ID: 1144107229

View in Genome Browser
Species Human (GRCh38)
Location 17:11997246-11997268
Sequence GGGGCCGGGGCAGCCATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 680
Summary {0: 1, 1: 0, 2: 3, 3: 68, 4: 608}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144107229_1144107243 16 Left 1144107229 17:11997246-11997268 CCAGCCATGGCTGCCCCGGCCCC 0: 1
1: 0
2: 3
3: 68
4: 608
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107229_1144107241 15 Left 1144107229 17:11997246-11997268 CCAGCCATGGCTGCCCCGGCCCC 0: 1
1: 0
2: 3
3: 68
4: 608
Right 1144107241 17:11997284-11997306 CCCGCGCGCTCCCAGACGCATGG 0: 1
1: 0
2: 1
3: 9
4: 72
1144107229_1144107245 22 Left 1144107229 17:11997246-11997268 CCAGCCATGGCTGCCCCGGCCCC 0: 1
1: 0
2: 3
3: 68
4: 608
Right 1144107245 17:11997291-11997313 GCTCCCAGACGCATGGGCAAGGG 0: 1
1: 0
2: 0
3: 7
4: 101
1144107229_1144107244 21 Left 1144107229 17:11997246-11997268 CCAGCCATGGCTGCCCCGGCCCC 0: 1
1: 0
2: 3
3: 68
4: 608
Right 1144107244 17:11997290-11997312 CGCTCCCAGACGCATGGGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144107229 Original CRISPR GGGGCCGGGGCAGCCATGGC TGG (reversed) Intronic
900098583 1:951271-951293 GGGGCAGGGGCTGCCAGAGCCGG - Intronic
900121101 1:1049077-1049099 GGGGCCGGGGCAGCTCAGGTGGG + Intronic
900121126 1:1049125-1049147 GGGGCCGGGGCAGCTCAGGTGGG + Intronic
900126686 1:1071876-1071898 GGGGCAGGGGCAGGCAGCGCAGG + Exonic
900129690 1:1082098-1082120 AGCGCCAGGGCAGCCTTGGCAGG + Exonic
900137044 1:1122105-1122127 GGTCCCGGGGAAGCCATGGCGGG - Intergenic
900139789 1:1134866-1134888 GGGGGCTGGGCAGCGATGGCTGG + Intergenic
900160375 1:1220457-1220479 GGGGCCTGGGAAGCGCTGGCAGG - Intronic
900298802 1:1966284-1966306 GTGGCCGGGGCAGGCGTGGGAGG + Intronic
900397042 1:2457318-2457340 GGGGCCTTTCCAGCCATGGCTGG + Intronic
900419092 1:2547888-2547910 GGGGGTTGGGCAGCCATGGTCGG - Intergenic
900531716 1:3157074-3157096 GGCGACTGGGCAGCCACGGCTGG - Intronic
900626647 1:3611577-3611599 GGGGGCGGGCGAGCCAGGGCGGG - Intergenic
900644068 1:3701033-3701055 GGGGCTGTGGCCGACATGGCGGG + Intronic
900777550 1:4596045-4596067 GGGCCCAGGGCTGCCACGGCTGG + Intergenic
900949326 1:5849091-5849113 GGGGCCTGGATAGCCATGCCAGG - Intergenic
901051052 1:6426072-6426094 GGTGTGGGGGCAGCCATGGGAGG + Intronic
901098592 1:6701983-6702005 GGCGCCTAGGCAGCCCTGGCGGG + Intergenic
901533526 1:9868055-9868077 GGGGAGGGGTCAGCCATGTCTGG - Intronic
901739050 1:11330391-11330413 GGGGCAGGGGCGGCCAGGGGTGG + Intergenic
901839445 1:11944789-11944811 GGGGCAGGGGTAGCCGGGGCAGG - Intronic
902220153 1:14959458-14959480 GGGACAAGGGCAGCCCTGGCTGG - Intronic
902513377 1:16977909-16977931 GGTGCAGGGGCACCCAAGGCAGG - Intronic
902823247 1:18956249-18956271 GCGGCGGGGGCTGCCCTGGCGGG - Exonic
903044340 1:20554033-20554055 GGGGCCGGGGCAGCCGAAGCGGG - Exonic
903210340 1:21814666-21814688 GGGGCCGGGGCGCCCCCGGCGGG - Exonic
903554862 1:24186181-24186203 GGGGCTGGAGCATCCCTGGCTGG + Intronic
903777065 1:25800151-25800173 GGGGGCGGGGCGGCCGGGGCGGG - Intergenic
904026114 1:27504725-27504747 GAGGCAGGGGCAGGCCTGGCCGG + Intergenic
904089499 1:27934918-27934940 GGGGCAGGGGCTGCACTGGCAGG + Intergenic
904197160 1:28794463-28794485 GGGCAGGGGGCAGCCATGGTGGG - Intergenic
904480083 1:30788040-30788062 GGGGCAGGGGCCGCCAGGGCTGG - Intergenic
904611444 1:31728150-31728172 AGGGCAGGGGCAGCCACGGGAGG + Intronic
904751132 1:32741949-32741971 GGCGCGCGGGCCGCCATGGCAGG - Exonic
905974439 1:42164654-42164676 GGGGCCTGGGCCGCCTTGGCAGG - Exonic
906106136 1:43293774-43293796 GGGGCCCAGGCAGGCAGGGCTGG - Intergenic
906204500 1:43979642-43979664 GGGGTGGGGGCAGCCAGGCCGGG - Intronic
906290679 1:44617574-44617596 GGGGCAAGGGCAGCCAAGGCTGG - Intronic
906614548 1:47225497-47225519 GCGGCGGGGGCAGCCAGCGCGGG + Exonic
906615762 1:47231972-47231994 GGGGCGGCGGCAGCCGGGGCGGG + Intronic
906949638 1:50323762-50323784 GGGACTGGGGCAGGCAGGGCGGG - Intergenic
907384026 1:54114172-54114194 TGGGCCAGGGCAGCCACTGCAGG - Intergenic
908128213 1:61050720-61050742 GGGGCGGGGGCGGCTCTGGCCGG + Intronic
908501226 1:64745244-64745266 GGGGCCGGGGCTGCGCGGGCAGG + Exonic
908769858 1:67586043-67586065 GAGGCCAGTGCAGCCATGGTGGG - Intergenic
911057669 1:93722117-93722139 GGGGGAGGGGCGGCCATGGCCGG + Intronic
912595417 1:110871107-110871129 GGGGCCGGGGAAGAAATAGCCGG + Intergenic
913144510 1:115976475-115976497 GGGGCCGGGGCGGGCCGGGCCGG - Intergenic
913979581 1:143497458-143497480 GGGGGTGGGGAAGCCACGGCGGG - Intergenic
914073896 1:144322815-144322837 GGGGGCGGGGAAGCCACGGCGGG - Intergenic
914105257 1:144643545-144643567 GGGGGCGGGGAAGCCACGGCGGG + Intergenic
915073154 1:153288792-153288814 GGGGCTGGGCCAGCCCTGGTGGG - Intergenic
915474835 1:156147336-156147358 GGAGCAGGGCCAGGCATGGCAGG - Intergenic
917856901 1:179108499-179108521 AGGACGGGGGCAGCCTTGGCTGG + Exonic
919304111 1:195808133-195808155 GTGCCCGGGGAAGCCAAGGCAGG + Intergenic
920665353 1:207959339-207959361 GGGGCCGAGACAGCCAAGCCCGG - Intergenic
921029955 1:211327823-211327845 GCTGCAGGGGCAGCCCTGGCAGG - Intronic
921367435 1:214386951-214386973 GAGGCCTGGGCAGACACGGCTGG + Intronic
922445807 1:225696233-225696255 GAGGAAGGGGCTGCCATGGCTGG + Intergenic
922801857 1:228368139-228368161 GGGGGAGGGGCAGGCAGGGCTGG - Intronic
1062957319 10:1548899-1548921 GGGGCCGAGGCAGGCCTGGCAGG + Intronic
1063049398 10:2430306-2430328 GGGTCTGGGGTAGCCATGGATGG + Intergenic
1064010324 10:11730268-11730290 GGTGCATGGGCAGCCATGGGTGG - Intergenic
1064354455 10:14604481-14604503 GGGGGCGGGGCTGCCAGGGCGGG - Intronic
1065483802 10:26217681-26217703 GGGACCGGGGCGGCCAAGGTCGG + Intronic
1067054906 10:43044759-43044781 GGGCCCGTGGCACCCAGGGCGGG - Intergenic
1067435218 10:46272319-46272341 TGGGCTGGGGCAGCCAGGACTGG + Intergenic
1069651751 10:70053946-70053968 GGAGCCGGGGGAGGCAGGGCTGG - Intronic
1069756914 10:70779094-70779116 GGGGCTGGGGCTGCCAGTGCAGG - Intronic
1069857800 10:71451291-71451313 TGGGCAGGGCCATCCATGGCTGG - Intronic
1070079136 10:73168282-73168304 GCGGCCGGGGCAGGCACGCCAGG - Exonic
1070112048 10:73495852-73495874 GGGGGCGGTGCAGCCCGGGCCGG + Exonic
