ID: 1144107231

View in Genome Browser
Species Human (GRCh38)
Location 17:11997259-11997281
Sequence ACGTGGCGAGTGCGGGGCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144107231_1144107245 9 Left 1144107231 17:11997259-11997281 CCCCGGCCCCGCACTCGCCACGT 0: 1
1: 0
2: 1
3: 10
4: 209
Right 1144107245 17:11997291-11997313 GCTCCCAGACGCATGGGCAAGGG 0: 1
1: 0
2: 0
3: 7
4: 101
1144107231_1144107244 8 Left 1144107231 17:11997259-11997281 CCCCGGCCCCGCACTCGCCACGT 0: 1
1: 0
2: 1
3: 10
4: 209
Right 1144107244 17:11997290-11997312 CGCTCCCAGACGCATGGGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 74
1144107231_1144107243 3 Left 1144107231 17:11997259-11997281 CCCCGGCCCCGCACTCGCCACGT 0: 1
1: 0
2: 1
3: 10
4: 209
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107231_1144107241 2 Left 1144107231 17:11997259-11997281 CCCCGGCCCCGCACTCGCCACGT 0: 1
1: 0
2: 1
3: 10
4: 209
Right 1144107241 17:11997284-11997306 CCCGCGCGCTCCCAGACGCATGG 0: 1
1: 0
2: 1
3: 9
4: 72
1144107231_1144107248 19 Left 1144107231 17:11997259-11997281 CCCCGGCCCCGCACTCGCCACGT 0: 1
1: 0
2: 1
3: 10
4: 209
Right 1144107248 17:11997301-11997323 GCATGGGCAAGGGAGCCCGCTGG 0: 1
1: 0
2: 0
3: 17
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144107231 Original CRISPR ACGTGGCGAGTGCGGGGCCG GGG (reversed) Exonic
900072086 1:779060-779082 ATGAGGCGAGTGGGCGGCCGGGG - Intergenic
900184039 1:1324771-1324793 GCGGGGCGAGGGCGGGGCGGTGG + Exonic
900205014 1:1427937-1427959 CCGTGGCGGGGGCGGGGCTGCGG - Intergenic
900318533 1:2070993-2071015 ACGTGGAGGGTGCTGGGCCCGGG + Intronic
900658763 1:3772722-3772744 AGGGGGCGAGGGCGGGGGCGGGG - Intergenic
901242873 1:7704966-7704988 GCGGGGCGGGGGCGGGGCCGGGG + Intronic
903426457 1:23257606-23257628 ACGGGGCGGCTGCGGGGCGGAGG - Intergenic
910261054 1:85294287-85294309 ACGTGGTGTGTGAGGGGCAGAGG - Intergenic
913047853 1:115089300-115089322 GGGTGGCGGGCGCGGGGCCGGGG - Intronic
913222107 1:116667788-116667810 GCGAGGCGAGCGCGGGGCCAGGG + Intergenic
914787971 1:150851078-150851100 ACGGGGCGGCTGCGGGGCGGAGG - Intronic
915902864 1:159858716-159858738 ACGTGGTGAGTGCTGGGCACAGG - Exonic
922196541 1:223364359-223364381 ACGGGGTGAGTGGGGGGGCGGGG + Intergenic
922267020 1:223993015-223993037 ATGAGGCGAGTGGGCGGCCGGGG - Intergenic
922740826 1:228013450-228013472 AACTGGCAAGTGCGTGGCCGCGG + Intronic
1063663806 10:8050349-8050371 ACGTGCAGACCGCGGGGCCGCGG + Intergenic
1064443205 10:15371356-15371378 ACCTGGCGGCTGCGGCGCCGAGG + Intergenic
1064982074 10:21174531-21174553 TCGCGGGGAGTGCGGGGCCAGGG + Intergenic
1065712956 10:28533940-28533962 ACGGCGCGGGTGGGGGGCCGGGG - Intronic
1067873838 10:49986727-49986749 ATGTGTCGAGTGAGGGGCCTAGG + Intronic
