ID: 1144107230

View in Genome Browser
Species Human (GRCh38)
Location 17:11997250-11997272
Sequence GTGCGGGGCCGGGGCAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 524}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144107230_1144107244 17 Left 1144107230 17:11997250-11997272 CCATGGCTGCCCCGGCCCCGCAC 0: 1
1: 0
2: 3
3: 49
4: 524
Right 1144107244 17:11997290-11997312 CGCTCCCAGACGCATGGGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 74
1144107230_1144107241 11 Left 1144107230 17:11997250-11997272 CCATGGCTGCCCCGGCCCCGCAC 0: 1
1: 0
2: 3
3: 49
4: 524
Right 1144107241 17:11997284-11997306 CCCGCGCGCTCCCAGACGCATGG 0: 1
1: 0
2: 1
3: 9
4: 72
1144107230_1144107243 12 Left 1144107230 17:11997250-11997272 CCATGGCTGCCCCGGCCCCGCAC 0: 1
1: 0
2: 3
3: 49
4: 524
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107230_1144107248 28 Left 1144107230 17:11997250-11997272 CCATGGCTGCCCCGGCCCCGCAC 0: 1
1: 0
2: 3
3: 49
4: 524
Right 1144107248 17:11997301-11997323 GCATGGGCAAGGGAGCCCGCTGG 0: 1
1: 0
2: 0
3: 17
4: 221
1144107230_1144107245 18 Left 1144107230 17:11997250-11997272 CCATGGCTGCCCCGGCCCCGCAC 0: 1
1: 0
2: 3
3: 49
4: 524
Right 1144107245 17:11997291-11997313 GCTCCCAGACGCATGGGCAAGGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144107230 Original CRISPR GTGCGGGGCCGGGGCAGCCA TGG (reversed) Intronic
900109003 1:997852-997874 GGGAGGGGGCAGGGCAGCCAGGG + Intergenic
900121099 1:1049073-1049095 GGACGGGGCCGGGGCAGCTCAGG + Intronic
900137046 1:1122109-1122131 GTGGGGTCCCGGGGAAGCCATGG - Intergenic
901602589 1:10433372-10433394 GTGCAGGCCTGGGGCTGCCAGGG + Intronic
901628955 1:10638965-10638987 GCGCGGGGCCGGGGGCGCCCAGG + Exonic
901683436 1:10929634-10929656 GGGTGGGGCCGGGGCAGGCACGG + Intergenic
901730014 1:11272946-11272968 GGGCGGGGCCGGGGCGGGAATGG - Intergenic
901852062 1:12022067-12022089 GAGAGGGGCCGGGTCACCCAGGG - Intronic
902368229 1:15990810-15990832 CTGTGGGGCCGGAGGAGCCAGGG + Intergenic
902501476 1:16914256-16914278 GTGCCGGGCCGCGGCAGTCGCGG - Intronic
902505428 1:16936730-16936752 GAGCCGGGCCGAGGCAGCCCTGG + Exonic
903324838 1:22563746-22563768 GGGCGGGGCAGGGGCGGCCGAGG + Intronic
903923380 1:26817247-26817269 GTGCGGAGCCGGGACAGTCGCGG + Intergenic
904467760 1:30718421-30718443 GGGCGGGGCCAGAGCAGGCAGGG - Intronic
904480084 1:30788044-30788066 GTCTGGGGCAGGGGCCGCCAGGG - Intergenic
904611442 1:31728146-31728168 CTTCAGGGCAGGGGCAGCCACGG + Intronic
904753284 1:32754191-32754213 GGGTGGGGGCGGGGCAGGCAGGG + Intronic
904794780 1:33051117-33051139 GTGCGGAGCCGGGACAGTCGCGG + Intronic
905626283 1:39492154-39492176 GCGCGGGGCCGGGGCCGCCCGGG - Exonic
905670613 1:39788301-39788323 GCGCGGGGCCGGGGCCGCCCAGG + Exonic
906290680 1:44617578-44617600 GGGCGGGGCAAGGGCAGCCAAGG - Intronic
906436884 1:45803843-45803865 GTGCGGAGCCGGGACAGTCGCGG + Exonic
907069261 1:51519211-51519233 GAGCTGGGCCGCCGCAGCCATGG + Exonic
907277668 1:53326278-53326300 GGGCGGGGCCGGGGCAGGGCAGG + Intronic
915302863 1:154961556-154961578 GGGCGGCGCCGAGGCGGCCATGG + Exonic
915638837 1:157205313-157205335 ATGAGGGGCCAGGGCAGCCTGGG - Intergenic
917436157 1:175023475-175023497 GGGCGGGGCCTGGGCCGCCTGGG + Intergenic
917966867 1:180184265-180184287 TTGCGGGGCCGGGGCTGACTGGG + Intronic
918324353 1:183395383-183395405 GTCGGGGGCAGGGGAAGCCAGGG + Intronic
921414491 1:214870641-214870663 GTGCGGAGCCGGGACAGTCGCGG - Intergenic
922705343 1:227787599-227787621 GAGCCGGGCCGGGACAGGCAGGG + Intergenic
922754803 1:228089787-228089809 GTGTGGGGCTGGGGGATCCAGGG - Intronic
923013032 1:230104186-230104208 GTGGGGGGCCGAGGGAGGCAGGG + Intronic
923143613 1:231182568-231182590 GTGGGGCACCGGTGCAGCCATGG + Intronic
923519673 1:234725908-234725930 GTGTGGGGCCCGGGGAGGCAGGG - Intergenic
924384318 1:243487968-243487990 GGGCAGGGCCGGGGGAGCCGTGG + Intronic
924754978 1:246932244-246932266 GCGCGCCGCCGGGGCCGCCAGGG - Intergenic
1062806911 10:429216-429238 GTCCGGGGGGGAGGCAGCCAGGG - Intronic
1062806922 10:429238-429260 GTCCGGGGGGGAGGCAGCCAGGG - Intronic
1062806933 10:429260-429282 GTCCGGGGGGGAGGCAGCCAGGG - Intronic
1062806944 10:429282-429304 GTCCGGGGGGGAGGCAGCCAGGG - Intronic
1062806955 10:429304-429326 GTCCGGGGGGGAGGCAGCCAGGG - Intronic
1062806966 10:429326-429348 GTCCGGGGGTGAGGCAGCCAGGG - Intronic
1062806975 10:429348-429370 GTCCGGGGGGGAGGCAGCCAGGG - Intronic
1062806986 10:429370-429392 GTCCGGGGGGGAGGCAGCCAGGG - Intronic
1062855260 10:776956-776978 CTCCCGGGCCGGGGCTGCCATGG - Intergenic
1062957318 10:1548895-1548917 GTGAGGGGCCGAGGCAGGCCTGG + Intronic
1063458512 10:6201578-6201600 GCGCGGGGCGGGAGCAGCCCCGG + Intronic
1063695656 10:8332673-8332695 GCGCGGGGCCGGGGCTGCAGTGG - Intergenic
1064354457 10:14604485-14604507 AGGCGGGGGCGGGGCTGCCAGGG - Intronic
1065021685 10:21507168-21507190 GGGCGGGGGCGGGGCAGGAAAGG - Intergenic
1065687664 10:28302651-28302673 GGGCGGGGCCGGGGCAGGGGCGG - Intronic
1067103319 10:43349065-43349087 GTGCAGGGCCGGGGCGGGGACGG - Intergenic
1067112349 10:43409218-43409240 GTCCGGGGGCGGGGCCGCGACGG + Intergenic
1067321257 10:45223229-45223251 GAGCTGGGCAGGGGCAGCAAGGG + Intergenic
1067561892 10:47310170-47310192 GGGCTGGGCCGGGGCACCCCCGG - Exonic
