGCTTGG - Intergenic
1132342872 15:101089018-101089040 GCCCCGGGGCAGCCATTTCTCGG - Intergenic
1132414542 15:101610994-101611016 GGGCGGGGGCAGCCTTGGGTAGG - Intergenic
1132450814 15:101967418-101967440 GGGACAGGGCAGGGATGGCTTGG - Intergenic
1132616368 16:842860-842882 GGGCCGGGGGTGCGTTGGCTGGG + Intergenic
1132883118 16:2171016-2171038 GGGCGAGGGCGGCCAAGGCTGGG + Intronic
1132886621 16:2185069-2185091 GGGCCAGGGTGGCCAGGGCTGGG - Intronic
1132941972 16:2512997-2513019 GGGCAGCGCCAGCCCTGGCTGGG + Intronic
1133301495 16:4785442-4785464 AGGAGGGGACAGCCATGGCTTGG + Intronic
1135290697 16:21235450-21235472 GGGCCCAGGAAGCCATGTCTTGG + Intronic
1136718034 16:32300974-32300996 TGGCAGGGCCAGCCATGGCAGGG + Intergenic
1136775343 16:32868771-32868793 GGCCCTGGACAGCCATGGCTTGG + Intergenic
1136836410 16:33507244-33507266 TGGCAGGGCCAGCCATGGCAGGG + Intergenic
1136895273 16:33992741-33992763 GGCCCTGGATAGCCATGGCTTGG - Intergenic
1138105541 16:54285666-54285688 GGGGGGAGGCAGCGATGGCTGGG - Intronic
1138576689 16:57911950-57911972 GGGCCAGCCCAGCCATGGGTTGG - Intronic
1139505805 16:67397575-67397597 GGGCCCGGGCAGGCTTTGCTGGG - Intronic
1139515772 16:67451528-67451550 GGGCCTGGGCAGCCATCAGTGGG + Intronic
1139531098 16:67543093-67543115 GGGTCTGGACAGCCATGGCCAGG - Exonic
1141134839 16:81458429-81458451 GGGCCAGCACAGCCCTGGCTGGG + Intronic
1141477330 16:84282679-84282701 GGGCCAGGCCAGCCAGGTCTGGG + Intergenic
1141576311 16:84966372-84966394 GGGCCTGGGAAGCGAGGGCTGGG - Intergenic
1141618102 16:85221595-85221617 GGGTAGGGGCAGCCCTGGCTGGG - Intergenic
1142214898 16:88825444-88825466 GTGCCTGGGCGGCCAGGGCTGGG + Intronic
1142361676 16:89630578-89630600 GGGCTGGGGGAGCCGGGGCTGGG + Intronic
1142361690 16:89630607-89630629 GGGCTGGGGGAGCCAGGGCTGGG + Intronic
1142361738 16:89630697-89630719 GGGCTGGGGGAGCCGGGGCTGGG + Intronic
1203008394 16_KI270728v1_random:216791-216813 TGGCAGGGCCAGCCATGGCAGGG - Intergenic
1203077760 16_KI270728v1_random:1130880-1130902 GGCCCTGGACAGCCATGGCTTGG + Intergenic
1203146592 16_KI270728v1_random:1807545-1807567 TGGCAGGGCCAGCCATGGCAGGG + Intergenic
1142598382 17:1040478-1040500 GGGGCGGGGAAGTCAAGGCTGGG - Intronic
1143762547 17:9115768-9115790 GCGCCGGGGCAGCCTTGGATGGG + Intronic
1144021315 17:11241559-11241581 GGGCCGGGGGCGCCCTGGCACGG + Exonic
1144107228 17:11997245-11997267 GGGCCGGGGCAGCCATGGCTGGG - Intronic
1144946394 17:18971604-18971626 GGTGGGGGCCAGCCATGGCTGGG + Exonic
1145063822 17:19748726-19748748 GGCCCGGGGCAGCGGTGGCTGGG - Intronic
1145230066 17:21167287-21167309 GGGCCCGGGCAGCCAGAGTTCGG - Intronic
1145765617 17:27456609-27456631 GGGCCGCGGCGGCCGAGGCTGGG - Intergenic
1146357033 17:32142813-32142835 GGGCCGGGGCTGCAAAGGTTGGG - Intronic