1070139902 10:73731607-73731629 GGGGCCCGCGCAGCCAAGGCAGG - Intergenic
1070162240 10:73873737-73873759 GGGGCGGGGGCTGCAGTGGCCGG + Intronic
1070351011 10:75592201-75592223 GGGGCCTGACCAGCCCTGGCAGG + Intronic
1071784113 10:88880215-88880237 GGGGCCGGGGCAGGGGAGGCCGG + Exonic
1072618339 10:97064125-97064147 GGGAGCGGGGCAGCCAAGCCCGG - Intronic
1072676311 10:97468938-97468960 GGGGCCGTGGCAGCCAGGAAGGG - Intronic
1073043625 10:100623558-100623580 GGAGCAAGGCCAGCCATGGCAGG + Intergenic
1073061398 10:100735783-100735805 GGGATGGGGGCGGCCATGGCCGG + Intronic
1073471890 10:103727632-103727654 AGGGCTGGGTGAGCCATGGCTGG - Intronic
1074951541 10:118342090-118342112 GGGGCCGCGGAAGCGACGGCGGG - Intronic
1075280154 10:121132162-121132184 CAGGCCAGGGCTGCCATGGCAGG + Intergenic
1075556402 10:123435580-123435602 GGTGCCTGGGAAGCCACGGCCGG + Intergenic
1075557761 10:123445665-123445687 GGGGCAGAGGCAGCCATGTATGG - Intergenic
1075995611 10:126873926-126873948 GGGGCCGGGGGAGCCAGCTCAGG - Intergenic
1076202937 10:128572776-128572798 GGGGCAGGTGCAGTCATGGAGGG - Intergenic
1076346939 10:129785656-129785678 GAGGCAGGGGCAGCCAGGTCAGG + Intergenic
1076434086 10:130427635-130427657 GGGGATGGGGGAGCCAGGGCTGG + Intergenic
1076670488 10:132118231-132118253 GAGACCTGGGCACCCATGGCAGG + Intronic
1076690876 10:132223395-132223417 GAGCCCGGGGCAGCCATGCATGG + Intronic
1076723667 10:132403782-132403804 GGGGCAGGAGCAGCCACTGCTGG - Intronic
1076809328 10:132878512-132878534 GGGTCTGGGGCAGGCGTGGCTGG + Intronic
1076900415 10:133335131-133335153 GGGGCGAGGGCAGCCAGCGCCGG + Intronic
1077012812 11:386324-386346 GGTGCATGGGCAGCCATGGGTGG - Intergenic
1077015201 11:396228-396250 TGGGCCGGGGCAGGCCAGGCTGG + Intronic
1077017876 11:404920-404942 AGGGTCGGGCCAGCCATGGAAGG - Intergenic
1077117836 11:893359-893381 GGGTCGGGGGCAGCCAGTGCAGG - Intronic
1077252485 11:1566749-1566771 AGGGGCGGGGCAGCCCTGGGAGG + Intronic
1077253826 11:1571987-1572009 GGGGCCCGCGCAGCCGGGGCAGG + Intergenic
1077376944 11:2209571-2209593 GGAGCGTGGGCAGCCAGGGCAGG - Intergenic
1078080347 11:8199853-8199875 GGGTGAGGGGCAGGCATGGCCGG - Intergenic
1078800976 11:14643943-14643965 GCGGCCGGCGCAGCCCTGACGGG + Exonic
1078993700 11:16674652-16674674 GAGGCCAGGGCAGCCAAGGCTGG + Intronic
1079006298 11:16793659-16793681 AGGGCCAGGCCAGCCTTGGCTGG - Intronic
1080687130 11:34524919-34524941 GGGGCCGGGACACCCAGGGGTGG - Intergenic
1082821321 11:57546273-57546295 GCAGCCGGGGCAGCCATTGGTGG + Exonic
1083265386 11:61544504-61544526 GGGGCCGGCCCAGGCCTGGCCGG + Intronic
1083419851 11:62546605-62546627 GGGTCCGGGGCACCAAGGGCGGG - Intronic
1083713101 11:64560629-64560651 GGGGCTGGGACAGTCATGCCTGG - Intronic
1083845016 11:65326588-65326610 GAGGCCGGAGTAGCCATGGAAGG + Intergenic
1083879245 11:65540049-65540071 AGGGCCCGGGCACCCAGGGCGGG + Exonic
1083886596 11:65576231-65576253 CGGGCCGGGCCAGCGGTGGCGGG + Exonic
1083886831 11:65577135-65577157 GGGGCCTGGGCAGCTATGGGTGG - Intronic
1084165563 11:67373382-67373404 CGGGCCGGGGGAGGCACGGCTGG - Intronic
1084279391 11:68077407-68077429 GGGGGCTGGACAGACATGGCTGG + Intronic
1084284077 11:68120709-68120731 GGGGCCGGGGGAGCCGGGGCCGG - Intronic
1084652905 11:70499520-70499542 GGGTCCCTGGCAGCCATGGTGGG + Intronic
1085298532 11:75444709-75444731 GGGGGCGGGGGAGGCAGGGCTGG + Intronic
1085863163 11:80257823-80257845 GGGGGAGGGTCAGGCATGGCGGG - Intergenic
1085928456 11:81052136-81052158 GAGGCTGGGGAAGCCTTGGCAGG - Intergenic
1087608460 11:100405606-100405628 GGGGCAGGGCAAGCCATGGGTGG + Intergenic
1088002430 11:104898407-104898429 GGAGCAGGAGAAGCCATGGCTGG - Intergenic
1088075148 11:105839057-105839079 GGGGCCGGTGCATGCATGGATGG - Intronic
1088186369 11:107176225-107176247 CGGGCTGGGGCAGCCATGGCAGG - Intergenic
1088704277 11:112447877-112447899 GGTCCATGGGCAGCCATGGCAGG + Intergenic
1089198668 11:116710477-116710499 GGGGCAGGGGGAGCCAGGGAGGG + Intergenic
1089401251 11:118166008-118166030 TGGGCAGGGGCAGCCAAGGCTGG - Exonic
1090260361 11:125314804-125314826 AGCCCCGGGGCAGCCCTGGCTGG + Intronic
1090615683 11:128512571-128512593 GTGGCTGGGGAAGCCAAGGCAGG + Intronic
1090627547 11:128619593-128619615 GGGGCCGCAGCAGCCTAGGCTGG + Intergenic
1091399780 12:174919-174941 GGGGCGGGGGCAGCGGAGGCTGG - Exonic
1091405037 12:203758-203780 GGGGCCGGGGCGGCGCTGGGTGG + Intronic
1091665483 12:2415764-2415786 GGGGACGAGGCCACCATGGCGGG - Intronic
1092001092 12:5032992-5033014 GGGGCTGGGGCTGGCGTGGCTGG - Intergenic
1096474045 12:51897183-51897205 GGGGTCGGGGTATCCAAGGCGGG - Intergenic
1096678920 12:53242059-53242081 GGGTGGGGGACAGCCATGGCAGG - Intergenic
1097190677 12:57217999-57218021 GGGGCCTGGGCCCCCATTGCGGG - Intronic
1097259686 12:57711117-57711139 GGGGCTGGAGCAGGGATGGCGGG - Intronic
1098155133 12:67589753-67589775 GGGAAAGGTGCAGCCATGGCTGG + Intergenic
1100830960 12:98516157-98516179 GGGGCCGGGGCTACAAAGGCGGG + Intronic
1101444987 12:104731236-104731258 AGGGCGGGGGCAGCCGTGTCTGG - Intronic
1101814861 12:108138267-108138289 GAGGCCGGGGCATCTATGGCAGG - Intronic
1101987378 12:109458166-109458188 GGAGATGGGGCAGTCATGGCTGG + Intronic
1102034817 12:109765151-109765173 GGGCACTGGGCAGCCATGGGAGG - Intronic
1102151019 12:110689176-110689198 GGGGCGGGGGCGGCCCGGGCGGG - Intronic
1102652320 12:114450875-114450897 GGGGCTGGGGCAGCAAGGGGAGG + Intergenic
1102937713 12:116911378-116911400 GGGGCCGGCGCAGGCATGGGCGG - Intronic
1103474747 12:121210150-121210172 GCGGGCGGCGCGGCCATGGCGGG + Exonic
1103834414 12:123807650-123807672 GGAGCCTGGGAAGCCACGGCAGG + Intronic
1103920060 12:124394680-124394702 GGGGCTGGGGGAGGCAAGGCAGG + Intronic
1103930065 12:124445320-124445342 GGGGCCGGGGCAGCCGCAGAGGG - Intronic
1104845745 12:131845940-131845962 GGGGCCGTGGCTGCTAGGGCCGG + Intronic
1104854763 12:131896398-131896420 GGGCCCAGGGCAGGCAGGGCTGG + Intronic
1105011797 12:132761482-132761504 GCGGCCGGGGAAACCAGGGCCGG - Intronic
1105571146 13:21604012-21604034 GTGGCCGGCGCGGCCCTGGCAGG - Exonic
1105975474 13:25468790-25468812 TGTGCCGCGGCAGCCAAGGCCGG - Intronic