1069769522 10:70888476-70888498 CAGCGGGGCCGGGGCAGCCGCGG - Intronic
1069849693 10:71396891-71396913 GAGCGGGGCGGGGGAAGCAAGGG + Intergenic
1069943158 10:71969152-71969174 GGGCAGAGCCGGAGCAGCCAGGG + Intronic
1072793418 10:98335947-98335969 GTGGGGGGGAGGGGCAGTCAAGG + Intergenic
1073067742 10:100773731-100773753 CTGGGGGGCCGGGGCAGCCTGGG - Intronic
1073117080 10:101097308-101097330 AAGCGGGGCTGGGGCAGCCTTGG - Intronic
1073207427 10:101776288-101776310 GGGCGGGGGCGGGGCGGCCGGGG + Intronic
1074592076 10:114822335-114822357 CTGCCGGCCTGGGGCAGCCAGGG - Intronic
1074816011 10:117140903-117140925 GGGCGGGGCGGGGGCAGTCAGGG + Intergenic
1074829966 10:117241267-117241289 GAGCGGGCCCGGGGGAGGCAGGG + Intronic
1075616120 10:123891830-123891852 GGGCTGGGCCGGGGCGGACAGGG + Intronic
1075748570 10:124744534-124744556 GCGCGGGGCCCGGGCAGCCGCGG - Intronic
1076156720 10:128210739-128210761 GGGCGTGGCCGGGACAGGCAGGG - Intergenic
1076452665 10:130567502-130567524 GTGCGGGGCCGGGGAAGTGGAGG + Intergenic
1076776470 10:132700596-132700618 GGGAGGGGCCCGGGGAGCCATGG + Intronic
1077280904 11:1745047-1745069 GCGGTGGGCGGGGGCAGCCAGGG - Intronic
1077367241 11:2166184-2166206 GTGCGGATCCTGGGCGGCCAGGG - Intronic
1077477536 11:2797503-2797525 GTGCAGGGCTGGTACAGCCACGG - Intronic
1077491506 11:2862932-2862954 GCGCGGGCCCGGGGCGGCCCGGG + Intergenic
1078066918 11:8084738-8084760 GTGTGGGGCTGGGAAAGCCAAGG - Intronic
1080687132 11:34524923-34524945 GCTCGGGGCCGGGACACCCAGGG - Intergenic
1083153394 11:60808019-60808041 GGCCTGGGCTGGGGCAGCCAGGG + Intergenic
1083457301 11:62787488-62787510 GTGCGGGGCCGTGGCGGCCGCGG + Exonic
1083609814 11:63999455-63999477 GGGAGGGGCCGGGGCGGACAGGG - Intronic
1083744151 11:64725996-64726018 GTGGGGGACCGGGGCACTCATGG + Intergenic
1083763927 11:64833245-64833267 ATGCTGGGCCTGGGCCGCCAGGG - Exonic
1083911408 11:65712296-65712318 GGGCGGGGCGGAGGGAGCCAGGG + Exonic
1084088160 11:66864235-66864257 GAGAGGGGCCCGGGCAGGCAGGG + Intronic
1084149083 11:67279774-67279796 GGGTGGGGCCTGGGCAACCACGG + Intronic
1084165268 11:67372561-67372583 GGGCGGGGCCGGGGGCGCCGAGG - Intronic
1084177072 11:67428527-67428549 CCGCGGGGCCGGCGCCGCCATGG + Exonic
1084284078 11:68120713-68120735 GTCGGGGGCCGGGGGAGCCGGGG - Intronic
1084610987 11:70203012-70203034 GTGCAGGGCCGGGGCGGGGAGGG - Intergenic
1084611159 11:70203755-70203777 GGGCCGGGCCGGGGGAGCCAGGG + Intronic
1084758401 11:71252808-71252830 GGGCGGGGCAGAGGCGGCCAGGG - Intergenic
1085044074 11:73343283-73343305 GGGAGGGGGAGGGGCAGCCAGGG + Intronic
1085339753 11:75723461-75723483 CTGCGGGGCCTGGGCAGTAAAGG - Intronic
1088916213 11:114229833-114229855 GTATTGGGCCGGGGCAGGCAGGG + Intronic
1089729626 11:120512009-120512031 GTGCGGGGCCGCGGCCCCCGAGG - Intronic
1090956565 11:131518126-131518148 TTGAGGGGCTGGGGAAGCCAAGG + Intronic
1091857731 12:3752970-3752992 GTGGGCGGCCGGGGCGGCCGGGG - Intronic
1092589934 12:9943458-9943480 GTACGAGGCAGGGGCAGCAACGG + Intergenic
1092778684 12:11965661-11965683 GTGTGGGGCAGAGGCACCCAAGG - Intergenic
1094841350 12:34343920-34343942 ATGCGCGGCGGGGGGAGCCAGGG - Intergenic
1095439303 12:42226976-42226998 GTGCGGAGCCGGGACAGTCGCGG + Intronic
1095440798 12:42237792-42237814 GGGCGGGGCGGGGGCGGCCGCGG - Intronic
1095672369 12:44876245-44876267 GTGCGGGGCCGCCCCAGCCCGGG - Intronic
1095981556 12:47977355-47977377 CAGCGGGGCCAGGGGAGCCAGGG + Exonic
1096677228 12:53232306-53232328 GAGCCGGGCAGGGGCAGGCAGGG - Intronic
1097521296 12:60673393-60673415 GTGGGGGGAAGGGGCAGCGATGG - Intergenic
1098029014 12:66235309-66235331 GCGCGGGCGCGGGGCAGCCTGGG + Intronic
1101909902 12:108853575-108853597 GGGAGGGGCCTGGGCAGCAAGGG + Intronic
1102217021 12:111168942-111168964 GTGGGGGGAGGGGGCAGGCAGGG - Intronic
1102487259 12:113266738-113266760 CTGCGGGGCTGGGGCTGCCCAGG - Intronic
1102652318 12:114450871-114450893 ATGGGGGGCTGGGGCAGCAAGGG + Intergenic
1103609886 12:122116826-122116848 GGGCTGGGCCGGGCCAGCCTGGG + Intronic
1103659240 12:122500562-122500584 GCGTGGGGCCGGGGCAGCGCCGG - Exonic
1103969471 12:124660981-124661003 CTCCAGGGCTGGGGCAGCCAGGG + Intergenic
1104697278 12:130872515-130872537 GCGCGGGAGCGGGGCCGCCATGG + Intronic
1104745444 12:131207581-131207603 GTGTGGGCCTGGGGCTGCCAGGG - Intergenic
1104788896 12:131469528-131469550 GTGTGGGCCTGGGGCTGCCAGGG + Intergenic
1104845744 12:131845936-131845958 GTGAGGGGCCGTGGCTGCTAGGG + Intronic
1104848359 12:131858419-131858441 GTGCGGGCTCAGGGGAGCCACGG + Intergenic
1104929384 12:132329804-132329826 GAGCGGGGGCGGGGCAGGCGCGG + Intergenic
1104953167 12:132451450-132451472 GGGCGGGGCAGGGGCTGGCAGGG + Intergenic
1105203063 13:18195313-18195335 GTGCGAGGCCCGGGCAGCATCGG + Intergenic
1106719936 13:32427335-32427357 GTGGGGGCCCGGGGCGGCCGTGG - Intronic
1107151862 13:37121100-37121122 GAGAGGGGGAGGGGCAGCCATGG - Intergenic
1107718222 13:43221506-43221528 GTCCGGGTTGGGGGCAGCCATGG - Intronic
1107999286 13:45891597-45891619 CTGTGGGGCAGGGGCTGCCAAGG + Intergenic
1109008557 13:56909999-56910021 GGGCGGGGCTGGGCCAGCCCAGG + Intergenic
1109300437 13:60585098-60585120 GTGCCTGGACAGGGCAGCCAAGG - Intergenic
1110119383 13:71864843-71864865 TTGCTGGGCTGGGGAAGCCAAGG + Intronic