1146401602 17:32504278-32504300 GGGGAGGGGCAGCCCAGGCTGGG - Intronic
1147142320 17:38466598-38466620 GGGCCCGGGGGGCCATGGCTGGG - Exonic
1147204161 17:38824866-38824888 GGGCGGATGGAGCCATGGCTAGG - Intronic
1147683973 17:42276195-42276217 GGGCCGGGGGAGCCAGGCCGGGG - Intronic
1147948360 17:44093064-44093086 GGCCCTGGGCAGGCATGGGTGGG - Intronic
1148050462 17:44767655-44767677 GTGCCGGGGCAGCTGGGGCTGGG - Intronic
1148050986 17:44769833-44769855 GGGGCGGGGGAGACATGGCTAGG + Intronic
1148200837 17:45749121-45749143 GGGGTGGGACAGCCAGGGCTTGG + Intergenic
1148795063 17:50192944-50192966 GTGCCGGGGCAGCAATGGGAAGG + Intronic
1148846819 17:50534375-50534397 GGGCCAGGGCAGCCAGGTCCAGG + Intronic
1150237028 17:63601382-63601404 GGGCAGCGGCAGCCAGTGCTGGG - Intronic
1150287010 17:63960336-63960358 GTGCCGAGGCAGCCATGGCCAGG - Intronic
1150676015 17:67246009-67246031 GCGCGGAGGCAGCCAGGGCTCGG + Intergenic
1151497492 17:74467330-74467352 GTCCCGAGGCAGCCTTGGCTGGG + Intronic
1151676493 17:75601499-75601521 GGGCAGGGGCAGCCGGGGCTTGG - Intergenic
1151694479 17:75707188-75707210 GGACTGGGGCAGCCCTGGCCAGG - Exonic
1152069131 17:78126468-78126490 GGGCTGGGGCACCCAAGTCTTGG + Intronic
1152126550 17:78450639-78450661 GTGCCCTGGCAGCCAGGGCTTGG - Intronic
1152228790 17:79104565-79104587 GGGGTGGGGCAGTCATGCCTTGG - Intronic
1152305656 17:79518941-79518963 GGGCCGAGGCGGCCACGGCCAGG + Intergenic
1152511953 17:80796005-80796027 GGGCCAGGGCAACGATGCCTGGG - Intronic
1152564500 17:81094099-81094121 GGGCCAGGGCAGCCAGGGGTCGG + Intronic
1152834457 17:82520146-82520168 GGGCGGCGGCGGCCATGGCGGGG + Exonic
1156491712 18:37500222-37500244 GGCAGGCGGCAGCCATGGCTGGG + Intronic
1156854954 18:41771027-41771049 GGGCTGGGTCATCCATGACTAGG + Intergenic
1158893743 18:61894770-61894792 GGGCCGGGGCCGCGGTGGGTGGG + Intergenic
1159706956 18:71702614-71702636 GGGCGGTGGCTGCCAGGGCTTGG + Intergenic
1159889565 18:73940922-73940944 GGGCCAGGGCTGCCTTGCCTGGG + Intergenic
1160240470 18:77119113-77119135 GAGCTGGGGCAGCCATGGCTTGG + Intronic
1160577418 18:79864378-79864400 GCGCGGGGGCAGCCATGGCCAGG + Intronic
1160634448 19:65129-65151 GGGACAGGGCAGGGATGGCTTGG + Intergenic
1160874019 19:1288920-1288942 GGGCTGGGGCGTCCAGGGCTTGG + Intronic
1160878813 19:1310440-1310462 GGGACCGGGCAGCGAAGGCTGGG + Intergenic
1160939188 19:1612176-1612198 GTGCTGGGGCAGCCCTGGCCGGG + Intronic
1161067929 19:2247697-2247719 GGGCTAGGGCCGCCAGGGCTGGG - Intronic
1161898326 19:7099268-7099290 GGGCGGGGGAAGCCGAGGCTCGG + Intergenic
1162013482 19:7831327-7831349 GGGCAGGGGCAGATATGCCTGGG - Intronic
1162711312 19:12596971-12596993 GGGCCGGGGCCGCAATCGCAGGG + Intronic
1163423076 19:17226139-17226161 GGGGCGGGGCTGACCTGGCTGGG - Intergenic