1106042636 13:26108412-26108434 GGGGCAGGGGCAGGCAGAGCAGG - Intergenic
1108183553 13:47865907-47865929 GGGGCCGGAGGTGCCATGGTGGG + Intergenic
1108685441 13:52815362-52815384 GGGGCAGGCTCAGGCATGGCGGG + Intergenic
1109260716 13:60142641-60142663 GGAGGAGGGGCAACCATGGCTGG - Intronic
1111199964 13:84922610-84922632 GGGGCCGGGGGGGCCGGGGCGGG - Intergenic
1112272048 13:97976967-97976989 GGCGCCGCGGCAGCAATGGCCGG - Intronic
1112331889 13:98483146-98483168 GGGCACGGGGCAGCCTGGGCAGG + Intronic
1112507863 13:99985597-99985619 GGGGCGGCGGCAGCTCTGGCGGG + Exonic
1113371929 13:109732773-109732795 GGGGCAGGCTCAGGCATGGCGGG + Intergenic
1113441380 13:110331448-110331470 TGGGCCAAGGCAGCCACGGCCGG - Intronic
1113820569 13:113209622-113209644 GGGGCCTCGTCCGCCATGGCTGG - Exonic
1115528141 14:34301880-34301902 GGGGCTGGGGCTGGGATGGCTGG - Intronic
1119761967 14:77158108-77158130 GGGGCCTGTGCAGCCAGGGGAGG + Intronic
1119781475 14:77279065-77279087 GAGGCCTGGGCACCAATGGCAGG + Intronic
1121013549 14:90535231-90535253 GGGGCCTGGGCAGGTGTGGCCGG - Exonic
1121307868 14:92918155-92918177 GGGGCGGGGGCATGCCTGGCAGG - Intergenic
1121635185 14:95449453-95449475 GGAGCCGGAGCAGCCATGCTGGG + Intronic
1122389930 14:101373326-101373348 GAGGCCGGGGCTGCCCAGGCCGG + Intergenic
1122634741 14:103124619-103124641 GGGGCCTGGGCACCCAGGGTGGG + Intronic
1122767720 14:104083312-104083334 GGGGCCAGGGCAGCCTTCACTGG - Intergenic
1122806705 14:104263394-104263416 GGGGCTGGGGCAGGCGGGGCTGG + Intergenic
1122822663 14:104355019-104355041 GGGGCTGGGGCAGGCAGGGCCGG + Intergenic
1123019223 14:105389805-105389827 GGGGCCGGGACACACAGGGCAGG + Intronic
1123050291 14:105538114-105538136 GGGGTCGGGGCACCACTGGCAGG - Intergenic
1124494219 15:30176547-30176569 GGAGCCGGGACAGACATGGGAGG + Intergenic
1124749351 15:32362098-32362120 GGAGCCGGGACAGACATGGGAGG - Intergenic
1125626911 15:41116240-41116262 GGGACACGGGGAGCCATGGCGGG + Exonic
1126089024 15:45035095-45035117 GGGGAAGGGTCAGGCATGGCGGG - Intronic
1128543385 15:68551965-68551987 GGGGCCGGGGGAGACCTGGCAGG + Intergenic
1128622429 15:69161371-69161393 GGGGCCGGGGCCGCCTTGGGGGG + Intronic
1129253713 15:74322303-74322325 GGGGCGGGAGCAGCCAGGGCTGG + Intronic
1129299209 15:74615802-74615824 GGGGGCGGGGCTGCCACGGGCGG + Exonic
1130959503 15:88650341-88650363 GGGGCTGGGGCAGTCACAGCTGG + Intronic
1130960927 15:88658178-88658200 GGGGCCGGGGCAGGAGGGGCAGG + Intergenic
1131030778 15:89184547-89184569 GAGGGCTGGGCAGGCATGGCTGG + Intronic
1131053553 15:89362847-89362869 GGGGCTGGGGCATCCCTGCCCGG + Intergenic
1131475419 15:92734406-92734428 GCGGCCGGGGCAGCCAAGGGCGG - Intronic
1131694066 15:94856390-94856412 GGGTCCGGGGGAGCCAGGCCAGG + Intergenic
1131827052 15:96330511-96330533 GCGCCCGCGGCCGCCATGGCGGG + Intronic
1132349991 15:101133543-101133565 AGGGCCAGGCCAGCCATGGGGGG + Intergenic
1132544740 16:527971-527993 GGGGCCGGGGCCGCGCTGCCCGG + Exonic
1132551698 16:556345-556367 TGGGCAGGGGTGGCCATGGCAGG + Intergenic
1132553509 16:563175-563197 GGAGCCTGGGGAGCCATGGATGG + Intronic
1132582445 16:691204-691226 GGGGTGGAGGCTGCCATGGCTGG - Intronic
1132601359 16:774549-774571 GGGGCAGGGGCTCCCAGGGCGGG - Intronic
1132623366 16:878747-878769 GGGGCAGGGGCGGGCAGGGCAGG + Intronic
1132678675 16:1130929-1130951 GGGGCCGGGGGTGCAGTGGCGGG + Intergenic
1132684235 16:1155624-1155646 GGGGATGGGGCAGCCAGGCCCGG - Intronic
1132778947 16:1612570-1612592 GGGGCCGGGGCTGCCCGGCCCGG + Intronic
1132876958 16:2144242-2144264 GGGGCAGGAGGAGCCAGGGCAGG + Intronic
1132887569 16:2189383-2189405 GGGGGCGGGGCAGCGGGGGCGGG - Intronic
1134172100 16:11976839-11976861 GGAGCCGGGGCGGCCGGGGCAGG - Intronic
1135407200 16:22206792-22206814 GGGGCCGGAGAAGGCATGGAAGG + Intronic
1136718033 16:32300973-32300995 ATGGCAGGGCCAGCCATGGCAGG + Intergenic
1136836409 16:33507243-33507265 ATGGCAGGGCCAGCCATGGCAGG + Intergenic
1137426561 16:48385352-48385374 GGAGCCGGGGCGGCCGTTGCGGG - Intronic
1138576028 16:57907874-57907896 GAGGCCAGGGCAGCCCAGGCAGG - Intronic
1138619078 16:58197720-58197742 GCGGCCGGGCCGGGCATGGCGGG + Exonic
1138683910 16:58707976-58707998 AGGGCAGAGGCATCCATGGCTGG - Exonic
1139325770 16:66151599-66151621 GTGGCCCAGGCAGCCAAGGCCGG + Intergenic
1139345449 16:66300252-66300274 GGGCCTGGAGCAGCCATGGAGGG - Intergenic
1139410095 16:66751808-66751830 GCCGCCGGGGCAGCCATGCGCGG + Intergenic
1139451354 16:67029857-67029879 GGGGCCGCGGCGGCCCAGGCCGG + Intronic
1139505806 16:67397576-67397598 GGGGCCCGGGCAGGCTTTGCTGG - Intronic
1139971070 16:70775568-70775590 GGGACAGGGGCAGCTGTGGCAGG + Intronic
1141477329 16:84282678-84282700 GGGGCCAGGCCAGCCAGGTCTGG + Intergenic
1141513511 16:84527584-84527606 GGGGCCGGGGCGGGCAGGGTGGG + Intronic
1141576312 16:84966373-84966395 GGGGCCTGGGAAGCGAGGGCTGG - Intergenic
1141601114 16:85126931-85126953 GGAGCCGGGGCAGGCACTGCGGG - Intergenic
1141618103 16:85221596-85221618 TGGGTAGGGGCAGCCCTGGCTGG - Intergenic
1141807211 16:86349644-86349666 GGGGTTGGGCCAGCCAGGGCAGG - Intergenic
1142271278 16:89090811-89090833 GTGGCCTGGGCAGGCCTGGCAGG - Intronic
1142361675 16:89630577-89630599 GGGGCTGGGGGAGCCGGGGCTGG + Intronic
1142361689 16:89630606-89630628 GGGGCTGGGGGAGCCAGGGCTGG + Intronic
1142361737 16:89630696-89630718 GGGGCTGGGGGAGCCGGGGCTGG + Intronic
1203008395 16_KI270728v1_random:216792-216814 ATGGCAGGGCCAGCCATGGCAGG - Intergenic
1203146591 16_KI270728v1_random:1807544-1807566 ATGGCAGGGCCAGCCATGGCAGG + Intergenic
1142470657 17:161618-161640 GGGGCAGGAGAAGCCAGGGCTGG - Intronic
1142494429 17:298892-298914 GGGGCCGGGGGAGCCAGGCCTGG + Intronic
1142664720 17:1456110-1456132 GGCGCGGAGGCAGCCATGGCGGG - Exonic
1142720016 17:1769844-1769866 GGGGTCTGGGGAGCCCTGGCAGG - Exonic
1142763986 17:2055848-2055870 GGGGCCGGGGGAGCCGCGGAGGG + Intronic
1142766045 17:2064898-2064920 GGGGCTGGGGGAGCCAGGACAGG + Intronic
1142860017 17:2755703-2755725 GCGGCCGGGCGAGGCATGGCGGG + Intergenic
1142980366 17:3668018-3668040 GGGGCAGGGGCTGCCACGGCAGG + Intronic
1143117344 17:4588477-4588499 GGGACCGGGGCAGAAATCGCTGG - Intronic
1143747265 17:9003575-9003597 AGGGCCGGGGCTGGCTTGGCCGG - Intergenic