1069452896 10:68531458-68531480 AGGTGGGGGGTGCGGGGCTGGGG - Intergenic
1069991495 10:72319430-72319452 ACTTGGGGAGTGGGGGGCAGGGG - Intergenic
1072336699 10:94403608-94403630 TCGGGGCGGGTCCGGGGCCGGGG + Intronic
1073137291 10:101227128-101227150 AGGAGCCGAGTCCGGGGCCGGGG + Exonic
1073286672 10:102394015-102394037 ACGGAGCGAGAGAGGGGCCGGGG + Intergenic
1074152161 10:110767491-110767513 ACGGGGCGGCTGCGGGGCGGAGG + Intronic
1075259261 10:120949038-120949060 GCGTGGCCAGCTCGGGGCCGCGG - Intergenic
1075700351 10:124465256-124465278 ACTTGGCGAGTTCGAGGGCGTGG + Intronic
1076729885 10:132433015-132433037 ACGTGGCCAGCACAGGGCCGAGG - Intergenic
1076793347 10:132787755-132787777 ACGCGGGAACTGCGGGGCCGGGG + Intergenic
1077185756 11:1234708-1234730 AGGTGGGGAGGGCGGGGGCGGGG + Intronic
1078801148 11:14644623-14644645 CGGGGGCGTGTGCGGGGCCGCGG - Exonic
1078986745 11:16605322-16605344 ACCTGGCGGGAGCGGGGGCGAGG - Intronic
1081911321 11:46701532-46701554 CCTTGGCGAGTGAGGGGCCAAGG - Exonic
1082706194 11:56497230-56497252 ACGTGGCGGCTGCCGGGCGGAGG - Intergenic
1083656883 11:64234316-64234338 CCTTGGCGAGGCCGGGGCCGGGG - Intergenic
1083900863 11:65642635-65642657 AAGTGGTGAGTGGCGGGCCGCGG + Exonic
1086434834 11:86770744-86770766 ACGGGGCGGCTGCGGGGCGGAGG + Intergenic
1090345175 11:126063332-126063354 ACGAGGCTAGGGCGGGGCCTCGG - Intronic
1090732028 11:129580450-129580472 AGGAGGCCAGTGAGGGGCCGGGG + Intergenic
1096159900 12:49367560-49367582 ACGAGGCGATTGCGGGGGCCTGG + Exonic
1097243479 12:57591837-57591859 AGGTGGAGGGTGAGGGGCCGAGG + Intronic
1103432941 12:120903827-120903849 TCGTGGTGAGTGCGGGGCTCCGG - Exonic
1103439689 12:120954043-120954065 ACGTGCCAAGGGCGGGGCAGTGG - Intergenic
1103872661 12:124102185-124102207 ACGTGGCGGCTGCCGGGCGGAGG + Intronic
1104624224 12:130338790-130338812 GTGTGGGGGGTGCGGGGCCGGGG + Intronic
1104718527 12:131031865-131031887 ACCTGGCATGTGCGGGGACGAGG - Intronic
1104763681 12:131313259-131313281 GCGTGGGGAGTGCAGGGCCTGGG - Intergenic
1105248480 13:18673960-18673982 ACGGGGCGGCTGCCGGGCCGAGG - Intergenic
1106169106 13:27273402-27273424 ATGTTGGGAGAGCGGGGCCGAGG - Exonic
1106340258 13:28820281-28820303 CCGAGGTGAGTGCGGGGGCGCGG + Intergenic
1107548867 13:41457404-41457426 GCGTGGCGAGGGCGGTGCCTGGG + Intergenic
1115592084 14:34874462-34874484 CCGGGCCGTGTGCGGGGCCGCGG - Intronic
1116895669 14:50312614-50312636 GCGGGGCGGGGGCGGGGCCGAGG - Intronic
1118265812 14:64294224-64294246 AGGCGGCGAGCGCTGGGCCGGGG - Exonic
1119004032 14:70907999-70908021 ACATGGTGAGTGTGGGGGCGGGG + Exonic
1121245585 14:92459051-92459073 AAGTGGCCAGTGCGGGGCAGTGG - Intronic
1122438764 14:101716203-101716225 ACGTGGCCAGTGAGGGCCGGTGG + Intergenic