1163473485 19:17511666-17511688 GGGCCGGCGCGGCCATGGCGAGG - Exonic
1163583872 19:18153748-18153770 GGGGCGGGGCAGGCAGGGCTGGG - Intronic
1163822680 19:19505261-19505283 GGGTCTAGGCAGCTATGGCTGGG + Intronic
1165307238 19:35010223-35010245 GGGCGGGGGCCCCCATGGCCAGG + Intronic
1165330379 19:35138673-35138695 GGGCCAGGGCAGTCTGGGCTGGG + Intronic
1166359707 19:42248001-42248023 GGGGCAGGGCAGGCAGGGCTGGG + Exonic
1166644963 19:44524913-44524935 GGGCTGTGGCTGTCATGGCTGGG - Intronic
1166750643 19:45162614-45162636 GGGCTGGGGCTGCCAGGGCTGGG - Intronic
1167052250 19:47086449-47086471 GGGCAGGGGCAGCCGAGGCAGGG - Exonic
1167569917 19:50280544-50280566 GGGTCAGGACAGCCAGGGCTGGG - Intronic
1167593756 19:50417284-50417306 GGGGCGGGGCAGCCCAGGGTCGG - Intronic
1167722845 19:51190674-51190696 AGGAGGAGGCAGCCATGGCTGGG - Intergenic
1168350882 19:55674955-55674977 GGGCCGGGGCGGGCGTGGCGTGG + Intergenic
925152289 2:1623138-1623160 GGGCTGGGGCAGCCATTGGAGGG - Intergenic
925364538 2:3302928-3302950 GGGCCTGGGCAGCCACAGCAGGG + Intronic
925607448 2:5673417-5673439 GGGCCGCGGGAGCCCTGGCCAGG + Intergenic
926570639 2:14526369-14526391 GGGCCTCAGCAGCCAAGGCTTGG + Intergenic
926675813 2:15619058-15619080 GGGCAGCTGCAGCCATGCCTGGG + Intronic
927192204 2:20524498-20524520 GGGCCCGGGCAACCATGGCATGG - Intergenic
927894672 2:26774142-26774164 GGGCCGGGTCACCCAGGTCTGGG + Intronic
928225049 2:29441386-29441408 GGGCAGGGCCCGCCCTGGCTGGG + Intronic
928303578 2:30147487-30147509 GGGGCGGGGCAGCCGCGGCGCGG - Intronic
929400000 2:41568345-41568367 AGTCTGGGGAAGCCATGGCTGGG + Intergenic
929452965 2:42048554-42048576 GGGCCGGGGGAGCCTGGGCCGGG - Exonic
929593173 2:43159975-43159997 GGGGCTGGGCAGGCAAGGCTAGG - Intergenic
933847403 2:86337226-86337248 GGGCCGGGACGGCGAGGGCTGGG - Intronic
933983673 2:87573601-87573623 GGGCCGGGCCAGCGAATGCTTGG + Intergenic
934850571 2:97698015-97698037 GGGGCGGGGCAGCTTTGGATGGG - Intergenic
935856994 2:107285587-107285609 GTGCCAGGGCAGACATGGGTAGG - Intergenic
936075486 2:109398956-109398978 GGGCCAGGGCAGGCATCCCTGGG + Intronic
936567026 2:113589898-113589920 GGGACAGGGCAGGGATGGCTTGG - Intergenic
937274213 2:120673703-120673725 GGGCCGGGCCAGCCAGTGCTAGG + Intergenic
937354983 2:121192645-121192667 GGTCAGGGGCAGCCTTGGCCTGG - Intergenic
941562782 2:167069624-167069646 GGGTCGGGGCAGCAGGGGCTTGG - Intronic
942208675 2:173648954-173648976 GTCCTGGGGCAGCCATGGCCTGG + Intergenic
942828569 2:180210719-180210741 AGGCTGGAGCAGTCATGGCTTGG + Intergenic
944605286 2:201346907-201346929 GGGCAGGGGCATCAGTGGCTTGG - Intronic
946003059 2:216499035-216499057 GGGGCGGGGGCGCCTTGGCTGGG + Intronic
946268369 2:218568459-218568481 GGGGCGGGGCTGCCCGGGCTAGG - Intergenic