1143762546 17:9115767-9115789 GGCGCCGGGGCAGCCTTGGATGG + Intronic
1144107229 17:11997246-11997268 GGGGCCGGGGCAGCCATGGCTGG - Intronic
1144556518 17:16287127-16287149 GGTGCCTGCGCAGCCATGGCTGG - Intronic
1144654132 17:17024794-17024816 GGGGCAGGGGGAGCCACGGCAGG + Intergenic
1144727213 17:17507919-17507941 GGGCTCGGGGCAGCCAGGCCAGG - Intronic
1144730071 17:17520973-17520995 GGAGCCGGGGCAGGCCTTGCTGG - Intronic
1144950604 17:18991652-18991674 GGCACAGGGGCAGGCATGGCAGG + Intronic
1145063823 17:19748727-19748749 GGGCCCGGGGCAGCGGTGGCTGG - Intronic
1145765618 17:27456610-27456632 GGGGCCGCGGCGGCCGAGGCTGG - Intergenic
1146062004 17:29612618-29612640 GGGGCTGGGTCAGGCACGGCCGG - Intronic
1146401603 17:32504279-32504301 GGGGGAGGGGCAGCCCAGGCTGG - Intronic
1147139422 17:38453025-38453047 GGGGCTGTGGCATCCATGCCTGG + Intronic
1147139724 17:38454164-38454186 GGGGCCGGGGCAGGCCTTGTCGG + Intronic
1147142321 17:38466599-38466621 CGGGCCCGGGGGGCCATGGCTGG - Exonic
1147188244 17:38724536-38724558 GGGGCCTGGCCAGGCAGGGCAGG + Intronic
1147582042 17:41632381-41632403 GGGGCCAGGGGAGCCAGGGGAGG - Intergenic
1147683974 17:42276196-42276218 GGGGCCGGGGGAGCCAGGCCGGG - Intronic
1148002501 17:44398025-44398047 GGGGCCAGGGCAGCTGAGGCTGG + Exonic
1148048513 17:44758404-44758426 GAGGCCGGGGCATCTTTGGCGGG + Intergenic
1148493440 17:48037713-48037735 GGGGCCGCGGCGGCCCAGGCCGG - Exonic
1148625708 17:49067468-49067490 GTGGCAGGGGCAGACACGGCAGG + Intergenic
1148722558 17:49764080-49764102 GCAGCCGGGAGAGCCATGGCGGG - Exonic
1149564579 17:57631894-57631916 GGAGCGGGGGCAGCCCAGGCCGG - Intronic
1149640702 17:58200573-58200595 GTGGATGGGGGAGCCATGGCAGG - Intronic
1149712480 17:58755983-58756005 GGGGCATGAGCAGCGATGGCCGG + Exonic
1150373355 17:64661286-64661308 GTGGCCCGGGCAGCGGTGGCCGG + Intronic
1150830079 17:68511736-68511758 GGGGCCCGGGCGGCGCTGGCCGG + Intergenic
1151368313 17:73631228-73631250 GGGGCCTGGGCTGCCAAGGAGGG - Intronic
1151449023 17:74186021-74186043 GGGTTCAGGGCAGCCAAGGCAGG + Intergenic
1151456396 17:74228701-74228723 GGGGCGGGGGGAACCAGGGCGGG + Intronic
1151642273 17:75405177-75405199 GGGGCCCGGGAAGCCCAGGCGGG - Exonic
1151966649 17:77434966-77434988 GGGGCCCTGGCAACCGTGGCAGG + Intronic
1152107923 17:78341797-78341819 CGGGCCGGGGCAGCCCTGCCCGG - Intergenic
1152197244 17:78925072-78925094 CGGGCCGCGGCGCCCATGGCGGG + Exonic
1152263157 17:79278142-79278164 TGGCCCGTGGCAGCCATGGGGGG + Intronic
1152330438 17:79669565-79669587 GGGGACGGGGAAGCCATGTAGGG + Intergenic
1152511954 17:80796006-80796028 GGGGCCAGGGCAACGATGCCTGG - Intronic
1152647739 17:81477566-81477588 GGGGCCGGGGTAGCCGAGGAAGG - Intergenic
1152715597 17:81899042-81899064 GGGGCCGGCGCTGCCAGGACAGG + Intronic
1152834456 17:82520145-82520167 CGGGCGGCGGCGGCCATGGCGGG + Exonic
1152870692 17:82751720-82751742 GGGCCGGGGGCCGCCAGGGCGGG - Intergenic
1154303912 18:13217506-13217528 GGTACCGGGGCCGCCGTGGCGGG - Intronic
1154501168 18:14998709-14998731 GGTGCCGGTGCCGCCATGCCAGG + Intergenic
1157235262 18:45959357-45959379 GGGGCCGGGCCAGGCATGGGCGG + Intronic
1158648878 18:59269346-59269368 CGGGCCCGGGCAGCGGTGGCGGG - Exonic
1158893742 18:61894769-61894791 GGGGCCGGGGCCGCGGTGGGTGG + Intergenic
1159889564 18:73940921-73940943 GGGGCCAGGGCTGCCTTGCCTGG + Intergenic
1160454838 18:78992943-78992965 GGGGCGGGGGCAGCGGGGGCAGG - Exonic
1160552684 18:79705101-79705123 GGGGCCGCGGCTGCTCTGGCCGG + Intronic
1160710593 19:549302-549324 GGGGGCGGGGAAGCACTGGCAGG + Intronic
1160720291 19:594230-594252 GGGGGCTGGGCAGACCTGGCGGG + Intronic
1160730829 19:640960-640982 TGGGCCGGTCCATCCATGGCGGG + Intronic
1160763819 19:798254-798276 CGGGCCGGGGCAGCCTTTCCGGG + Intronic
1160870365 19:1275149-1275171 GAGGCCGGGGCAGGAGTGGCGGG + Intergenic
1160878812 19:1310439-1310461 GGGGACCGGGCAGCGAAGGCTGG + Intergenic
1160894166 19:1395013-1395035 GGGCCCGGGGCTGCCCTGGACGG - Intronic
1160939187 19:1612175-1612197 GGTGCTGGGGCAGCCCTGGCCGG + Intronic
1161018017 19:1992974-1992996 GGGGCGGGGCCAGGCCTGGCTGG - Intronic
1161280820 19:3444604-3444626 GGGCCAGCGGCAGCCAGGGCAGG - Intronic
1161285887 19:3468196-3468218 GGGGAGGGGGCTGCCATGGACGG - Intronic
1161342489 19:3750941-3750963 GGGTCCTGGCCAGCCAGGGCAGG + Exonic
1161587696 19:5114420-5114442 GCAGCCGTGGCAGCCCTGGCAGG - Intronic
1161943199 19:7418730-7418752 TGGGCCGGGGCAGAGAGGGCAGG - Intronic
1161958267 19:7508091-7508113 GGGGCGGGGCCAGGCAGGGCAGG - Intronic
1162013483 19:7831328-7831350 GGGGCAGGGGCAGATATGCCTGG - Intronic
1162711311 19:12596970-12596992 GGGGCCGGGGCCGCAATCGCAGG + Intronic
1162793119 19:13073168-13073190 GTGGCCAGGGCAGCCAGGGTGGG - Intronic
1162954714 19:14091371-14091393 GCGGCGGGGGCGGCCCTGGCAGG - Intergenic
1163310245 19:16510008-16510030 GGGGCCGGGGCAGCCGGGACAGG + Intronic
1163423077 19:17226140-17226162 GGGGGCGGGGCTGACCTGGCTGG - Intergenic
1163583873 19:18153749-18153771 AGGGGCGGGGCAGGCAGGGCTGG - Intronic
1163773613 19:19205359-19205381 GGGCCCGGAGCAGTCATGGAAGG + Intergenic
1163810889 19:19430714-19430736 GGGGTTGCGGCACCCATGGCTGG - Intronic
1163822679 19:19505260-19505282 GGGGTCTAGGCAGCTATGGCTGG + Intronic
1163829413 19:19540636-19540658 GGGGCGGGGCCAGGCAGGGCGGG + Intronic
1164157692 19:22606400-22606422 AGGGCTGGGGCAGCAATGGCAGG + Intergenic
1164682734 19:30146318-30146340 GCAGCCAGGGCAGCCAGGGCGGG + Intergenic
1165055587 19:33174361-33174383 GGGGCTGGGAGAGCCAGGGCAGG + Intronic
1165309402 19:35021438-35021460 TGGGACGGGGCAGCCAGGGCTGG + Intronic
1165584736 19:36904345-36904367 GGGACTGGGGCAGTCATGGTAGG + Intronic
1165742250 19:38211249-38211271 GGGGCGGGGGCCGCCAGGCCTGG + Intronic
1166134116 19:40765176-40765198 GGGGAAGGGGCAGGCATGGGGGG - Exonic
1166215325 19:41331011-41331033 GGGGCCGGGCCTGCCGGGGCGGG + Exonic
1166558504 19:43717097-43717119 GAGGCAAGGGCTGCCATGGCAGG + Intronic
1166703786 19:44897084-44897106 GGGCACGAGGGAGCCATGGCAGG + Intronic
1166750644 19:45162615-45162637 CGGGCTGGGGCTGCCAGGGCTGG - Intronic
1166844430 19:45718065-45718087 GGGCACTGGGGAGCCATGGCAGG - Intronic