1122779710 14:104138528-104138550 GGGAGGCGAGGGCGGGGCCGGGG - Intergenic
1122883485 14:104700350-104700372 GGGTGGAGAGTGCTGGGCCGGGG + Intronic
1124960370 15:34389288-34389310 AACTGGCGAGGGCGGGGCCTGGG + Intronic
1124976999 15:34535509-34535531 AACTGGCGAGGGCGGGGCCTGGG + Intronic
1126660844 15:51031524-51031546 ACGTGGCCAGTGCTGGGGGGAGG + Intergenic
1130411980 15:83654811-83654833 AGGCGGCCAGTGCGGGGCCCTGG - Intronic
1132064007 15:98715594-98715616 ACGTGGAGCGTGTGGGCCCGTGG + Intronic
1132244136 15:100281211-100281233 ACATGGTGAGTCCGGAGCCGGGG - Exonic
1132672601 16:1107898-1107920 AGGTGGGGAGGGCAGGGCCGAGG + Intergenic
1132683456 16:1153032-1153054 GCGTGGCCGGGGCGGGGCCGGGG - Intergenic
1133031366 16:3012808-3012830 ACGGGGAGGGTGCGGGGCTGGGG - Exonic
1137019877 16:35414692-35414714 ACGGGGCGGGGGCGGGGACGGGG - Intergenic
1138178596 16:54928375-54928397 ACGGGGCGGGGGCGGGGGCGGGG + Intergenic
1141659652 16:85435196-85435218 TCCTGGCGTGTGCAGGGCCGAGG - Intergenic
1142241354 16:88948302-88948324 TCGTGGCGAGTGGGGAGCTGGGG + Intronic
1142271768 16:89093726-89093748 TCGTGGCGGGGTCGGGGCCGCGG - Intronic
1142304774 16:89279054-89279076 CCGTGGTGAGTGCGGGGCCCGGG - Exonic
1142419915 16:89963903-89963925 GCGTGGGGAGTGCGGGGATGCGG + Intronic
1142550117 17:732930-732952 CCCTGGCGGGAGCGGGGCCGGGG + Intronic
1142848134 17:2691935-2691957 GCGGGGCGGGGGCGGGGCCGCGG - Intronic
1142848150 17:2691968-2691990 GCGTGGCGGGGGCGGGGGCGGGG - Intronic
1142974865 17:3637152-3637174 ACGTGCGGAGTGCGGGGCTCCGG + Exonic
1143635767 17:8163034-8163056 ACGCGTCGCGAGCGGGGCCGCGG + Intronic
1144107231 17:11997259-11997281 ACGTGGCGAGTGCGGGGCCGGGG - Exonic
1147311098 17:39596632-39596654 ACGCGGCCAGTGCGGGGAGGAGG - Intergenic
1148269586 17:46252990-46253012 ACGGGGCGACTGCCGGGCGGAGG + Intergenic
1148796395 17:50199332-50199354 AGGGGGAGAGGGCGGGGCCGGGG + Intronic
1149135412 17:53358470-53358492 ACGTGTCAAGGGAGGGGCCGAGG + Intergenic
1150402961 17:64874400-64874422 ACGGGGCGACTGCCGGGCGGAGG - Intronic
1151876098 17:76868957-76868979 ACGCGGCGAGAGCTGGGCCCAGG + Intronic
1151879527 17:76886695-76886717 ACCTGGTGAGTGAGGGGCAGTGG + Intronic
1151939031 17:77281370-77281392 GCGGGGCGGGGGCGGGGCCGGGG + Intronic
1152672687 17:81618410-81618432 ACGGGGCGGCTGCGGGGCGGAGG - Intronic
1152696229 17:81798105-81798127 ACGGGGCGGCTGCGGGGCAGAGG + Intergenic
1160464979 18:79069082-79069104 ACGAGGCGGGGGCGGGGCCTCGG + Intergenic
1160679603 19:406703-406725 ATGTGGCCAGGGCGGGGCCGTGG - Exonic
1160784492 19:893068-893090 ACCAGGTGAGTGCGGGGCTGCGG - Exonic
1160810175 19:1009896-1009918 ACGCGGGGAGGGCGGGGCCATGG + Exonic
1160900927 19:1428086-1428108 AGGAGGAGGGTGCGGGGCCGGGG - Intronic