946809637 2:223509997-223510019 AAGCCTGGGCAGCAATGGCTAGG - Intergenic
947615549 2:231554769-231554791 GGGCAGGGGCAGCCTTGGTAAGG - Intergenic
947819476 2:233060181-233060203 GAGCCGCGGCAGCCGTGGCAGGG + Exonic
948508602 2:238448190-238448212 GGGCCAGGACAGCCGGGGCTGGG + Exonic
948712476 2:239833653-239833675 GGCCAGGGACAGCCATGGGTGGG - Intergenic
948856888 2:240734381-240734403 GGCGCGGGGCAGGCAAGGCTGGG + Intronic
948859277 2:240745095-240745117 CAGCCAGGGCAGCCCTGGCTTGG - Intronic
948918587 2:241051031-241051053 GGGGTGGGGCAGCCAGAGCTTGG + Intronic
1169457885 20:5768358-5768380 GGGGCAGGCCAGCCATGGCTAGG - Intronic
1172181891 20:33008561-33008583 CGGCCAGGGCAGCCATGGCTTGG + Exonic
1172272022 20:33660136-33660158 CGGGCGGGGAAGCCATGGCAGGG - Intronic
1175410979 20:58768945-58768967 GGGGCAGGGCAGCCATGGCCAGG - Intergenic
1175499759 20:59441482-59441504 GGGGTGGGGCAGCCCTGGTTGGG + Intergenic
1175538080 20:59729232-59729254 GGGCCGGGGGAGTCAGGGCAGGG + Intronic
1175920687 20:62449320-62449342 GTGCCGGGGGAGGCCTGGCTGGG + Intergenic
1176275392 20:64263358-64263380 GGGCCAGGGAAGCCTTGGCCTGG + Intronic
1179887150 21:44319043-44319065 GGGCTGGTCCAGCCCTGGCTCGG + Intronic
1179891134 21:44335597-44335619 GGGCCGGGACAGCGAGAGCTGGG - Intronic
1179952403 21:44716318-44716340 GGGCCAGGCCATCCAAGGCTGGG + Intergenic
1180071269 21:45436872-45436894 GCTGGGGGGCAGCCATGGCTGGG + Intronic
1180150381 21:45944184-45944206 GTGCAGGGGCAGCCAGAGCTGGG + Intergenic
1180837544 22:18937821-18937843 GGGCCTGGGCACCCAGCGCTAGG - Intergenic
1181063519 22:20293685-20293707 GGGCCTGGGCACCCAGCGCTAGG + Intergenic
1181273465 22:21674116-21674138 GGGCCTGGGTAGGCATAGCTGGG + Intronic
1182426011 22:30273073-30273095 GGGCTGGGGCATCCAGGGCTGGG + Intergenic
1183444417 22:37843860-37843882 GGGGCGGGGCAGCCCGGGCGAGG - Intronic
1183716311 22:39535460-39535482 GGGCAGGGGCAGCCACTGTTGGG + Intergenic
1184333237 22:43839036-43839058 GTGTCGGGGCAGCCCTGCCTGGG - Intronic
1184508157 22:44916683-44916705 GGGGAGGGGCCGCCCTGGCTCGG + Intronic
1184803126 22:46774578-46774600 GGGCAGGGCCAGGCATTGCTGGG + Intronic
1185082722 22:48718661-48718683 GGGCCGGGGGAAGCCTGGCTGGG - Intronic
1185252335 22:49810745-49810767 GTGCAGGGGCAGCGATCGCTCGG - Intronic
1185266597 22:49907227-49907249 GGGCAGGGGCAGCCAGGCCTGGG - Intronic
1185342356 22:50297289-50297311 GGGCGGGGGCAGCCAAGGTCAGG + Intronic
1185420879 22:50733729-50733751 GGGCCACGGCAGCACTGGCTGGG - Intergenic
1203287637 22_KI270734v1_random:163120-163142 GGGCCTGGGCACCCAGCGCTAGG - Intergenic
949987840 3:9553748-9553770 GGGCCGAGGCAGCCGCTGCTGGG - Exonic
950442178 3:13016478-13016500 GGGGCGGGAGAGCCACGGCTGGG - Intronic
950522355 3:13504788-13504810 GGGCAGGGCCATCCCTGGCTGGG + Exonic