1116962642 14:50982227-50982249 GTCCAGGGCCAGGGCAGACAGGG + Intronic
1117176780 14:53153371-53153393 GCGCGGCGCCGGTGCAGCCCGGG - Intergenic
1117629120 14:57671250-57671272 GTGGGGAGCTGGGGCAGCTAAGG + Intronic
1118730184 14:68660559-68660581 GTGCAGAGCCTGGGCAGACACGG + Intronic
1118757219 14:68853844-68853866 GTGCGGGGTGGAGGCAGGCACGG - Intergenic
1119385891 14:74258027-74258049 GCGCGGGGCGGGGGCCGCGAGGG + Intronic
1121473432 14:94174201-94174223 GGGCGGGGCCGAGGCGGGCAAGG + Intronic
1122153446 14:99736946-99736968 GTGCAGGGCAGGACCAGCCAAGG - Intergenic
1122275211 14:100587444-100587466 GCGCGGGGCCGGGGCTGGCGGGG - Intergenic
1122342434 14:101037217-101037239 CTGAGGGCCCGGGGCAGACACGG + Intergenic
1122427453 14:101620219-101620241 GGGCTGAGGCGGGGCAGCCAGGG - Intergenic
1122470848 14:101964948-101964970 GTGCGGGGCCGCGGAGGGCAGGG + Intronic
1122691302 14:103533231-103533253 GTGCGGAGGCGGGGCAGCCCTGG + Intronic
1122716883 14:103701250-103701272 GAGCTGGCCCGGGACAGCCAGGG + Intronic
1122750357 14:103928414-103928436 GAGCGGGGGCGGGGCTTCCAGGG + Intergenic
1122783143 14:104152191-104152213 GTGCGAGGCTGGGGCCTCCATGG - Exonic
1122806704 14:104263390-104263412 GGGCGGGGCTGGGGCAGGCGGGG + Intergenic
1122836444 14:104433146-104433168 CAACGGGGCCGGGGCAACCACGG - Intergenic
1122879006 14:104681716-104681738 GTGCAGAGCCGGGACAGCCTGGG + Intergenic
1122880872 14:104689914-104689936 GCGCGGAGCCGGGGGGGCCAGGG - Intronic
1122941538 14:104983576-104983598 GTGCTGCGTCGGGGAAGCCAAGG - Intergenic
1122947838 14:105021281-105021303 GGGCGGGGGCGGGGCAACCGAGG - Intergenic
1123047769 14:105526968-105526990 TTGCGGGGCCCGGGCAGTGAAGG + Intronic
1125462666 15:39920931-39920953 GTGCGCGCCTGGGGCAGCCGGGG + Intergenic
1125584886 15:40813163-40813185 CTGCAGGGCTGGGGCAGGCAGGG + Intronic
1126110113 15:45170009-45170031 ATGCGGAGCCAGGTCAGCCAGGG + Intronic
1126392943 15:48178427-48178449 GTGCGGGGGGAGGGGAGCCATGG + Exonic
1128058500 15:64718469-64718491 GAGCAGGAGCGGGGCAGCCAGGG + Intergenic
1128313964 15:66648467-66648489 GTGCTGGGTGGGGGCAGCCAGGG - Intronic
1128361107 15:66962280-66962302 GAGCGGGGCCAGGACACCCAAGG + Intergenic
1128582328 15:68818737-68818759 GCGCGGGGCCGGGGTCGCCGCGG - Intronic
1128772644 15:70293832-70293854 GTGTGGGGCAGGGGCAGGCCAGG + Intergenic
1129115073 15:73361004-73361026 ATGTGGGGCCAGGGCTGCCAGGG + Intronic
1129299207 15:74615798-74615820 GCGAGGGGGCGGGGCTGCCACGG + Exonic
1129361829 15:75029249-75029271 GGGCTGGGCTGGGGCAGACAGGG - Intronic
1129428233 15:75480608-75480630 GTGCGGAGCCGGGACAGTCGCGG + Intronic
1129698114 15:77752187-77752209 GAGAGGGGCTGGGGCAGGCAGGG - Intronic
1130655107 15:85786912-85786934 GTGGGGGGCAGGGGCGGGCAGGG + Intronic
1132336207 15:101050195-101050217 GAGGGGAGCCGTGGCAGCCAAGG + Intronic
1132414544 15:101610999-101611021 GGGCAGGGCGGGGGCAGCCTTGG - Intergenic
1132589740 16:721437-721459 GTGCGGGGCGGGGCCAGGCCGGG + Intronic
1132644023 16:990669-990691 GGCGGGGGCCGGGGCAGGCAGGG - Intergenic
1132754125 16:1474539-1474561 GAGGGGCGCCGGGGCAGCCGTGG - Intronic
1132757570 16:1493512-1493534 GTCCGGGGCCGCGGCGGCCGTGG + Exonic
1132862409 16:2078147-2078169 GTGCTGGGGTGGGGCAGCCTGGG + Intronic
1132887571 16:2189387-2189409 GAGCGGGGGCGGGGCAGCGGGGG - Intronic
1133130200 16:3671981-3672003 GTGGGTGGCCGGGACAGCCTCGG + Intronic
1135234357 16:20741719-20741741 CTGCTGGGCAGGGGCCGCCATGG + Exonic
1135548048 16:23378782-23378804 GGGCGGGGCTGGGGAAGACAGGG + Intronic
1136293031 16:29287275-29287297 GTGAGGGGCGGTGGCACCCAGGG - Intergenic
1136375472 16:29862868-29862890 GAGCAGGCCCGGGGCAGCAAGGG - Exonic
1136455481 16:30377717-30377739 GGGCGGGGCCGGAGCAGCAAAGG + Intronic
1137280591 16:46973440-46973462 GCGCGGGGCCTGCGCGGCCAGGG - Intronic
1138113283 16:54340887-54340909 GTGCGGGGGGGGGACAGCTAGGG + Intergenic
1138340508 16:56286062-56286084 GTGTGGGGTGGGGACAGCCAAGG + Intronic
1138553589 16:57759868-57759890 GTGGGGAGCCAGGGCAGCCGTGG - Intronic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1139469446 16:67170478-67170500 CGGCGGGGGCGGGGCGGCCAGGG - Intronic
1139952474 16:70679035-70679057 TGGTGGGGGCGGGGCAGCCAGGG + Intronic
1140484506 16:75283068-75283090 TTGGGGGGCCGGGGAAGCCAAGG - Intergenic
1141089059 16:81117557-81117579 CTGTGGGGCGGGGGCAGTCACGG - Intergenic
1141618410 16:85223070-85223092 GTACGGGGCCGGCGGAGTCAAGG + Intergenic
1141660586 16:85439155-85439177 GTGAGGGGCCAGGGCAGGCAGGG - Intergenic
1142098915 16:88261282-88261304 GTGAGGGGCGGTGGCACCCAGGG - Intergenic
1142136947 16:88455858-88455880 GCGCGGGGCCGGGGCAGCTCGGG + Intronic
1142156234 16:88533930-88533952 GCGGGCGGCCGGGGCAGCGAGGG + Exonic
1142175484 16:88643239-88643261 GGGCGGGGCTGGGGTAGCGATGG - Intergenic
1142195719 16:88738441-88738463 CTGCGGGGCAGGGGCACACAGGG + Intronic
1142275475 16:89116486-89116508 TTGCTGGGCCTGGGGAGCCATGG + Intronic
1142312404 16:89321496-89321518 CTGCGGGGCAGGGGCTGCCCAGG + Intronic
1142335977 16:89490015-89490037 GTCCGGGTTCGGGGCAGCCGGGG - Intronic
1142361674 16:89630573-89630595 GAGCGGGGCTGGGGGAGCCGGGG + Intronic
1142361688 16:89630602-89630624 GAGCGGGGCTGGGGGAGCCAGGG + Intronic
1142623784 17:1180054-1180076 GTGCGGGGGCGGGGCGGGGAGGG + Intronic