1160930719 19:1568369-1568391 ACGTCGCGGGGGCGGGGCCGGGG - Intergenic
1161337569 19:3722569-3722591 CCGTGGCGGGGGCGGGGCGGGGG + Intronic
1161435063 19:4258221-4258243 ACCTGGCGGGCGCGGGGCGGCGG - Exonic
1162617585 19:11814535-11814557 ACGCGGCGACTCCGGGGTCGTGG + Intronic
1162778673 19:12995688-12995710 CCGGGCCGAGCGCGGGGCCGCGG + Exonic
1163431210 19:17268873-17268895 TTGGAGCGAGTGCGGGGCCGAGG - Exonic
1163433460 19:17281978-17282000 CCGTGGTGAGGGCGGGGCCGGGG + Exonic
1163577219 19:18117971-18117993 CCCAGGCGAGTGCGGGGGCGGGG - Intronic
1164986728 19:32653726-32653748 GCGTGGCGGGGGCGGGGACGGGG + Intronic
1165479519 19:36054397-36054419 ACGTGACGAGGGCGGGACTGTGG - Exonic
1165511490 19:36268982-36269004 ACGCGGCGGCTGCGGGGCCTGGG - Intergenic
1165512038 19:36271505-36271527 ACGCGGCGGCTGCGGGGCCTGGG - Intergenic
1165512586 19:36274004-36274026 ACGCGGCGGCTGCGGGGCCTGGG - Intergenic
1165513137 19:36276547-36276569 ACGCGGCGGCTGCGGGGCCTGGG - Intergenic
1165513692 19:36279100-36279122 ACGCGGCGGCTGCGGGGCCTGGG - Intergenic
1165514241 19:36281634-36281656 ACGCGGCGGCTGCGGGGCCTGGG - Intergenic
1165514795 19:36284173-36284195 ACGCGGCGGCTGCGGGGCCTGGG - Intergenic
1165515347 19:36286704-36286726 ACGCGGCGGCTGCGGGGCCTGGG - Intergenic
1165515897 19:36289242-36289264 ACGCGGCGGCTGCGGGGCCTGGG - Intergenic
1165516448 19:36291777-36291799 ACGCGGCGGCTGCGGGGCCTGGG - Intergenic
1165517000 19:36294305-36294327 ACGCGGCGGCTGCGGGGCCTGGG - Intergenic
1165517553 19:36296828-36296850 ACGCGGCGGCTGCGGGGCCTGGG - Intergenic
1165518105 19:36299363-36299385 ACGCGGCGGCTGCGGGGCCTGGG - Intergenic
1165518656 19:36301898-36301920 ACGCGGCGGCTGCGGGGCCTGGG - Intergenic
1165519204 19:36304428-36304450 ACGCGGCGGCTGCGGGGCCTGGG - Intergenic
1165519753 19:36306943-36306965 ACGCGGCGGCTGCGGGGCCTGGG - Intergenic
1165520304 19:36309473-36309495 ACGCGGCGGCTGCGGGGCCTGGG - Intergenic
1165623766 19:37269109-37269131 ACGCGGCGGCTGCGGGGCCTGGG + Intergenic
1165624309 19:37271649-37271671 ACGCGGCGGCTGCGGGGCCTGGG + Intergenic
1165624856 19:37274176-37274198 ACGCGGCGGCTGCGGGGCCTGGG + Intergenic
1165625393 19:37276714-37276736 ACGCGGCGGCTGCGGGGCCTGGG + Intergenic
1165625926 19:37279239-37279261 ACGCGGCGGCTGCGGGGCCTGGG + Intergenic
1165626470 19:37281766-37281788 ACGCGGCGGCTGCGGGGCCTGGG + Intergenic
1165627009 19:37284291-37284313 ACGCGGCGGCTGCGGGGCCTGGG + Intergenic
1165627552 19:37286815-37286837 ACGCGGCGGCTGCGGGGCCTGGG + Intergenic
1165628087 19:37289339-37289361 ACGCGGCGGCTGCGGGGCCTGGG + Intergenic
1165628629 19:37291865-37291887 ACGCGGCGGCTGCGGGGCCTGGG + Intergenic
1165629169 19:37294390-37294412 ACGCGGCGGCTGCGGGGCCTGGG + Intergenic