950665455 3:14492363-14492385 GGGCAGGTGTAGCCAGGGCTGGG - Exonic
950864300 3:16176505-16176527 GGGCTGGGGCTGCCCTGGCAGGG - Intronic
953905462 3:46866256-46866278 GGGCCTGGAGAGCCAGGGCTGGG + Intronic
953914190 3:46907404-46907426 GGGCAGGAGCAGCCTTGGCATGG + Intergenic
954013424 3:47663608-47663630 GGGCCGGAGTCGCCATGTCTGGG - Intronic
954121793 3:48504079-48504101 GGACCGGCGCAGTCATGGCTGGG + Exonic
954279324 3:49564809-49564831 GCACAGGGGCTGCCATGGCTAGG - Intronic
963947236 3:151159988-151160010 GGGCCGGGGGGGCCAGGGCTGGG - Exonic
966808727 3:183825539-183825561 GCGCCGGGGCTGGCATGGCGTGG - Exonic
968515767 4:1015059-1015081 GGGCTGGGCAAGCCAGGGCTGGG - Intronic
968528150 4:1075118-1075140 GGGCCATGGCAGACTTGGCTGGG + Intronic
968612478 4:1563556-1563578 GGGCCTGGGCAGCAACGGGTGGG - Intergenic
968621939 4:1607635-1607657 GGGCGGGTGAAGCCAGGGCTTGG - Intergenic
968703961 4:2069586-2069608 GCGCCGGGGCTGCCAGGGCAAGG - Intergenic
968725914 4:2247731-2247753 GGGCCGGGGCAGACAGAGCAGGG + Exonic
968788001 4:2638312-2638334 GGGCCTGGGCAGCATGGGCTTGG + Intronic
969054537 4:4393402-4393424 GGCCCTTGGCAGCCTTGGCTGGG + Intronic
970823867 4:20251750-20251772 AGGCCGGGGCTGCCAGCGCTGGG - Intergenic
970833014 4:20365631-20365653 AGGTAGGGGCAGCCATGACTGGG - Intronic
971409956 4:26359695-26359717 GGGCCGGGGCGGGCGTGGCGTGG + Intronic
972644059 4:40951499-40951521 GGCTCAGTGCAGCCATGGCTTGG + Intronic
976226454 4:82798522-82798544 TGGCCGGGCCTGGCATGGCTGGG + Exonic
982069975 4:151686486-151686508 GGGCAGGGGGAGCCCAGGCTGGG - Intronic
985035687 4:185838183-185838205 GGGCGGGGCCAGCCAGGCCTGGG - Intronic
985538240 5:476137-476159 GAGCGGGGGCAGTCAGGGCTGGG - Intronic
985602490 5:842575-842597 GTGCGGGTGCAGCCATGCCTGGG + Intronic
985709425 5:1419968-1419990 GGGCCGGTGGAGCCAGGTCTGGG - Intronic
987035099 5:14011591-14011613 GCGCCGCGGCGGCCCTGGCTGGG + Intergenic
987088520 5:14490481-14490503 GGACTGGTGCAGCCATGGTTTGG - Intronic
987129825 5:14850160-14850182 GGGCAGGGTTAGCCTTGGCTTGG - Intronic
987661809 5:20887998-20888020 GGGCTGGAGCAGCAAGGGCTGGG + Intergenic
988337308 5:29923099-29923121 GAGCCAGAGCAGCAATGGCTTGG + Intergenic
988761774 5:34317321-34317343 GGGCTGGAGCAGCAAGGGCTGGG - Intergenic
990509990 5:56481188-56481210 CGGCCGGGGCGGCCTTGGCCTGG + Intronic
992111572 5:73498827-73498849 GGGCCGGGCAGGCCCTGGCTAGG + Intronic
992398159 5:76386643-76386665 GGGCCAGCCCAGCCATGACTGGG - Intergenic
992565670 5:77993180-77993202 GGGGCGGAGTAGGCATGGCTAGG + Intergenic
993900169 5:93579614-93579636 GGGCGGGGGCAGCCGATGCTGGG - Intergenic
997265116 5:132490821-132490843 GGGCGGGGCCGGCCAGGGCTGGG - Intergenic
1001571820 5:172735229-172735251 GGGCCTGAGCAGCTAGGGCTTGG + Intergenic