1166939033 19:46351848-46351870 GGGGCTGGGGCAGCCCAGTCGGG + Intronic
1167052251 19:47086450-47086472 TGGGCAGGGGCAGCCGAGGCAGG - Exonic
1167056277 19:47113059-47113081 GCAGCCGGGGCACCCAGGGCGGG - Intronic
1167108776 19:47447003-47447025 GGGGCCTGGGAAGGCAGGGCAGG - Intronic
1167196727 19:48034169-48034191 GGAGCGGGGGCAGCCACCGCAGG - Intronic
1167569918 19:50280545-50280567 GGGGTCAGGACAGCCAGGGCTGG - Intronic
1167735704 19:51293497-51293519 GGGGACTGGGAAGCCATGGGAGG + Intergenic
1168289743 19:55351839-55351861 GGGGCAGGGGCAGACCTGCCCGG - Intronic
1168401553 19:56088390-56088412 GCGGCCGCGGCAGCCATGGCGGG - Exonic
1168647519 19:58069971-58069993 GAGGCAGGTGCAGCCATGCCTGG - Intronic
925025130 2:601480-601502 GGGGCCGGGGGAGCCCTGTGTGG + Intergenic
925152290 2:1623139-1623161 AGGGCTGGGGCAGCCATTGGAGG - Intergenic
925339397 2:3125793-3125815 GGGTCCTGGGCAGCCATGGAGGG + Intergenic
925364537 2:3302927-3302949 AGGGCCTGGGCAGCCACAGCAGG + Intronic
925421937 2:3719569-3719591 GGGGATGGGGCAGCCATGTCAGG + Intronic
925979278 2:9164091-9164113 GGGGCAGGGGCAGCACTGGAAGG + Intergenic
926090210 2:10044245-10044267 GGGGCCGGGGCAACGACGGGAGG + Intronic
926197528 2:10772828-10772850 GGGGCCAGGGCAGCCTTCCCAGG - Intronic
926740195 2:16104160-16104182 GGGGCAGGGACAGCCCTGCCTGG + Intergenic
927871162 2:26624742-26624764 GGGGGCGGGGCAGGCAGGGATGG + Intronic
927894671 2:26774141-26774163 GGGGCCGGGTCACCCAGGTCTGG + Intronic
927928906 2:27031785-27031807 GGGTCTGGGACAGCCAGGGCCGG - Intergenic
927932083 2:27051831-27051853 GGGGCCGGGGCTGGCGGGGCCGG - Intronic
928907314 2:36381341-36381363 GGGGGCGGGGCTGGCAGGGCAGG + Intronic
929158855 2:38811722-38811744 GGGGCCTGGGGAGCAAAGGCAGG + Intronic
929399999 2:41568344-41568366 GAGTCTGGGGAAGCCATGGCTGG + Intergenic
929452966 2:42048555-42048577 CGGGCCGGGGGAGCCTGGGCCGG - Exonic
930022072 2:47007650-47007672 GGGGCCTCGGCAGCCGAGGCAGG + Intronic
931869174 2:66440805-66440827 GGGGCCGGGCGAGCCAGCGCGGG + Intronic
932152690 2:69387343-69387365 GGGGGCGGGGCAGCGCTGGGAGG - Intergenic
932983461 2:76698267-76698289 GGGGGCGGCTCAGGCATGGCGGG + Intergenic
933770668 2:85741972-85741994 GGGGACGGGCCAGCCAGGGGGGG - Intergenic
934556519 2:95289606-95289628 GGGGCAGGGGGAGGCTTGGCAGG - Exonic
934850572 2:97698016-97698038 GGGGGCGGGGCAGCTTTGGATGG - Intergenic
935137788 2:100322332-100322354 GGGGCCGGGACAGGCACCGCGGG + Exonic
936345211 2:111670484-111670506 GGGGCCTGGGCTGACATTGCAGG + Intergenic
938156949 2:128949830-128949852 GGGGCTGGGGCAGCTCTGTCTGG - Intergenic
938500327 2:131828877-131828899 GGTGCCGGTGCCGCCATGCCAGG + Intergenic
939925858 2:148172716-148172738 GGTCCATGGGCAGCCATGGCGGG - Intronic
943646033 2:190408542-190408564 GGGGCGGGGGAGGCCAGGGCGGG - Intronic
944119696 2:196227667-196227689 GGGGCAGTGGCTGCCATGGGAGG - Intronic
945279811 2:208025568-208025590 GCGGCCCGGGCAGCCAGAGCCGG + Intergenic
946353869 2:219172754-219172776 GGGGTGGAGGCAGGCATGGCAGG + Exonic
946395636 2:219442439-219442461 GGGGCTGGGGCAGGCCGGGCGGG - Intronic
947451943 2:230216742-230216764 GGGGGCTGGGCTGCCATGGAAGG + Intronic
947734645 2:232448286-232448308 GGGGCCTGGGCAGAGCTGGCTGG + Intergenic
947749759 2:232526045-232526067 GGGGACGGGCCAGCCAGGGCAGG - Intronic
947819475 2:233060180-233060202 AGAGCCGCGGCAGCCGTGGCAGG + Exonic
947964779 2:234270253-234270275 AGGGCCGGGCCAGGCAGGGCTGG - Intergenic
948112063 2:235464190-235464212 GGGGCCAGGGCAGGCAGGGAAGG - Intergenic
948255940 2:236567979-236568001 GGGGCCGGGGCTGGCGGGGCAGG + Intronic
948607732 2:239146755-239146777 GGGGTCAGGGCAGCCTTGGGAGG - Intronic
948895589 2:240925461-240925483 GGGGCAGGGGCAGATATCGCAGG + Intronic
949045317 2:241870111-241870133 GGTCCCGGGGAAGACATGGCGGG + Intronic
1171391916 20:24807108-24807130 GGGGCCTGGGCATCGTTGGCTGG - Intergenic
1172272023 20:33660137-33660159 TCGGGCGGGGAAGCCATGGCAGG - Intronic
1173059853 20:39650892-39650914 GGGGCAGAGCCAGCCATGGGAGG - Intergenic
1173059864 20:39650928-39650950 GGGGCAGAGCCAGCCATGGGAGG - Intergenic
1173059886 20:39651033-39651055 GGGGCAGAGCCAGCCATGGGAGG - Intergenic
1173390095 20:42623960-42623982 GGGGCTGGGGCAGGTGTGGCAGG - Intronic
1173821232 20:46021900-46021922 GGGGCGGGGCCTGCCAGGGCCGG + Intronic
1173891303 20:46513302-46513324 GGAGGCGAGGCAGCCAGGGCAGG - Intronic
1174197690 20:48785319-48785341 GGGAGCGGGGCAGCCACTGCTGG - Intronic
1174607003 20:51768383-51768405 GGGGGCGCGGCGGCCAAGGCGGG - Exonic
1175428789 20:58888958-58888980 GGCGCGGGGGCCGCGATGGCGGG - Intronic
1175459746 20:59143521-59143543 AGGGCCAGGCCTGCCATGGCTGG - Intergenic
1175499758 20:59441481-59441503 GGGGGTGGGGCAGCCCTGGTTGG + Intergenic
1175538079 20:59729231-59729253 TGGGCCGGGGGAGTCAGGGCAGG + Intronic
1175922894 20:62458388-62458410 GGCCACGGGGCAGCCAGGGCCGG + Intergenic
1175945408 20:62556336-62556358 GGGGCTCGGGCTGCCATGGGCGG - Intronic
1176013555 20:62914618-62914640 GGGGCCGGGGCAGCGCAGGAAGG + Intronic
1176091832 20:63321692-63321714 GAGGCAGCTGCAGCCATGGCAGG - Intronic
1176104517 20:63379650-63379672 GGGGCCAGGGCAGCAGAGGCTGG - Intergenic
1176114888 20:63427878-63427900 TGGGCCTGGGCAGGCCTGGCAGG + Intronic
1176290770 21:5043535-5043557 TGGGCCTGGGCAGCCTTTGCCGG - Intergenic
1176370910 21:6060903-6060925 GAGGCAGGGGCTGCCATGACAGG + Intergenic
1178076674 21:29019102-29019124 GGAACCGGGGCCGCCATGCCGGG + Intronic
1178488576 21:33033752-33033774 GGGGTCGGGGAAGCGAGGGCCGG - Intergenic
1178552573 21:33553270-33553292 GACTCTGGGGCAGCCATGGCTGG - Exonic
1179752609 21:43477638-43477660 GAGGCAGGGGCTGCCATGACAGG - Intergenic
1179866485 21:44220106-44220128 TGGGCCTGGGCAGCCTTTGCCGG + Intergenic
1179891135 21:44335598-44335620 GGGGCCGGGACAGCGAGAGCTGG - Intronic
1179997596 21:44981148-44981170 GGGGCCTGGGCAGCCATAGGGGG + Intergenic
1180015985 21:45084308-45084330 TGAGCCTCGGCAGCCATGGCAGG - Intronic
1180071268 21:45436871-45436893 GGCTGGGGGGCAGCCATGGCTGG + Intronic
1180150380 21:45944183-45944205 GGTGCAGGGGCAGCCAGAGCTGG + Intergenic
1180875266 22:19172130-19172152 GGGGCTGGGGCAGCCGAGGCTGG - Intergenic
1181000887 22:19987276-19987298 GGGGCCGGGGTGGGCGTGGCGGG + Intronic