1142752528 17:1997709-1997731 GGGTGGGGCAGGGGCAGCTAGGG - Intronic
1143024075 17:3930587-3930609 GTGCGGGGTCGGGGCGGCGGTGG + Intronic
1143431995 17:6894429-6894451 GTGCAGGGCCCGGGGACCCAAGG + Intronic
1143625820 17:8109697-8109719 CTGCGGGGGCGGGGGAGACAGGG + Intronic
1143731375 17:8884815-8884837 GTGAGGAGCCGGGGAAGCCAGGG - Intronic
1143904630 17:10198759-10198781 GACCGGGGCCGGGGCCGCCCTGG + Intergenic
1144107230 17:11997250-11997272 GTGCGGGGCCGGGGCAGCCATGG - Intronic
1144642159 17:16943614-16943636 GCTGGGGGCAGGGGCAGCCATGG - Intronic
1144826373 17:18107829-18107851 GTGCTGGGCAGGGGCTGCCCTGG - Exonic
1146763512 17:35498183-35498205 GTGGGGAGCCGGGGCCGCCTGGG + Intronic
1146956703 17:36940240-36940262 GGGCGGGGATGGGTCAGCCAGGG - Intronic
1147184244 17:38705181-38705203 CTGCCCGGCCGCGGCAGCCATGG - Intergenic
1147265424 17:39231670-39231692 GGGCTGGGGAGGGGCAGCCAAGG - Intergenic
1147360148 17:39925213-39925235 GTGCTGGGCAGGGGAAGGCATGG - Exonic
1147741637 17:42673774-42673796 GCTCGGCGCGGGGGCAGCCAGGG + Exonic
1147830755 17:43297097-43297119 GTACGGGGCCGGGTCTGCCGCGG - Intergenic
1148337636 17:46852015-46852037 GGGCGGGGCCGGGGCGGACGGGG - Intronic
1148578726 17:48728617-48728639 GTGCGGGGGCGGGGAATCTAGGG + Exonic
1149593819 17:57851549-57851571 TTGGGGGGGTGGGGCAGCCAGGG + Intergenic
1150211843 17:63446182-63446204 GTGCGGGGCGGGGGCGGCCCAGG - Exonic
1150211933 17:63446450-63446472 GTGCGGGCCCGGAGCTGGCAGGG - Intergenic
1150897259 17:69226793-69226815 GTTGGGGGCAGGGACAGCCAGGG - Intronic
1151368315 17:73631232-73631254 TTGTGGGGCCTGGGCTGCCAAGG - Intronic
1151456394 17:74228697-74228719 GTGGGGGGCGGGGGGAACCAGGG + Intronic
1151841951 17:76625309-76625331 GACCGGGGCCAGGGCTGCCATGG - Exonic
1151882439 17:76903634-76903656 GAGCAGGGACAGGGCAGCCAGGG - Intronic
1151929618 17:77223904-77223926 GTGTGGGGTCGGGGCAGTCCTGG + Intergenic
1152096877 17:78277799-78277821 GAGCAGGGGCGGGGCAGCCGTGG - Intergenic
1152360362 17:79830501-79830523 GGGCGGGGCTGGGGTAGGCAGGG + Intergenic
1152458379 17:80428773-80428795 GTGCAGGGCCAGGGAAGGCAGGG + Intronic
1152544677 17:80994732-80994754 GTGGGGGGCCCGGGCAGCGTGGG + Intronic
1152544694 17:80994771-80994793 GTGGGGGGCCCGGGCAGCGTGGG + Intronic
1152544711 17:80994810-80994832 GTGGGGGGCCCGGGCAGCGTGGG + Intronic
1152544728 17:80994849-80994871 GTGGGGGGCCCGGGCAGCGTGGG + Intronic
1152544745 17:80994888-80994910 GTGGGGGGCCCGGGCAGCGTGGG + Intronic
1152544762 17:80994927-80994949 GTGGGGGGCCCGGGCAGCGTGGG + Intronic
1152564496 17:81094094-81094116 CCCCGGGGCCAGGGCAGCCAGGG + Intronic
1152567542 17:81106914-81106936 GGGCGGGGCCGGGGCTGGGAGGG + Intronic
1152570466 17:81119276-81119298 GTCCTGGGCCGGGCCAGCCCCGG - Intronic
1152639724 17:81444514-81444536 CTGCGGGTGCGGGGCAGCCAGGG - Exonic
1152809596 17:82375312-82375334 GTGCGGGGCCCGGGCAGCGGGGG + Exonic
1154160908 18:11980780-11980802 GTGCGGTGCCGGCCCAGCCCCGG - Intergenic
1157095008 18:44679653-44679675 GCGCGGGGCGGGCGCGGCCATGG + Intergenic
1160163558 18:76492394-76492416 GTGCGGGTCAGACGCAGCCAGGG + Intronic
1160305394 18:77729547-77729569 GTGCGGGGCAGTGGGAGTCATGG - Intergenic
1160409609 18:78666915-78666937 CTGGGAGGCAGGGGCAGCCAAGG + Intergenic
1160662819 19:308956-308978 GTGCTGGGGCTGGGCAGCCGGGG - Intronic
1160765983 19:808283-808305 GCGCGGGGCCGGGGCTGACGGGG + Intronic
1160846600 19:1168790-1168812 TTGCTGGGGAGGGGCAGCCAGGG - Intronic
1160853873 19:1207227-1207249 GGGCCGGGCCGGGCCAGTCACGG + Intronic
1161013163 19:1969836-1969858 GGCGGGGGCCGGAGCAGCCACGG + Exonic
1161015284 19:1980091-1980113 GTGCAGGGCGGGGGCAGCCCAGG - Intronic
1161245529 19:3249625-3249647 GTGAGGGGCGGGGCCAGCCCCGG - Intronic
1161315602 19:3615897-3615919 GTGCTTGGCTGGGGCTGCCACGG - Intronic
1161354838 19:3813318-3813340 GTGAGGGGCCGGGCCAGGCTAGG - Intronic
1161393216 19:4031969-4031991 GTGAGCGGCTGGGGCAGCCTTGG + Intronic
1161489789 19:4555617-4555639 GTGGGGGGCTGAGGGAGCCAGGG - Intronic
1162069887 19:8147326-8147348 GTGCGGAGGCGGGGCAGCCCAGG - Exonic
1162079452 19:8209570-8209592 GGGCCGGGCTGGGGCCGCCATGG - Intronic
1162344415 19:10111127-10111149 GGCCGGGGCCGGGGCCGCCCAGG + Exonic
1162793121 19:13073172-13073194 GAGGGTGGCCAGGGCAGCCAGGG - Intronic
1162886649 19:13702577-13702599 GTGCGGAGCCGGGACAGTCGCGG + Intergenic
1162934538 19:13975063-13975085 GAGGGGGGCAGGGGCAGGCACGG + Intronic
1162954485 19:14090725-14090747 GCGCGGGGCCGGGGATGCGAGGG + Intronic
1163364792 19:16869830-16869852 GTGCGGGGCTGGGGGCGGCAGGG - Exonic
1163473488 19:17511671-17511693 GCCCGGGGCCGGCGCGGCCATGG - Exonic
1163480840 19:17555505-17555527 GTGCGGGGGCGGGGCGTCCTGGG + Intergenic
1163702017 19:18790814-18790836 GTGCGGGGCAGGGAGTGCCAGGG - Intronic
1163715509 19:18870222-18870244 GCGCGGGTCAGGGGCAGCGAGGG + Exonic
1164191868 19:22925324-22925346 GTGCGGAGCCGGGACAGTCGCGG + Intergenic
1165351397 19:35277782-35277804 GTGCTGGGGCTTGGCAGCCAGGG + Intronic
1165402831 19:35612856-35612878 TTCCGGGGCCCGGGCCGCCACGG - Exonic
1165445761 19:35856220-35856242 GTGCCGGGCCGGGGCAGGCAGGG - Intronic
1165460007 19:35938846-35938868 ATGGGGAGACGGGGCAGCCAGGG - Intronic
1165778711 19:38419985-38420007 GTGGGGGGCCAGGGCCACCAGGG + Exonic
1165922427 19:39307481-39307503 GGGAGGGGGCGGGGCAGCCTCGG - Exonic