1002332513 5:178454466-178454488 GGGTGGGGGCAGGCCTGGCTTGG + Intronic
1002435334 5:179227839-179227861 GGGGCAGGGCAGCCCTGGCTTGG + Intronic
1003345273 6:5260930-5260952 GGGCGGGCGCAGGCAGGGCTCGG + Intronic
1004603136 6:17169996-17170018 GGGCTGAGCCAGCCATGGATGGG + Intergenic
1005719413 6:28586672-28586694 GAGCCTGGCCAGCCAAGGCTGGG + Exonic
1006108507 6:31730359-31730381 GGGCCTGGGCAGCGCTCGCTGGG - Intronic
1006162588 6:32047000-32047022 GGGCCGGGGCAGCCAGGGTGGGG + Intronic
1006329822 6:33382393-33382415 GGGGCGGGGGAGCCATCACTAGG + Intergenic
1006434648 6:34019899-34019921 AGGCCAGTGCAGCCAGGGCTGGG - Intronic
1006832322 6:36976421-36976443 GGGCCGGGCCTGGCAGGGCTGGG - Intronic
1007763433 6:44147542-44147564 GGTCCTGGGCAGGCAAGGCTGGG + Intronic
1007832947 6:44652850-44652872 GGAAGGGGGCAGCCAAGGCTAGG + Intergenic
1010082999 6:71886369-71886391 CGGCCGGGGCACGCGTGGCTCGG + Intergenic
1012912892 6:105137184-105137206 AGGCGGCGGCAGCCAGGGCTGGG + Intergenic
1015310549 6:131762397-131762419 GGGCCGGGGCAGCGGGGGCAGGG - Intergenic
1015328350 6:131950381-131950403 GGGAAGGGGCAGTCAGGGCTGGG + Exonic
1015776766 6:136822630-136822652 CGGCCGGGGCAGCGAGGGCCGGG + Exonic
1016887449 6:148971172-148971194 GGGCCAGGAAAGCCATGGTTTGG - Intronic
1017146613 6:151240691-151240713 GGTCCGAGGCAGCGATGGCGGGG - Exonic
1017884680 6:158588921-158588943 GGGCCGGGGCAGAGCTTGCTGGG + Intronic
1018619230 6:165714548-165714570 GGGCTGGGGCAGCCAGGGGAGGG + Intronic
1018669659 6:166168056-166168078 GGGCCGGGGCTCGCAGGGCTGGG - Intronic
1019047842 6:169161988-169162010 GGGCCGGGGCACCCGTGGACAGG - Intergenic
1019048102 6:169163353-169163375 GGCCCGGGGCACCCAGGCCTGGG - Intergenic
1019170550 6:170131063-170131085 GGGCCGGGGGTGCCAAGGCCTGG - Intergenic
1019197259 6:170289968-170289990 GGGCCGCGCCAGCCACGGCCCGG - Intronic
1019612995 7:1946267-1946289 GGGCCGGGGCAGCACTGGAGGGG - Intronic
1019640930 7:2103270-2103292 CCGTCGGGGCAGCCATGGCTTGG - Intronic
1019700814 7:2474403-2474425 AGGCAGGGGCAGGCATGGCCTGG - Intergenic
1019774856 7:2906421-2906443 AGGCCAGGTCAGCCAGGGCTGGG + Exonic
1019910752 7:4099427-4099449 GGGCCGGGCCAGGCAAGGTTAGG + Intronic
1021253071 7:18355902-18355924 GGGCTGGGGCAGGAATGGGTGGG + Intronic
1022100131 7:27164582-27164604 GGGCCTGGGCAGCCAAGGAGAGG + Intronic
1023367167 7:39475474-39475496 AGCCCTGGGCAGCCATGACTGGG + Intronic
1024606457 7:51026345-51026367 AGCCTGGGGCAGCCATGGCAAGG - Intronic
1025850510 7:65239801-65239823 GGGGCGGGGCGTCCATGGCAGGG + Intergenic
1026000335 7:66556217-66556239 GAGCCCGGGCGCCCATGGCTGGG + Intergenic
1026734658 7:72942063-72942085 GGGACGGGGCAGATGTGGCTTGG - Exonic
1026784993 7:73296975-73296997 GGGACGGGGCAGATGTGGCTTGG - Intergenic