1181774809 22:25151675-25151697 GAGGCCGGGGAGGCCAAGGCGGG - Intronic
1181786274 22:25229591-25229613 GGGGCAGGGTGAGCCAGGGCTGG - Intronic
1181818445 22:25457414-25457436 GGGGCAGGGTGAGCCAGGGCTGG - Intergenic
1182109164 22:27710744-27710766 GGGGCCATGGGAGCCATGGAGGG - Intergenic
1182426010 22:30273072-30273094 GGGGCTGGGGCATCCAGGGCTGG + Intergenic
1182586058 22:31344938-31344960 GCGGCTGGTGCAGCCATTGCAGG - Exonic
1183361113 22:37384051-37384073 GGGACCGGGTGAGCCATGGGGGG - Intronic
1183454712 22:37916159-37916181 TGGGCAGGGGCAGCCCTGGTGGG + Intronic
1183476545 22:38038925-38038947 GGGGCCGGGGCAGTCGTAGGGGG + Intronic
1184102607 22:42348715-42348737 GGGGCGGTGGCTGCCCTGGCAGG + Intergenic
1184184703 22:42856966-42856988 GGGGCCGCGGCAGCCTGGCCGGG - Intronic
1184520571 22:44991595-44991617 GGGGCCAGGACATCCATGGAGGG + Intronic
1184688592 22:46107450-46107472 GGGGCCGGGCCAGCCAGGACAGG - Intronic
1184803125 22:46774577-46774599 GGGGCAGGGCCAGGCATTGCTGG + Intronic
1185064198 22:48622543-48622565 GGGGCTGGAGCAGACATGGAGGG + Intronic
1185082723 22:48718662-48718684 GGGGCCGGGGGAAGCCTGGCTGG - Intronic
1185227755 22:49662806-49662828 GGGGCCGGGTCAGCCTCGGGAGG + Intergenic
1185266598 22:49907228-49907250 AGGGCAGGGGCAGCCAGGCCTGG - Intronic
1185310658 22:50152557-50152579 GGGGCCTGGCCAGCCCTGGGCGG - Intronic
1185313579 22:50169728-50169750 GGGGCCGGGGCTGCAGTGGAGGG + Intergenic
1185335455 22:50269266-50269288 GGGGCCGGGGGTCCCAGGGCAGG - Intronic
1185394989 22:50582392-50582414 GGGGCCGCGGCAGGTAGGGCCGG - Intronic
950045113 3:9944499-9944521 GGGGCTGTGGCGGCCATGACTGG + Exonic
950208354 3:11097102-11097124 GGGCCCTGGGGAGCCATGGGAGG - Intergenic
950406888 3:12810342-12810364 GGGGCCTGGGCTGGCATGGTGGG + Intronic
950522354 3:13504787-13504809 GGGGCAGGGCCATCCCTGGCTGG + Exonic
950675674 3:14552949-14552971 GGGGCAGTGGGAGCCATGGATGG - Intergenic
950864301 3:16176506-16176528 GGGGCTGGGGCTGCCCTGGCAGG - Intronic
951711675 3:25590042-25590064 GGGGCCGGGGCAGGGAAGGGAGG + Intronic
953905461 3:46866255-46866277 GGGGCCTGGAGAGCCAGGGCTGG + Intronic
954121792 3:48504078-48504100 GGGACCGGCGCAGTCATGGCTGG + Exonic
954135694 3:48581227-48581249 GGAGTCGGGGGAGTCATGGCGGG - Intronic
954410848 3:50370263-50370285 GGGGCCGGGGCGGTCAGGGTAGG + Intronic
954615042 3:51965193-51965215 GGGGACTGGGCAGCCATGGGTGG - Intronic
954715341 3:52524025-52524047 TGGGTTGGGGCTGCCATGGCGGG + Intronic
956250813 3:67231872-67231894 GGAGCTGTGGCAGCCATGGTTGG - Intergenic
956452270 3:69386288-69386310 GGGGCACGGGAAGCCCTGGCCGG + Intronic
956675122 3:71725541-71725563 GGGGCCGTGGGAGGCACGGCCGG + Intronic
957919649 3:86731594-86731616 GGGGGAGGGTCAGGCATGGCGGG + Intergenic
958810738 3:98858070-98858092 GGGGCAGGCTCAGGCATGGCGGG + Intronic
959109633 3:102106515-102106537 GGGGCTGGGGCAGTGTTGGCGGG - Intronic
960941254 3:122936450-122936472 CGGGCCTGGGCAGACATGGAGGG - Intronic
961182430 3:124887197-124887219 GGGACCGCGGCTGCCCTGGCTGG + Exonic
961392064 3:126558056-126558078 GGGGCAGGGGAAGCCTGGGCCGG + Intronic
961506652 3:127374778-127374800 GGCATAGGGGCAGCCATGGCAGG - Intergenic
961649700 3:128411212-128411234 GGGGACGGGGGAGCCAGGGAAGG - Intergenic
961735153 3:128996841-128996863 GGGGCGGGGGAACCCATGGAGGG - Intronic
961929370 3:130517095-130517117 GGGCCCGGGGCCGCCGGGGCGGG + Intergenic
962310786 3:134325543-134325565 GCAGCTGGGGCAGCCATGGAGGG + Intergenic
962744449 3:138387257-138387279 TGCGCCTGGGCAGCCATGGGTGG - Intronic
963858397 3:150280501-150280523 GGGGCAGGGGAGGCCATGGGTGG - Intergenic
963947237 3:151159989-151160011 AGGGCCGGGGGGGCCAGGGCTGG - Exonic
964974202 3:162599959-162599981 GGGGGAGGAGCAGGCATGGCGGG - Intergenic
965590363 3:170356812-170356834 GAGGCCGGGGCCGCCGGGGCGGG + Intergenic
966266269 3:178048261-178048283 GTGGCCGGGGCAGCAAGGGTGGG - Intergenic
968085776 3:195873283-195873305 GGGGCAGGGGCAGGCAGGCCAGG + Intronic
968178179 3:196569003-196569025 GGGGCTGGGGCAGCCTCGGGCGG + Exonic
968481853 4:836790-836812 GGGGCCGGAGCAGCCCCCGCCGG - Intergenic
968612479 4:1563557-1563579 GGGGCCTGGGCAGCAACGGGTGG - Intergenic
968615711 4:1576951-1576973 GGGGCGGGGGCACCCTTGGAAGG - Intergenic
968640618 4:1712638-1712660 CGGGCGGGGGCAGCTTTGGCGGG + Intergenic
968646836 4:1745348-1745370 GTGGCCGGGGCAGACTGGGCAGG - Intergenic
968701891 4:2061328-2061350 GGGGCTGGGGGAGGCACGGCCGG + Intronic
968725913 4:2247730-2247752 CGGGCCGGGGCAGACAGAGCAGG + Exonic
968830672 4:2931695-2931717 GGGGCAGGGCCACCCAGGGCAGG + Intronic
968914843 4:3492902-3492924 GCCGCCGGGGAAGCCATGGTGGG + Exonic
968985101 4:3870748-3870770 GGGGGCGAGGCAGAGATGGCGGG + Intergenic
969054536 4:4393401-4393423 GGGCCCTTGGCAGCCTTGGCTGG + Intronic
970508560 4:16757369-16757391 GAGGCCTGGGCAACAATGGCTGG + Intronic
970823868 4:20251751-20251773 GAGGCCGGGGCTGCCAGCGCTGG - Intergenic
971424827 4:26505201-26505223 GGGGCCGGGGCAGCGGGGGGCGG + Intergenic
972543155 4:40056735-40056757 GGCGACGTGGCAGCCATTGCCGG + Intergenic
973551251 4:52038143-52038165 GGGCCCGCGGGAGCCCTGGCCGG - Intronic
973760455 4:54109948-54109970 GGCGCCAGGGCAGGGATGGCTGG + Intronic
976226453 4:82798521-82798543 GTGGCCGGGCCTGGCATGGCTGG + Exonic
976369687 4:84273210-84273232 GGGGCCAATGCAGCCATTGCTGG - Intergenic
978777087 4:112515381-112515403 GGGGTCAGGGCCGCCAAGGCGGG + Exonic
979829383 4:125281211-125281233 GGGGCCGGGCCAGACATGGCGGG - Intergenic
982069976 4:151686487-151686509 GGGGCAGGGGGAGCCCAGGCTGG - Intronic
983577191 4:169271536-169271558 GCGGCGGGAGCAGCCCTGGCGGG + Intergenic
984708044 4:182862283-182862305 GGGGCCGGGAGAGGAATGGCAGG - Intergenic
984754666 4:183314042-183314064 GGAGCAGGGACAGCTATGGCAGG + Intronic
984885554 4:184446286-184446308 GGGGCAGGTGCAGCCAGGGTAGG + Intronic
985538241 5:476138-476160 GGAGCGGGGGCAGTCAGGGCTGG - Intronic
985588176 5:751470-751492 GGGGCGGGGGCATGCAGGGCAGG + Intronic
985602846 5:843933-843955 GGGGCGGGGGCATGCAGGGCAGG + Intronic
985602872 5:844003-844025 GGGGCGGGGGCATGCAGGGCAGG + Intronic
985698449 5:1356448-1356470 GGGGCCGTGGGAGCCTGGGCGGG + Intergenic