1166666479 19:44683494-44683516 GTCCTGGGCCAGGCCAGCCAGGG + Exonic
1167042739 19:47032279-47032301 CTGCGGGGCCGCGGCGGCCTGGG - Exonic
1167321615 19:48800130-48800152 GGCTGGGGCCGGGGCAGCAAGGG - Intronic
1167358191 19:49016663-49016685 GGGCGGGGCATGGGCATCCAGGG - Exonic
1167483445 19:49746603-49746625 CTGGCGGGCCGGGGCAGCCCTGG + Exonic
1167502224 19:49854739-49854761 GTGCCGGGGCGTGGCAGCCAGGG + Intronic
1167571251 19:50290397-50290419 GTGAGGGGCAGGGGCAGCTCTGG + Intronic
1167586126 19:50376902-50376924 GTGCGGGGGCGGGGCATGAAGGG + Intronic
1167972400 19:53196902-53196924 GGGCGGGGCCTGGACAGGCAGGG - Intergenic
1168304746 19:55429387-55429409 GTGCGGGGCTGGGGAGGCCCTGG + Exonic
1168322056 19:55516814-55516836 GTGCGGAGCCAGGGGAGGCAGGG - Intronic
1168401556 19:56088394-56088416 GGCCGCGGCCGCGGCAGCCATGG - Exonic
1168404116 19:56102020-56102042 GGGCGGGGCTGTGGCAGCCTTGG - Intronic
1168414506 19:56159913-56159935 GCGCGGGCCCGGGGCTGCCGGGG - Exonic
1168654691 19:58118467-58118489 GGGCGGGGCCGGGGCCGGCCCGG + Intergenic
925102997 2:1265537-1265559 CTGCGGGGCCAGGAGAGCCAGGG + Intronic
926051703 2:9749343-9749365 GTGGGGGGTAGGGGCAGCAAGGG + Intergenic
926103505 2:10136129-10136151 GTGCGGGGCTGGGGCAAGCCTGG + Intergenic
927026483 2:19073710-19073732 GGGCAGGGCAGGGCCAGCCAGGG + Intergenic
927932084 2:27051835-27051857 GGGCGGGGCCGGGGCTGGCGGGG - Intronic
928303579 2:30147492-30147514 GGGTGGGGGCGGGGCAGCCGCGG - Intronic
929174277 2:38960738-38960760 GAGCGGGGCCGGGCCAGGCTAGG + Intronic
929670773 2:43875294-43875316 GAGCAGGGCCGCGGCGGCCAGGG - Exonic
930189247 2:48440935-48440957 GTACGGGGCGGGGGAGGCCATGG + Exonic
931587290 2:63841745-63841767 GCGCGGGGAGGGGGCAGCTAGGG + Exonic
932104073 2:68927052-68927074 GAGAGGGGACAGGGCAGCCAGGG - Intergenic
932411334 2:71549677-71549699 GTGAGGGGTAGGGGCAGGCATGG + Intronic
932753872 2:74391680-74391702 GTGCGGGGCGGGGACTGGCAGGG - Intronic
934028384 2:88019187-88019209 GTGCAGGGCCAGGCCAGCCAGGG - Intergenic
934188725 2:89766742-89766764 GTGGTGGGCAGGGGCAGCCTGGG - Intergenic
934557640 2:95295925-95295947 GGGTGGGGCGGGGGCAGCTAGGG + Intergenic
935147520 2:100405926-100405948 GGGCGGTGCCGGAGCAGGCAGGG + Intronic
935645342 2:105329696-105329718 CTGCGGGGTCGGGCCAGCCCAGG - Exonic
936599669 2:113883442-113883464 GGGCGGGGTGGGGGCAGACAGGG + Intergenic
937356164 2:121199420-121199442 GTGGGGGGCAGGGGCAGTCTTGG + Intergenic
937869353 2:126776687-126776709 GGGCGGGGCCGGGGCACGAAGGG - Intergenic
938058840 2:128236593-128236615 GGGCGGGGCAGCCGCAGCCAGGG + Intergenic
938256151 2:129861537-129861559 GTGTGGGGCCAGGGCAGCCAGGG - Intergenic
938950011 2:136246572-136246594 GTCCGAGGCAGAGGCAGCCAGGG - Intergenic
940881126 2:158947758-158947780 AGGCGGGGCAGGGGCAGGCATGG + Intergenic
943646035 2:190408546-190408568 GTGCGGGGCGGGGGAGGCCAGGG - Intronic
944743548 2:202634951-202634973 GTGGGGGGCGGGGGCAGCAGAGG + Intergenic
946171635 2:217899174-217899196 GTGTGGAGATGGGGCAGCCAAGG + Intronic
946306810 2:218860783-218860805 GAGAGGGGCCTGGCCAGCCAAGG + Intronic
946395638 2:219442443-219442465 GTGGGGGGCTGGGGCAGGCCGGG - Intronic
947525257 2:230873558-230873580 GTGAGGGGCCGGGCCAGGTAGGG + Intronic
947592558 2:231393953-231393975 GTGTGGAGCCAGGGAAGCCAGGG + Intergenic
948005564 2:234605072-234605094 GTGAGGGGCTGAGGCAGCCCCGG - Intergenic
948255939 2:236567975-236567997 GCGCGGGGCCGGGGCTGGCGGGG + Intronic
948607734 2:239146759-239146781 GTGGGGGGTCAGGGCAGCCTTGG - Intronic
1168769786 20:408003-408025 GGGCGGGGCCGGGGGGGCCGGGG - Intronic
1169074347 20:2752046-2752068 GGGCACGGCCGGGGCAGCCGCGG - Intronic
1169240151 20:3970230-3970252 GGGCGGGGACGGGGCAGGAATGG - Intronic
1169263168 20:4152276-4152298 GTGGGCAGCCTGGGCAGCCAGGG + Intronic
1170193851 20:13670642-13670664 GTGAGGGGGCGGGGGACCCATGG - Intergenic
1170524778 20:17226874-17226896 GGGCGGGCCCGGGGCGGCCCAGG + Intronic
1171432410 20:25091369-25091391 GTGCGGGGCCCTGGCATGCAGGG - Intergenic
1172252542 20:33490045-33490067 GGGCGGGGCGGGGCCAGCCGGGG + Intergenic
1172304201 20:33870148-33870170 GTGAGGAGCCAGGGGAGCCAGGG - Intergenic
1172391096 20:34566131-34566153 GGGCAGGGCAGGGGGAGCCAGGG - Intronic
1174057906 20:47811134-47811156 GTGCATGGCAGGGGGAGCCAGGG - Intergenic
1174160372 20:48546180-48546202 GTGCATGGCAGGGGGAGCCAGGG + Intergenic
1175238545 20:57529195-57529217 GTGTGGTGACGGGCCAGCCATGG + Intergenic
1175402473 20:58708375-58708397 GTGCGGGGCTGAGGCGGCCTGGG + Intronic
1175443826 20:59007326-59007348 GGGCGGGGCAGGAGCAGCGATGG - Intergenic
1175844095 20:62049625-62049647 GTGCGGGGCTGGGGCAGGCAGGG - Intronic
1175892278 20:62321159-62321181 GGGCGGGGCCGGTGGAGGCAGGG + Intronic
1176022138 20:62967281-62967303 GTGTGGGGCCTGGGCTGCCCGGG + Intronic
1176092836 20:63326551-63326573 GTGCAGGGCATGGGGAGCCAGGG + Intronic
1176189893 20:63803551-63803573 GCCCGGGGCCTGGGCAGCCCGGG - Intronic
1176244690 20:64091850-64091872 GTGTGGGGCCGGCGCAGCCCTGG + Intronic
1176714897 21:10342692-10342714 GTGCGAGGCCCGGGCAGCATCGG - Intergenic
1176858397 21:13987740-13987762 GGGCGGGGCCGGGACAGGCCAGG - Intergenic
1178488577 21:33033756-33033778 GTGCGGGGTCGGGGAAGCGAGGG - Intergenic