1027109084 7:75422955-75422977 GGGACGGGGCAGATGTGGCTTGG + Exonic
1028752315 7:94394771-94394793 GGGCCCGGGCAGCCACAGCTGGG - Exonic
1029175159 7:98659344-98659366 GGGCAGGGGCAGCTTTGGCTGGG + Intergenic
1029599206 7:101553897-101553919 GGGAGGGGGCAGCCAGGGCACGG + Intronic
1029737416 7:102472512-102472534 GGGCCGGGGCAGCCAGTCCACGG + Exonic
1030315774 7:108112887-108112909 GGGCCTTGTGAGCCATGGCTAGG - Intronic
1032194424 7:129780946-129780968 GGGCGGGGCCAGCCGGGGCTGGG + Intergenic
1032734746 7:134681531-134681553 AGGCAGGGGCCACCATGGCTGGG - Intergenic
1033170097 7:139076489-139076511 GGGGCAGGGCAGGCATGGATGGG - Intronic
1033473275 7:141667748-141667770 GGTCCAGGACAGCCCTGGCTTGG - Intronic
1033543242 7:142376310-142376332 AGGCTGGGGCAGCAAGGGCTGGG + Intergenic
1033550756 7:142445446-142445468 GGGCTGGGGCATCCAGGGCTTGG + Intergenic
1033710608 7:143939145-143939167 GGTCTGGGGCCTCCATGGCTGGG + Intergenic
1034254263 7:149715693-149715715 AGTCCGAGGCAGCCATGGATGGG + Intronic
1035468667 7:159096174-159096196 GGGCTTGGGCAGCCTTGGGTGGG - Intronic
1037819035 8:22126980-22127002 GGGAGGGGGCAGCCGGGGCTGGG - Intronic
1037825486 8:22158248-22158270 GGGCAGGGGCATCCCTGGCTGGG - Intronic
1041244900 8:55880310-55880332 GGCCCGGGGGAGCCAGGGCGCGG + Intronic
1044819261 8:96144944-96144966 GGGCGAGGGCAGCCAAGGCCTGG + Exonic
1047182830 8:122605648-122605670 GGGCTGGCCCAGCTATGGCTTGG + Intergenic
1047189021 8:122661288-122661310 GGGCAGCTGGAGCCATGGCTCGG - Intergenic
1048971094 8:139645359-139645381 GGGCATGGGCAGGCATGGGTGGG - Intronic
1049066587 8:140321213-140321235 GGGCTAGGAGAGCCATGGCTGGG + Intronic
1049164763 8:141119039-141119061 GGGCAAGGGCAGACATGGCGAGG - Intronic
1049387371 8:142350045-142350067 GGACCAGGGCAGGCAGGGCTGGG + Intronic
1049471588 8:142777305-142777327 GGGCCGGGGCAGGCCTGGGGCGG - Intronic
1049507913 8:143013718-143013740 GGGACGGGGCAGGCTGGGCTGGG - Intergenic
1049583569 8:143423165-143423187 GGGCAGGGCCAGCCAGGGCCCGG - Intronic
1049613102 8:143564935-143564957 GGGCCGGGACAGTCTTGGCCTGG - Intergenic
1049615153 8:143572706-143572728 AGGCAAGGGCCGCCATGGCTGGG - Exonic
1049665450 8:143840819-143840841 GCTCCGGGGCCGCCATGGTTCGG + Exonic
1049686606 8:143941668-143941690 GGGGCGGGGCAGGCTGGGCTGGG - Intronic
1049690685 8:143957646-143957668 TGGCCAGGGCAGCCAGGGCCTGG - Intronic
1049693715 8:143973620-143973642 GGGCCGGGGCCGCCGCGGCCGGG + Intronic
1049749836 8:144277820-144277842 GGGCAGGGGCGGCCACTGCTGGG + Intronic
1049805775 8:144538150-144538172 AGGCTGGGGCAGCCATGGCCTGG + Intronic
1049885503 9:23634-23656 GGGACAGGGCAGGGATGGCTTGG + Intergenic
1053128187 9:35599570-35599592 GGTCCTGGGCAGCCATGGGTGGG - Intergenic
1053319048 9:37079474-37079496 GGGCCTGGGCAGCCCTGGAGCGG - Intergenic