986165940 5:5271473-5271495 GGGGGCGGGGCAGCCGCGGGAGG - Intronic
986184396 5:5422620-5422642 GGGGCGGGGCGAGCCAGGGCGGG + Intronic
986184405 5:5422640-5422662 GGGGCGGGGCGAGCCAGGGCGGG + Intronic
986848787 5:11785946-11785968 GTGCCCGGGGCAGTCATGGAGGG + Intronic
987247266 5:16061247-16061269 GGAGCAGTGGCAGCCATGGAGGG - Intergenic
990954736 5:61331255-61331277 GGGGCTGAGGCAGCGAGGGCGGG + Intergenic
992398160 5:76386644-76386666 GGGGCCAGCCCAGCCATGACTGG - Intergenic
992641235 5:78770193-78770215 GGGGGCGGGGAAGCCAGGGAGGG - Intergenic
993900170 5:93579615-93579637 GGGGCGGGGGCAGCCGATGCTGG - Intergenic
994107256 5:95961478-95961500 GGGGCCGGCGGAGCCGTGGCTGG - Intronic
995483075 5:112612134-112612156 GTGGCCACTGCAGCCATGGCTGG - Intergenic
995833255 5:116376535-116376557 GGGGCTCTAGCAGCCATGGCCGG + Intronic
995835624 5:116396933-116396955 GGGGCCAGGCCAGCGATGGGAGG + Intronic
997208191 5:132062531-132062553 TGGCCAGGGGCAGACATGGCAGG - Exonic
997265117 5:132490822-132490844 GGGGCGGGGCCGGCCAGGGCTGG - Intergenic
997341167 5:133145650-133145672 GGGGCATGGGCAGCTGTGGCAGG + Intergenic
998018955 5:138753723-138753745 GGGGCCCGGGCGGGCACGGCCGG + Intronic
999309137 5:150540268-150540290 GGGGGCTGGGCAGCCTGGGCAGG + Intronic
999749156 5:154613707-154613729 GGGGCCGTGGCAGCCAGGAAGGG + Intergenic
1000296293 5:159916286-159916308 GGGGCAGGGGCCGCGAGGGCGGG - Intergenic
1000378065 5:160602732-160602754 GGGGCACTGGCAGCCATGGATGG - Intronic
1001381648 5:171309911-171309933 GGGCCCCGGGCAGCCGTGGTGGG + Intronic
1001531090 5:172462377-172462399 GGTGCCATGGCGGCCATGGCAGG - Intergenic
1001636473 5:173213693-173213715 GGGGCAGGCTCAGGCATGGCGGG - Intergenic
1001827943 5:174761348-174761370 GGGGCTGGGGGAGGAATGGCAGG - Intergenic
1002099765 5:176851604-176851626 GGGGCGGGGCTGGCCATGGCGGG + Intronic
1002423734 5:179163963-179163985 GGGGCCAGGGGAGCCCTGGGAGG + Intronic
1002450992 5:179318424-179318446 GGGGCGGGGACAGCCAGGGACGG + Intronic
1002456168 5:179346235-179346257 GGGGCCGGGAGTGCAATGGCGGG - Intergenic
1003175621 6:3751013-3751035 GGGGCCGAGGCCGGCAGGGCGGG - Intronic
1004603135 6:17169995-17170017 GGGGCTGAGCCAGCCATGGATGG + Intergenic
1005466829 6:26123873-26123895 GGGGCGGGAGCAGACTTGGCTGG + Exonic
1005561460 6:27045504-27045526 GGGGGAGGGTCAGGCATGGCGGG - Intergenic
1005709512 6:28489965-28489987 GGGCCCAGGGCACCCAGGGCAGG + Intergenic
1005719412 6:28586671-28586693 GGAGCCTGGCCAGCCAAGGCTGG + Exonic
1006133975 6:31884610-31884632 GGGGCAGGGGCATCAAGGGCGGG + Intronic
1006162587 6:32046999-32047021 TGGGCCGGGGCAGCCAGGGTGGG + Intronic
1006180376 6:32150495-32150517 GGGGCCTGGGCAGTCTGGGCTGG + Exonic
1006347968 6:33498307-33498329 GGGTCATGGGCAGCCATGGGTGG - Intergenic
1006832323 6:36976422-36976444 GGGGCCGGGCCTGGCAGGGCTGG - Intronic
1006851627 6:37102762-37102784 GGGGCCGGGGCGGCCGGGCCAGG - Intergenic
1011117141 6:83906034-83906056 GGGGTGAGGCCAGCCATGGCAGG + Intronic
1013372638 6:109483482-109483504 GGGGTCGGGGGAGCCGCGGCGGG + Intergenic
1014049542 6:116936050-116936072 GGGCCCTGGGCAGCAATGGTTGG + Intergenic
1014116751 6:117675477-117675499 GGGGGCGGGGCTGCCAAGGGAGG + Intergenic
1015310550 6:131762398-131762420 GGGGCCGGGGCAGCGGGGGCAGG - Intergenic
1015776765 6:136822629-136822651 GCGGCCGGGGCAGCGAGGGCCGG + Exonic
1017146614 6:151240692-151240714 GGGTCCGAGGCAGCGATGGCGGG - Exonic
1018384120 6:163287470-163287492 GGGGCCTGGGCAGCCTCCGCAGG - Intronic
1018619229 6:165714547-165714569 TGGGCTGGGGCAGCCAGGGGAGG + Intronic
1018694775 6:166382869-166382891 GGTGTCGGCACAGCCATGGCGGG - Exonic
1018863775 6:167732170-167732192 GGGATCGAGGCCGCCATGGCCGG - Intergenic
1018940589 6:168307101-168307123 AGGGCAGGGGAAGCCATGGGAGG + Exonic
1019325027 7:433776-433798 GGGAGCAGGGCAGCCGTGGCCGG - Intergenic
1019346841 7:535274-535296 GGAGCCGGGCCAGGCATGGTGGG - Intergenic
1019494664 7:1332166-1332188 GGGGTGGGGGCAGCCATGCAAGG + Intergenic
1019612996 7:1946268-1946290 GGGGCCGGGGCAGCACTGGAGGG - Intronic
1019648164 7:2141948-2141970 GTCGCCGGGGCAGCCATCACCGG + Intronic
1019684657 7:2374460-2374482 AGTGCCGGGGCAGCCAAGGCTGG - Intronic
1019701560 7:2476899-2476921 GGGACCTGGGAAGCCAGGGCAGG - Intergenic
1019711472 7:2520003-2520025 GGCGCCGGGGCAGCCCCCGCGGG - Exonic
1019712771 7:2525013-2525035 GGGGGCGGGGCCGCCCTGGAAGG + Intronic
1020022808 7:4879117-4879139 CGAGCCGGTGCAGGCATGGCCGG + Intronic
1022776101 7:33529234-33529256 GGGGACTGGGCAGCCATGTTGGG + Intronic
1023083437 7:36546740-36546762 GGGGCTGGGGGAGCAATGGCTGG + Intronic
1023367166 7:39475473-39475495 GAGCCCTGGGCAGCCATGACTGG + Intronic
1025850509 7:65239800-65239822 CGGGGCGGGGCGTCCATGGCAGG + Intergenic
1025991851 7:66503227-66503249 GGGGCTGGTGCATCCATTGCTGG - Intergenic
1026803919 7:73417904-73417926 GGGGCTGGGAGAGCAATGGCAGG + Intergenic
1026833683 7:73624485-73624507 GCGGCGGCGACAGCCATGGCCGG - Exonic
1026968375 7:74454133-74454155 GGGGCCGGGGCGCCGCTGGCAGG + Exonic
1027426015 7:78062206-78062228 AGGGCCTGGGCCCCCATGGCTGG + Intronic
1028752316 7:94394772-94394794 GGGGCCCGGGCAGCCACAGCTGG - Exonic
1029175158 7:98659343-98659365 TGGGCAGGGGCAGCTTTGGCTGG + Intergenic
1029700233 7:102241747-102241769 GGGGCCAGGGCTGCCATTGTGGG - Intronic
1032194423 7:129780945-129780967 GGGGCGGGGCCAGCCGGGGCTGG + Intergenic
1033170098 7:139076490-139076512 GGGGGCAGGGCAGGCATGGATGG - Intronic
1033543241 7:142376309-142376331 GAGGCTGGGGCAGCAAGGGCTGG + Intergenic
1033657076 7:143381566-143381588 GGGCGGGGGGCCGCCATGGCCGG - Exonic
1034129136 7:148699270-148699292 CGGGCCGGGGCGGCCAGGCCTGG + Intronic
1034272493 7:149810036-149810058 TGGGCTGGGTCAGCCATGGAGGG + Intergenic
1034420843 7:150989816-150989838 GGGGCAGAGGATGCCATGGCAGG - Intergenic
1034445421 7:151111561-151111583 GGGGCCGGGGGGGTCATGACGGG - Intronic
1035266739 7:157693483-157693505 AGGGTCGGGGCAGCGAGGGCAGG - Intronic
1035404329 7:158587994-158588016 GGGGCCGGGGAGTCCAGGGCCGG - Intergenic
1035592058 8:823801-823823 GAGCCCGGGGCAGCCAGGACGGG + Intergenic
1035675211 8:1451308-1451330 GGGGAGGAGGCAGCCAAGGCCGG + Intergenic