1179435927 21:41362060-41362082 GAGCGGGGCCGGTGCAGGGAGGG + Intronic
1179908718 21:44437024-44437046 CAGCGGGTCCTGGGCAGCCATGG + Intronic
1180160759 21:45997814-45997836 GTGCGGGGCTGGGGCTTCCCAGG - Intronic
1180197375 21:46205979-46206001 CTGCAGAGCCTGGGCAGCCAGGG - Intronic
1180534953 22:16388293-16388315 GTGGTGGGCAGGGGCAGCCTGGG + Intergenic
1180603451 22:17037246-17037268 GTGCGAGGCCCGGGCAGCATCGG + Intergenic
1180636482 22:17266360-17266382 GTCCGAGGCCGGGGCATCCGTGG - Intergenic
1180866332 22:19122066-19122088 GAGCGGGGCCGGGGTCGCCCCGG - Intronic
1181052660 22:20245145-20245167 GTGCGGGGTCGGGGGAGACAGGG + Intronic
1181167103 22:20989683-20989705 GTGAGGGGCGTGGGGAGCCAGGG + Intronic
1181167115 22:20989720-20989742 GTGAGGGGCACGGGGAGCCAGGG + Intronic
1181670545 22:24423838-24423860 GGGCGGGGCGGGGGCAGCGCGGG + Intronic
1181813618 22:25420829-25420851 GCGGGAGGTCGGGGCAGCCAAGG + Intergenic
1182120331 22:27782246-27782268 GTGTGGGGCCGGGGAAGGGAGGG - Intronic
1183383133 22:37500473-37500495 GTGGGGGGCTGGGGCAGACCGGG - Intronic
1183386753 22:37519418-37519440 GGGCGGAGCCGGGGGCGCCACGG - Exonic
1183403556 22:37618768-37618790 GGCCAGGGGCGGGGCAGCCATGG + Intronic
1183475051 22:38031528-38031550 GTGCAGGACCTGGGCAGGCACGG + Intronic
1183963905 22:41429711-41429733 GGGCAGGGCTGGGGCAGCCCAGG + Intergenic
1184243033 22:43221345-43221367 GTGGGGGACGGGGGCTGCCAGGG + Intronic
1184557461 22:45240970-45240992 GGGCGGGGCCGGGGCGGGGAAGG - Intergenic
1184837336 22:47031734-47031756 GTGAGGGGCCGGGGTCCCCAGGG + Intronic
1185133716 22:49056459-49056481 GTGCTGGGCTGGGGCACCCTTGG + Intergenic
1185133725 22:49056527-49056549 GTGCTGGGCTGGGGCACCCTTGG + Intergenic
1185198841 22:49490075-49490097 GAGTGGGGCCGTGGCAGCCGGGG - Intronic
1185221784 22:49632706-49632728 CTGCCGGGACGCGGCAGCCAAGG + Intronic
1185272694 22:49936094-49936116 GCGCGGGGCCGGGGCGGCGGGGG - Intergenic
1185330005 22:50248247-50248269 GTGCGGGGCCTGGGCAGCACGGG + Exonic
1185369611 22:50454983-50455005 AGTCGGGGCTGGGGCAGCCACGG - Intronic
949536218 3:4998046-4998068 CAGCAGGGCCAGGGCAGCCAAGG - Intergenic
950038280 3:9902804-9902826 GGGCGGGGCCAGGGCAGGCTGGG + Intronic
950253911 3:11488504-11488526 GTGCGGAGCCGGGACAGTCGCGG - Intronic
950406886 3:12810338-12810360 GGGCGGGGCCTGGGCTGGCATGG + Intronic
950442514 3:13018353-13018375 GGGCAGGGCCAGGGCAGCCAAGG + Intronic
950487871 3:13283310-13283332 GTGCGGGGGCGCGGGACCCAGGG - Intergenic
953157360 3:40387129-40387151 GGGCGGGGGCGGGGCGGCCTCGG - Intergenic
953901417 3:46846058-46846080 GGCCGGGGCCGGGGGAGGCATGG - Intergenic
954437488 3:50503723-50503745 GCGCGGGGGCGGGCCAGCCCGGG - Intronic
954612884 3:51955535-51955557 GTGAGGGGCCGGAGGAGCAAGGG + Exonic
960937377 3:122912244-122912266 GTGCGGGGCTGGTGCAGGAACGG + Exonic
961392063 3:126558052-126558074 GTGCGGGGCAGGGGAAGCCTGGG + Intronic
961435307 3:126912658-126912680 GGGCTGGGCCGGGGGAGTCAGGG - Intronic
961450436 3:127000018-127000040 GTGGGGGCCTGGTGCAGCCAAGG + Intronic
961501421 3:127338412-127338434 GTGAGGGGCCAGGGAAGGCAGGG + Intergenic
961827678 3:129607233-129607255 GGCCGGGGGCGGGGCTGCCAGGG - Intergenic
965590361 3:170356808-170356830 GGGCGAGGCCGGGGCCGCCGGGG + Intergenic
966869764 3:184282657-184282679 GAGCAGGGCCAGGGCCGCCATGG + Intronic
967055291 3:185824980-185825002 GTACCGGGCCGGGGGAGCCGCGG - Exonic
968144518 3:196287389-196287411 GCGCGAGGCCGGGGCTGCGACGG - Intronic
968213333 3:196867781-196867803 GGGCGGGGGCGGGGCGGCCCCGG + Intergenic
968509038 4:987351-987373 GGGCGGGCCCGGGAGAGCCAGGG - Intronic
968515003 4:1012094-1012116 GGGCGGGGGCGGGGCAGGCCGGG - Intronic
968701120 4:2058816-2058838 GCTCCGGGCCGGGGCAGCCGCGG + Intergenic
968814185 4:2813173-2813195 GTGGGGAGGCAGGGCAGCCAGGG + Intronic
968879819 4:3293106-3293128 GTGCGGGGCCGGGGCCGGGGCGG + Intronic
969398810 4:6939996-6940018 GTGAGGTGCCGCGGGAGCCAGGG - Intronic
969611072 4:8228088-8228110 TGGCCGGGCCGTGGCAGCCATGG - Exonic
969639430 4:8388150-8388172 GTGAAAGGCGGGGGCAGCCATGG - Intronic
970394693 4:15654819-15654841 GTGGCCGGCCGGGGCACCCAGGG + Intronic
972817209 4:42657220-42657242 GTGAGGGGCGGGGAGAGCCAGGG + Intergenic
973816012 4:54619729-54619751 GTGTGGGAACGGGGCAGCAAGGG - Intergenic
977257499 4:94757678-94757700 GTGCGGGCCGGAGGCAGCCCGGG - Intergenic
978416825 4:108485908-108485930 GTGGGGGTCGGGGGCAGGCAGGG - Intergenic
982616146 4:157637952-157637974 GTGCGGAGCCGGGACAGTCGCGG - Intergenic
983595112 4:169457646-169457668 GTGCGGGGCAGGGGGAGAGAAGG + Intronic
985512624 5:321100-321122 GGGCGGGGCAGGGGCACCCAGGG + Intronic
985727593 5:1524103-1524125 GTGGGGGGCCGGGGCCGCTGGGG + Intergenic
985818585 5:2144888-2144910 GTGCAGGGCTGAGGAAGCCACGG - Intergenic
986184403 5:5422636-5422658 GGGCGGGGCGGGGCGAGCCAGGG + Intronic
986736925 5:10674828-10674850 GTGCAGAGCCGGGGAAGACAGGG - Intergenic
989719244 5:44504799-44504821 GTGTGGGGCAGGGGCATCCCAGG + Intergenic
992373671 5:76170877-76170899 GTGCGGAGCCGGGACAGTCGCGG + Intronic
992491392 5:77247836-77247858 GTGAGGGGATGAGGCAGCCAAGG - Intronic
992641237 5:78770197-78770219 GAGTGGGGGCGGGGAAGCCAGGG - Intergenic
992750477 5:79856608-79856630 GTGTGGGGCAGGGGCAGTGAAGG + Intergenic
994107257 5:95961482-95961504 GTGCGGGGCCGGCGGAGCCGTGG - Intronic