1165629712 19:37296916-37296938 ACGCGGCGGCTGCGGGGCCTGGG + Intergenic
1165630254 19:37299443-37299465 ACGCGGCGGCTGCGGGGCCTGGG + Intergenic
1165630793 19:37301981-37302003 ACGCGGCGGCTGCGGGGCCTGGG + Intergenic
1165939172 19:39406781-39406803 ACGGGGCGGGGCCGGGGCCGGGG - Intergenic
1166776394 19:45315483-45315505 CCGTGGCGAGCGCCGGGCGGTGG - Exonic
1167940565 19:52942712-52942734 GCGGGGCGGGGGCGGGGCCGGGG + Intronic
1168235977 19:55063291-55063313 GCGTGGCTAGTCCGGGGGCGGGG + Intronic
924985007 2:263437-263459 ACAGGGCGAGCGCGGGGTCGCGG - Intronic
925915250 2:8600126-8600148 CTGTGGAGAGTGCTGGGCCGAGG - Intergenic
926035101 2:9630449-9630471 CCATGGCGGGCGCGGGGCCGGGG + Exonic
929065039 2:37964057-37964079 ACGTGGCGGCTGCCGGGCGGAGG + Intronic
929497800 2:42461595-42461617 GAGTGGAGAGTGTGGGGCCGGGG - Intronic
933868466 2:86545537-86545559 ACGGGGCGACTGCCGGGCAGAGG + Intronic
933868476 2:86545577-86545599 ACGGGGCGACTGCCGGGCAGAGG + Intronic
935011497 2:99140976-99140998 GAGTGGCGGGTGCGGGGCCGTGG - Intronic
935710369 2:105893182-105893204 GGGAGGCGAGTGTGGGGCCGGGG - Exonic
936537742 2:113324985-113325007 GCGAGGGGAGGGCGGGGCCGAGG - Intergenic
936972112 2:118186012-118186034 AGCTGGCGCGGGCGGGGCCGGGG - Intergenic
937869356 2:126776696-126776718 GCGGGGCCAGGGCGGGGCCGGGG - Intergenic
940453862 2:153872402-153872424 CCGCGGCGAGTGCCGGGGCGCGG + Intronic
941911754 2:170770977-170770999 AGGTGGCGGGGGCGGGGGCGGGG - Intergenic
941987474 2:171522949-171522971 TCGCCGCGAGCGCGGGGCCGGGG + Intronic
1169088292 20:2840661-2840683 ACGTGGCGAGGCCGCCGCCGCGG - Exonic
1169191387 20:3660899-3660921 CCGTGGCGAGGGTGGGGACGGGG - Exonic
1171473649 20:25390921-25390943 AGGTGGCCGGGGCGGGGCCGGGG - Exonic
1175919934 20:62446105-62446127 AGGTGGCGAGGGCAGGGCGGGGG + Intergenic
1175919963 20:62446175-62446197 AGGTGGCGAGGGCGGGGCGGGGG + Intergenic
1175919991 20:62446249-62446271 AGGTGGCGAGGGCGGGGTGGGGG + Intergenic
1176510653 21:7745281-7745303 ACGTGGCCCGGGCGGGGCCCAGG + Intronic
1176548381 21:8211576-8211598 ACGCGGCGCGTGCGCGGGCGGGG + Intergenic
1176556273 21:8255782-8255804 ACGCGGCGCGTGCGCGGGCGGGG + Intergenic
1176567312 21:8394611-8394633 ACGCGGCGCGTGCGCGGGCGGGG + Intergenic
1176575212 21:8438824-8438846 ACGCGGCGCGTGCGCGGGCGGGG + Intergenic
1178534909 21:33403352-33403374 ACGGGGCGGGGGCGGGGGCGCGG + Exonic
1178644766 21:34375810-34375832 ACGTGGCCCGGGCGGGGCCCAGG + Exonic
1179996853 21:44978082-44978104 GCCTGGCGAGTGGGTGGCCGAGG + Intergenic
1180215975 21:46324083-46324105 GCGTGTCGGGGGCGGGGCCGCGG + Intergenic
1180712905 22:17851912-17851934 ACGTGGCGGGTGAAGGGCAGAGG + Intronic
1180854397 22:19037004-19037026 AGGTGGCCAGTGAGGGCCCGAGG - Exonic