1036690534 8:10941882-10941904 GGGGCAGAGGCAGCCGTGGAAGG - Intronic
1037825487 8:22158249-22158271 AGGGCAGGGGCATCCCTGGCTGG - Intronic
1037980098 8:23247009-23247031 GGGGCCAGGGCCGCGAGGGCGGG + Intronic
1038540222 8:28385501-28385523 GGGGCGGTGGCCGCCAGGGCGGG + Intronic
1044591519 8:93917513-93917535 GGGGCCGGGCCGGGCAGGGCGGG + Intronic
1048258367 8:132923450-132923472 GGGGCGGAGGCTGCCATGGTGGG + Exonic
1048976089 8:139673929-139673951 AGGGGCGGGGCTGCCGTGGCTGG - Intronic
1049008903 8:139874515-139874537 GGGGCCAGGGAGGCCAAGGCAGG + Intronic
1049066586 8:140321212-140321234 GGGGCTAGGAGAGCCATGGCTGG + Intronic
1049385150 8:142339424-142339446 GAGGCAGGGGAAGCCAGGGCGGG + Intronic
1049387337 8:142349954-142349976 GGGACCAGGGCAGGCAGGGCAGG + Intronic
1049387348 8:142349984-142350006 GGGACCAGGGCAGGCAGGGCGGG + Intronic
1049387359 8:142350014-142350036 GGGACCAGGGCAGGCAGGGCGGG + Intronic
1049387370 8:142350044-142350066 GGGACCAGGGCAGGCAGGGCTGG + Intronic
1049387378 8:142350065-142350087 GGGACCAGGGCAGGCAGGGCAGG + Intronic
1049387398 8:142350122-142350144 GGGACCAGGGCAGGCAGGGCGGG + Intronic
1049387428 8:142350203-142350225 GGGACCAGGGCAGGCAGGGCGGG + Intronic
1049488658 8:142879513-142879535 GGGTCCTGGGCAGCAAGGGCAGG + Intronic
1049520481 8:143086172-143086194 GGGGCCGTGTCACTCATGGCGGG + Intergenic
1049583141 8:143421711-143421733 AGGGCCGGGACAGCCATGGGCGG + Intronic
1049583957 8:143424484-143424506 GAGGCCAAGGCAGCCAGGGCAGG + Intronic
1049655622 8:143795665-143795687 GTGGCTGGGGCAGCCTTGGAGGG + Intronic
1049672681 8:143876870-143876892 GGGGCAGGGCCAGCGAGGGCGGG + Intronic
1049693714 8:143973619-143973641 GGGGCCGGGGCCGCCGCGGCCGG + Intronic
1049787977 8:144460242-144460264 GGCGCTGGGGCTGCCCTGGCTGG - Intronic
1051599452 9:18858278-18858300 GGGGTGGGGGCAGCAATGGTAGG - Intronic
1053019482 9:34685006-34685028 GGGCCAGGGGCAGGCAGGGCAGG - Intergenic
1053122298 9:35556166-35556188 GGGGCAGGCTCTGCCATGGCTGG + Intronic
1053128188 9:35599571-35599593 TGGTCCTGGGCAGCCATGGGTGG - Intergenic
1053436113 9:38075585-38075607 GGGGGAGGCTCAGCCATGGCGGG - Intergenic
1053443731 9:38136002-38136024 GGTGACAGGGAAGCCATGGCTGG - Intergenic
1055611570 9:78030844-78030866 GGGGTCGGGGCTGCCCTGCCCGG - Intronic
1056622412 9:88225277-88225299 GGGGGCGGGGAAGCCATCGAGGG - Intergenic
1057039645 9:91838634-91838656 GGGGCCGAGACAGCCATGCTGGG - Intronic
1057197136 9:93121444-93121466 GGGGACAGGGAAGCCAAGGCCGG + Intergenic
1057551491 9:96054011-96054033 GGGGCCGGGGGAGCCCCAGCAGG - Intergenic
1057883065 9:98807828-98807850 GGGGCCGGGGCTGCCGAGCCGGG + Exonic
1059161787 9:112041636-112041658 GTGGCCAGGGCAGCCATCACTGG + Intronic
1059391859 9:114004324-114004346 GGGGCTGGGGCAGGAAAGGCGGG - Intronic
1060114377 9:120928920-120928942 GGGGCCGGGGCGCCCGCGGCTGG + Intronic
1060198535 9:121638639-121638661 AGGGCCAGGGCAGCTAGGGCAGG + Intronic
1060544123 9:124450489-124450511 GGCGCCAGGCCAGCCATAGCGGG + Intergenic
1060767761 9:126307841-126307863 GGGGCCGGGGCGGGCAGTGCAGG + Intergenic
1060796468 9:126515567-126515589 GGGGGCGGCACAGCCCTGGCTGG - Intergenic
1060799092 9:126532338-126532360 GGGGTGCGGGCAGCCATGTCTGG + Intergenic
1060832031 9:126722959-126722981 GGGGCCTGGGCAGCGCGGGCGGG - Intergenic
1061015608 9:127979588-127979610 GGTGCCGGGGAACCCGTGGCTGG + Intronic
1061055735 9:128222061-128222083 GTGGCCCGGGCAGCAGTGGCAGG + Intronic
1061095078 9:128451959-128451981 GGGGTCGGGGGAGCCCAGGCTGG - Intergenic
1061165977 9:128922374-128922396 GGGGCCGGGAGGGTCATGGCGGG + Intronic
1061221940 9:129257277-129257299 GGGGGAGGGGCAGGCAGGGCAGG - Intergenic
1061282543 9:129605799-129605821 GGGTCCTGGGGAGCCACGGCAGG + Intergenic
1061309988 9:129755818-129755840 GGGGCCGGGACAGCCTGGCCTGG - Intergenic
1061423202 9:130483437-130483459 GGGGCTGGGGAAGCCGCGGCTGG + Intronic
1061472126 9:130835212-130835234 GGGGCGGGGGCGGGCCTGGCGGG + Intronic
1061660648 9:132127985-132128007 GGGGCGGGGGAAGCCGAGGCTGG + Intergenic
1061678991 9:132233382-132233404 GGTGCCAGGGCAGCCGTGGGAGG + Intronic
1061726090 9:132582725-132582747 GGGGCAGGGGCAGCGGCGGCTGG + Exonic
1061766042 9:132882094-132882116 TGGGCCAGGGCAGGCAGGGCAGG - Intronic
1061848300 9:133400405-133400427 GGGGCCACGGCAGACCTGGCAGG - Exonic
1062099597 9:134721276-134721298 GGAGCCTGGGCAGCCCTGGATGG - Intronic
1062101497 9:134730891-134730913 GGAGCTGGGGCCGCCCTGGCTGG + Intronic
1062140549 9:134955504-134955526 GGGCCTGGGGCTGGCATGGCAGG + Intergenic
1062431882 9:136529998-136530020 GGGGCCCTGGGAGCCAGGGCAGG - Intronic
1062442998 9:136579408-136579430 GGGCCCAGGGCAGCCCTGGCAGG + Intergenic
1062472506 9:136712635-136712657 GGGGCCCGCGCAGCCCCGGCCGG + Exonic
1062533923 9:137013393-137013415 GGGGCGGGGACAGCCTTGGTGGG - Intronic
1062558645 9:137129337-137129359 CGGGCCGGGGCAGCCGTGGTCGG - Intergenic
1062710322 9:137971867-137971889 GGGTCCGAGGCACCCAGGGCAGG + Intronic
1187064813 X:15823097-15823119 GGGGCCGGGGCAGCCGGAGCCGG + Exonic
1188475485 X:30587260-30587282 GGGGCCATTTCAGCCATGGCTGG + Intergenic
1189325447 X:40108549-40108571 GGGGCCCGGGAGGCCATGGCGGG - Intronic
1190152123 X:47957460-47957482 GGTGAGGGGACAGCCATGGCAGG - Intronic
1190160539 X:48028689-48028711 GGTGAGGGGACAGCCATGGCAGG + Intronic
1190360546 X:49644883-49644905 GGTCCATGGGCAGCCATGGCTGG + Intergenic
1191057286 X:56254848-56254870 GGGGCAGGGTCAACCATGGGTGG + Intronic
1195687199 X:107597869-107597891 GGGGGTGGGGCAGCAATGGCTGG - Exonic
1196434750 X:115664805-115664827 TGGGCCTGGGCAGCAGTGGCAGG - Intergenic
1196816300 X:119667656-119667678 GGGCCCAGGGCAGCCGTGGGAGG - Intronic
1200048999 X:153418571-153418593 GGGGCGGGGGGAGCCCTGGAAGG - Intronic
1200092547 X:153642653-153642675 GGGGCGGGGGCAGCCAGGCCGGG - Intronic
1200163261 X:154019805-154019827 CCGGCGGCGGCAGCCATGGCCGG - Exonic
1200255448 X:154580111-154580133 GGGGCCCTTGTAGCCATGGCTGG - Intergenic
1200262321 X:154624293-154624315 GGGGCCCTTGTAGCCATGGCTGG + Intergenic
1200563385 Y:4734829-4734851 GGGGCCCTCTCAGCCATGGCTGG + Intergenic
1201077882 Y:10200435-10200457 GGGGAAGGGGCAGGCATGGCAGG - Intergenic