997713984 5:136028839-136028861 GTGGGTGCCCAGGGCAGCCAGGG + Intergenic
1000288228 5:159846363-159846385 GTCTGGGGCAGGGGCAGCCTGGG - Intergenic
1000368404 5:160511811-160511833 GTGGTGGGCAGGGGCATCCAGGG + Intergenic
1000985201 5:167858647-167858669 GTGCGGAGCCGGGACAGTCGCGG + Intronic
1001677032 5:173527749-173527771 ATGCTGGGCAGTGGCAGCCACGG + Intergenic
1001822548 5:174721237-174721259 GGGCGGGGGAGGGGCAGCGAAGG - Intergenic
1001826670 5:174751163-174751185 GGGCGGGGTCGGGGGAGCCCGGG - Intergenic
1001827130 5:174753974-174753996 GTGCTGGGCCGGGGAACTCAGGG + Intergenic
1002329025 5:178428973-178428995 GTGCTGGGCCTGGGCAGCACTGG - Intronic
1002341461 5:178519001-178519023 GTGCGGAGCCGGGACAGTCGCGG - Intronic
1002415656 5:179119644-179119666 GTGGGGGGCTGGGCCAGCCCCGG - Intronic
1002417310 5:179127262-179127284 GTGTGGGGCCGGGGGTGCCCAGG + Intronic
1002450991 5:179318420-179318442 GGGCGGGGCGGGGACAGCCAGGG + Intronic
1002492185 5:179586484-179586506 GTGGGAGGCCTGGGCAGCCGGGG - Intronic
1003374677 6:5564877-5564899 GTGCGGGGACTGTGCAGACAAGG + Intronic
1005561462 6:27045508-27045530 GTGCGGGGGAGGGTCAGGCATGG - Intergenic
1006162585 6:32046995-32047017 CCACTGGGCCGGGGCAGCCAGGG + Intronic
1007077043 6:39074650-39074672 GTCCGTGGCAGGGGCAGCCGTGG - Intronic
1007465584 6:42048930-42048952 CGGCGGGGCCGGGGCAGCACGGG + Intronic
1007674476 6:43581751-43581773 GTGCGGAGCCGGGACAGTCGCGG - Intronic
1008932472 6:56954944-56954966 GCGCGGGGCCCGGGCGGCCGCGG - Intergenic
1009807117 6:68614168-68614190 GTGGGGAGCCTGGTCAGCCAAGG + Intergenic
1010083240 6:71887272-71887294 GTGTGGGGAAGGGGCTGCCAGGG + Intronic
1013978210 6:116100812-116100834 GGGCGGGGCTGCGGCTGCCAGGG - Intergenic
1014122394 6:117740244-117740266 GTGTGGGGATGGGGCACCCATGG - Intergenic
1015024601 6:128519306-128519328 GGGCGGGACCGGGAGAGCCAGGG + Intronic
1015476490 6:133664107-133664129 GTGCGGAGCCGGGACAGTCGCGG + Intergenic
1015776763 6:136822625-136822647 TTCCGCGGCCGGGGCAGCGAGGG + Exonic
1015939277 6:138432132-138432154 CTCCGGGAGCGGGGCAGCCAGGG + Exonic
1017765110 6:157600777-157600799 GTGAGGGGAAGGGGCAGTCATGG - Intronic
1018619227 6:165714543-165714565 GGGCTGGGCTGGGGCAGCCAGGG + Intronic
1019111934 6:169724031-169724053 GGGCGGGGCCGGGGCGGCGGGGG - Exonic
1019430375 7:996349-996371 GTTGGGGGGCGGGGCACCCAAGG + Intergenic
1019435371 7:1019798-1019820 GTGGGGGGCTGGGGCTGCCTGGG + Intronic
1019446534 7:1074230-1074252 GTGCGGGGTCGGGGGAGTGACGG - Intronic
1019513713 7:1430515-1430537 GGGCAGGGCAGGGGCAGCCCCGG + Intronic
1019598228 7:1868353-1868375 GTGCTGGGCGGCAGCAGCCATGG - Intronic
1019612998 7:1946272-1946294 GCACGGGGCCGGGGCAGCACTGG - Intronic
1019623570 7:2004030-2004052 GAGCCGGGTCGGGGCATCCAGGG + Intronic
1019705259 7:2494438-2494460 GGGTGGGGCAGGGGCAGCTAGGG + Intergenic
1019712770 7:2525009-2525031 GGGCGGGGGCGGGGCCGCCCTGG + Intronic
1022100129 7:27164577-27164599 GTCCTGGGCCTGGGCAGCCAAGG + Intronic
1023405235 7:39826736-39826758 GTGAGGGGAGGGGGCAGCCTTGG + Intergenic
1023792481 7:43764161-43764183 GTGCGGGGGCGGGGCGGGCAGGG - Intronic
1023937291 7:44748942-44748964 GCGCGGGCCGGGGGCCGCCACGG + Exonic
1024244699 7:47460401-47460423 GTGCGGGGCAGCTGCAGCAATGG - Intronic
1025943420 7:66089336-66089358 GTGCGAGGCCGGGGGAGGCCTGG + Intronic
1026363491 7:69624920-69624942 GTGGGGGGCGGGGGCACCGAGGG - Intronic
1026902250 7:74043749-74043771 GTGCCCGACAGGGGCAGCCAGGG - Intronic
1027218924 7:76201943-76201965 GTGCGGGGCCGTGGGGGCCGCGG + Exonic
1028605592 7:92651843-92651865 GAGAGGGGCAGGGGCATCCAGGG + Intronic
1029423418 7:100483428-100483450 GTGAGGCGCTGGGGCCGCCAGGG - Intergenic
1031317270 7:120273362-120273384 GGCCGGGGCCGGGGCCGGCACGG - Intergenic
1033288617 7:140062784-140062806 GTGCGCGGCCGGGGGCGCCCTGG - Exonic
1034243133 7:149624694-149624716 GCGCAGGGCAGGGGCAGTCAGGG - Intergenic
1034499411 7:151440183-151440205 GGGCAGGGCAGGGGCAGCCGCGG - Intronic
1034578936 7:152025952-152025974 GCGCGGGGCCTGGGCAGGCTGGG + Intronic
1034991019 7:155548310-155548332 GCGCAGGGCCAGGGCTGCCAGGG + Intergenic
1035153404 7:156893216-156893238 GGGCGGGGGCGGGGCAGGGAGGG + Exonic
1035224441 7:157425615-157425637 CTGCGGGGCCGGGGCTTCCCAGG + Intergenic
1035293418 7:157854287-157854309 GGGTGGGGCAGAGGCAGCCACGG - Intronic
1035311103 7:157969566-157969588 GTGGGGGCCAGGGGTAGCCATGG + Intronic
1035418344 7:158707401-158707423 CGGTGGGGCCGGGACAGCCAAGG - Intergenic
1035608970 8:948005-948027 GCACGGGGTCGGGGGAGCCATGG - Intergenic
1035663263 8:1362963-1362985 TTGAGGGCCTGGGGCAGCCATGG + Intergenic
1036065601 8:5378471-5378493 TTGTGGGCCTGGGGCAGCCATGG - Intergenic
1037961841 8:23103393-23103415 TCGCGGGCTCGGGGCAGCCAGGG - Intronic
1041068058 8:54101576-54101598 GCGGGGGGCGGGGGCAGCCGGGG - Intronic
1041244898 8:55880305-55880327 GACCGGGCCCGGGGGAGCCAGGG + Intronic
1041906448 8:63038626-63038648 GTGCGGGGCCGCAGCAGACGGGG - Intronic
1042651445 8:71046301-71046323 GGGCGGTGCAGGGGTAGCCAAGG + Intergenic
1044591517 8:93917509-93917531 GGGCGGGGCCGGGCCGGGCAGGG + Intronic
1044878870 8:96701724-96701746 TTGCAGGGCCAGGGCTGCCAAGG - Intronic
1045510018 8:102806713-102806735 GTGCGGGGCCGGGCCGGGCTGGG + Intergenic