1053443730 9:38136001-38136023 GTGACAGGGAAGCCATGGCTGGG - Intergenic
1056796578 9:89662821-89662843 AGGCCAGGGCAGCCATGGGCAGG - Intergenic
1057452292 9:95175587-95175609 GAGAGGGAGCAGCCATGGCTGGG + Intronic
1057623278 9:96655266-96655288 GGGCCGGCGCGGCCATGACGCGG + Exonic
1058746073 9:107991795-107991817 GGGCCGTGGCAGGCTTGGCCAGG + Intergenic
1059416105 9:114163517-114163539 GGGCCGGGGCAGCGATGGGCTGG + Intronic
1060114378 9:120928921-120928943 GGGCCGGGGCGCCCGCGGCTGGG + Intronic
1060198536 9:121638640-121638662 GGGCCAGGGCAGCTAGGGCAGGG + Intronic
1060796467 9:126515566-126515588 GGGGCGGCACAGCCCTGGCTGGG - Intergenic
1060799093 9:126532339-126532361 GGGTGCGGGCAGCCATGTCTGGG + Intergenic
1060945673 9:127568473-127568495 GGGCGGGGACAGCCAAGGGTGGG + Intronic
1060982790 9:127803236-127803258 GGGCCCGGGCCGCCGGGGCTGGG + Intronic
1061095077 9:128451958-128451980 GGGTCGGGGGAGCCCAGGCTGGG - Intergenic
1061284254 9:129613299-129613321 GGGCCCTGCCAGCCATGGGTGGG - Intronic
1061301745 9:129709554-129709576 AGGCCGGGGAAGCCATGGGATGG + Intronic
1061726091 9:132582726-132582748 GGGCAGGGGCAGCGGCGGCTGGG + Exonic
1061766041 9:132882093-132882115 GGGCCAGGGCAGGCAGGGCAGGG - Intronic
1061933800 9:133846550-133846572 GGGCCAGGGCAGCCAGGGACAGG - Intronic
1062099596 9:134721275-134721297 GAGCCTGGGCAGCCCTGGATGGG - Intronic
1062101498 9:134730892-134730914 GAGCTGGGGCCGCCCTGGCTGGG + Intronic
1062165339 9:135104784-135104806 GGGAGGGAGGAGCCATGGCTGGG - Intronic
1062389304 9:136327689-136327711 GGGCCGGGCCCGCCATGGGTCGG - Exonic
1062442999 9:136579409-136579431 GGCCCAGGGCAGCCCTGGCAGGG + Intergenic
1062461976 9:136665985-136666007 GGGCCGGGGCGCCCGCGGCTGGG + Intronic
1062513480 9:136920771-136920793 GGGCAGAGTCAGCCATGGATGGG + Intronic
1062568038 9:137171889-137171911 GGGGAAGGGGAGCCATGGCTGGG + Exonic
1062596951 9:137303799-137303821 GGCCCGGGGCAGGGATGGCATGG + Intergenic
1062618623 9:137409228-137409250 GGCTCGGGGCAGCCATGGTGAGG - Intronic
1062681157 9:137781976-137781998 GGCCTGGGGCGGCCATGGCCAGG + Intronic
1185778841 X:2828948-2828970 GGGCCGAGGCAGCCAGAGCGCGG + Exonic
1190267178 X:48834143-48834165 GGACAGGGGCTGCCATGGCGAGG + Intronic
1190360547 X:49644884-49644906 GTCCATGGGCAGCCATGGCTGGG + Intergenic
1192166379 X:68829783-68829805 CGGCCTGGGCAGCGTTGGCTCGG + Exonic
1192173044 X:68868481-68868503 GGGCCCTGGGAGCCATGGCGAGG + Intergenic
1196158288 X:112454851-112454873 TGGCCAGGGCAGGCATGACTTGG - Exonic
1198370596 X:135985489-135985511 AGGCGGGGGGAGACATGGCTCGG + Exonic
1200104573 X:153705286-153705308 GGCCCTGGAGAGCCATGGCTTGG - Intronic
1200163260 X:154019804-154019826 CGGCGGCGGCAGCCATGGCCGGG - Exonic
1200237149 X:154473159-154473181 GGGTGGGGTCAGCCATGGCAAGG - Exonic