1047010444 8:120667313-120667335 GGGCAGGGGAGGGGCAGCCAGGG - Intronic
1047498974 8:125428126-125428148 GTGGGAGGCCGGGCCAGACAAGG - Intergenic
1047687074 8:127315697-127315719 GTGCGGAGCCGGGACAGTCGCGG + Intergenic
1048185278 8:132234846-132234868 GGGCTGGGCCAGGGCAGCCGTGG - Intronic
1049008902 8:139874511-139874533 GTGTGGGGCCAGGGAGGCCAAGG + Intronic
1049072273 8:140365349-140365371 GTGAGGGACCAGGGCAGGCAGGG - Intronic
1049240538 8:141535518-141535540 GTGTGGGGTCAGGCCAGCCACGG - Intergenic
1049583139 8:143421707-143421729 CTGGAGGGCCGGGACAGCCATGG + Intronic
1049583570 8:143423170-143423192 TGGCGGGGCAGGGCCAGCCAGGG - Intronic
1049693713 8:143973615-143973637 GGGCGGGGCCGGGGCCGCCGCGG + Intronic
1049720611 8:144113820-144113842 GTGCGGGCTCAGGGAAGCCAAGG - Exonic
1049805072 8:144535018-144535040 GTCTGGGGCCAGGGGAGCCATGG + Intronic
1052862167 9:33443840-33443862 GTGCTCAGCCGGGGCACCCACGG - Exonic
1053072900 9:35111516-35111538 GCGCGGAGCCGGGGCGGCCCCGG - Exonic
1053457024 9:38241368-38241390 GTGCGGAGCCGGGACAGTCGCGG + Intergenic
1053600124 9:39602117-39602139 GTGCAGGGCCAGGCCAGCCAGGG + Intergenic
1053857779 9:42355973-42355995 GTGCAGGGCCAGGCCAGCCAGGG + Intergenic
1054253401 9:62740267-62740289 GTGCAGGGCCAGGCCAGCCAGGG - Intergenic
1054567517 9:66774766-66774788 GTGCAGGGCCAGGCCAGCCAGGG - Intergenic
1056299598 9:85227528-85227550 CTACAGGGCCGGGGCTGCCAAGG - Intergenic
1057229244 9:93308865-93308887 GTGCGGGGCTTGGGCTGCCCAGG - Intronic
1057466388 9:95317780-95317802 GGGCGGGGCGGGCGCGGCCAGGG + Intergenic
1057752417 9:97803503-97803525 GCGCGGGGGCGGGGCAACCGCGG + Intergenic
1057791802 9:98129689-98129711 GTGCGGGGTCTGGGGAGACAGGG - Intronic
1059210816 9:112513528-112513550 GTGCGGAGCCGGGACAGTCGCGG + Intronic
1059234751 9:112751576-112751598 GTGCTGGGACCGGGCAGCCCTGG + Intronic
1060114376 9:120928916-120928938 CTGCGGGGCCGGGGCGCCCGCGG + Intronic
1060268540 9:122126176-122126198 GGGCGCAGCCTGGGCAGCCAAGG + Intergenic
1060479994 9:124012223-124012245 GGGCGGGGCCGGGGCCGCGGTGG + Exonic
1060530208 9:124343433-124343455 GTGTGAGGCCGGGGCTGCTAGGG - Intronic
1060661114 9:125405703-125405725 GGGCAGGGCCAGGGCAGGCAGGG + Intergenic
1061050323 9:128191409-128191431 GTGCGGGGCCGGGGGCGGCTGGG - Intronic
1061057742 9:128233278-128233300 GTGCCGGGCAGGGGCATGCAAGG + Intronic
1061067243 9:128286159-128286181 GAGAGGGGCTGGGGCAGCCTAGG - Intronic
1061089917 9:128420779-128420801 GGGCGGGGCCGAGGCAGACCCGG - Exonic
1061123159 9:128656619-128656641 GCCCGGGGCCGGGGCGGCCAGGG - Exonic
1061196737 9:129110784-129110806 GGGCGGGGACGGGGCATCGATGG + Exonic
1061933802 9:133846555-133846577 GGCCGGGGCCAGGGCAGCCAGGG - Intronic
1062040345 9:134401683-134401705 GTGCAGCGAGGGGGCAGCCATGG - Exonic
1062164843 9:135102475-135102497 GAGTGGGGCCCGGGCGGCCAGGG + Intronic
1062349836 9:136133260-136133282 GTGCGGGGACGGGACAGGCTCGG - Intergenic
1062389306 9:136327694-136327716 GGGCGGGGCCGGGCCCGCCATGG - Exonic
1062460024 9:136659135-136659157 GTCAGGGGCCGGAGCAGGCAGGG + Exonic
1062504630 9:136866599-136866621 GTGCGGGGCCCGGGGAGGCACGG - Intronic
1062549439 9:137079179-137079201 GTGAGGGGCGGGGCCAGCCTCGG - Intronic
1062558647 9:137129341-137129363 TTTCCGGGCCGGGGCAGCCGTGG - Intergenic
1062622842 9:137430353-137430375 GTCCGGGGCGTGGCCAGCCAAGG - Intronic
1062696220 9:137877659-137877681 GGGCGGGGCGGGGGCGGCCGCGG + Intergenic
1203774158 EBV:63440-63462 GTCCGGGACCAGGTCAGCCAGGG - Intergenic
1203792897 EBV:161066-161088 GGGTGGGCCCGGGGCAGCCCAGG - Intergenic
1185750934 X:2609247-2609269 GGGCGGGGCAGGCGCAGCCTGGG + Intergenic
1185911203 X:3982562-3982584 CTGGGGGGAAGGGGCAGCCATGG + Intergenic
1186192178 X:7076655-7076677 GTGCGGGACAGGGGGTGCCACGG + Intronic
1188441040 X:30215603-30215625 GTGCGGCGTCTGGTCAGCCAGGG + Exonic
1189246303 X:39566123-39566145 GTCAGGGGCAGGGGCAGGCAGGG - Intergenic
1189963225 X:46344817-46344839 GTGAGGGTGCGGGGAAGCCAAGG - Intergenic
1191255935 X:58279652-58279674 GTGGGGTGCGGGGGCTGCCAAGG + Intergenic
1195716950 X:107826690-107826712 GTGCGGGGCGGGGGCGGCCGAGG + Intronic
1196825195 X:119735207-119735229 CTGCCGGGCAGGGGCAGGCAAGG + Intergenic
1197707668 X:129646300-129646322 GTGTGGGGACGGGGGAGTCAGGG - Exonic
1197774181 X:130109505-130109527 GTGCGGGGCGGGGGCGGCCCAGG + Intronic
1199718529 X:150525155-150525177 GTGCAGGGCCGGGGCGGGGAAGG - Intergenic
1199736919 X:150693687-150693709 GCGGGAGGCCGGGGCAGCCCGGG - Intronic
1199996343 X:153028961-153028983 GCTCGGGGCCAGGGCAGCCTTGG + Intergenic
1200034841 X:153320488-153320510 GCTCGGGGCCAGGGCAGCCTTGG - Intergenic
1200049000 X:153418575-153418597 GTGGGGGGCGGGGGGAGCCCTGG - Intronic
1200086646 X:153610359-153610381 GTGCGGGGCTGAGGCAGGGAGGG - Intergenic
1200089556 X:153627951-153627973 GGCCGGGGCTGGGGCAGCGAGGG + Intergenic
1200107762 X:153724384-153724406 GGGCGGGGCCGGGGCTGCTGTGG - Intronic
1200111074 X:153741145-153741167 GTGGTGGGCAGGGGCAGCCTGGG + Intronic
1200146415 X:153928485-153928507 GGGCGGGGCCGGGGCCGGAAAGG - Intronic
1200210397 X:154344456-154344478 GGGAGGGGCCGGGGCAGGGAGGG + Intergenic
1200220455 X:154387636-154387658 GGGAGGGGCCGGGGCAGGGAGGG - Intergenic
1200249865 X:154547133-154547155 GGGCGGGGCCGGGCCGGCGATGG - Exonic