1184766915 22:46576989-46577011 GCGGGGCGGGGGCGGGGCCGGGG + Intronic
1185259327 22:49853242-49853264 TCTGGGCGAGCGCGGGGCCGGGG - Intergenic
1203253261 22_KI270733v1_random:127879-127901 ACGCGGCGCGTGCGCGGGCGGGG + Intergenic
1203261316 22_KI270733v1_random:172960-172982 ACGCGGCGCGTGCGCGGGCGGGG + Intergenic
949989890 3:9570122-9570144 ACGGGGCGGCTGCGGGGCAGAGG - Intergenic
954228584 3:49199302-49199324 TCGCGGCGAGGGCGGGGCCCTGG + Intronic
954305705 3:49724217-49724239 TCGGGGCGAGGCCGGGGCCGTGG - Intergenic
954404503 3:50337887-50337909 ACGTGGTGAGCGCGGGGCCGAGG - Exonic
954717455 3:52533717-52533739 GCATGGCGGGTGCGGGGCTGCGG - Exonic
956148937 3:66221123-66221145 TGGTGGTGAGTGCGGGGCGGTGG + Exonic
961199220 3:125030835-125030857 AGCTGGCGAGTGAGGGGCCTGGG - Intronic
962787921 3:138785027-138785049 ACGGGGCGGCTGCGGGGCGGAGG - Intronic
966351001 3:179032755-179032777 ACGGGGCGGCTGCGGGGCAGAGG - Intronic
968522329 4:1039619-1039641 GGGTGGCGGGTGCTGGGCCGGGG + Intergenic
968701049 4:2058638-2058660 ACGGGGCGCATGCGCGGCCGCGG + Intergenic
968879772 4:3292984-3293006 TCGAGGCGAGGGCGGGGCCGAGG - Intergenic
969249091 4:5955434-5955456 ACGTGGCCAGTGCCCGGCGGTGG - Intronic
969295660 4:6269589-6269611 GCGGGGCGGGGGCGGGGCCGGGG + Intergenic
977607225 4:98995555-98995577 GCGGGGCGGGGGCGGGGCCGGGG + Intergenic
977689916 4:99894547-99894569 GCGGGGCGCGTGCGGGGCGGGGG - Intergenic
977694334 4:99949906-99949928 CCGTGGCGAGCGCGCGGCGGGGG - Intronic
978466799 4:109016949-109016971 ACATGGCGAATGAGGGGCAGGGG - Intronic
979482915 4:121238810-121238832 ACGTGGCGGCTGCCGGGCCGAGG - Intergenic
980356171 4:131732427-131732449 ACGCGGCGACTGCGGGGACTGGG - Intergenic
981429715 4:144645616-144645638 ACGGGGCGAGGGGCGGGCCGGGG + Intergenic
985566753 5:622544-622566 ATGTGGCAAGTGCTGGGCCCTGG + Intronic
985688644 5:1295059-1295081 GCGAGGAGAGGGCGGGGCCGCGG + Intronic
992415807 5:76551088-76551110 ACGGGGCGGCTGCGGGGCGGAGG + Intronic
1004375817 6:15089892-15089914 ACCTGGCCAGTGCAGAGCCGTGG - Intergenic
1006123495 6:31822108-31822130 AGGTGGGGAGTGCGGGGGGGGGG - Intergenic
1010270893 6:73915020-73915042 ACGGGGCGACTGCCGGGCGGAGG + Intergenic
1015994902 6:138987804-138987826 ACCTGGCGCGTGTGAGGCCGGGG - Exonic
1019562568 7:1665881-1665903 GCGGGGCGAGCGCGGGGCGGCGG - Intergenic
1022089287 7:27097019-27097041 ACGTGGCCAGCGCGGGGGCCGGG + Intergenic
1022113920 7:27246774-27246796 AGGTGGAGGGTGAGGGGCCGAGG - Intronic
1037273894 8:17157073-17157095 CGGCGGCGAGTGCGGGGCGGAGG - Intronic
1042858949 8:73294669-73294691 CCGCGGAGAGTGCAGGGCCGGGG + Exonic
1045432023 8:102123741-102123763 AGGAGGCGAGTGCGGGGCGTGGG - Intronic
1049557305 8:143289462-143289484 CCAAGGCGAGGGCGGGGCCGAGG + Intergenic
1053066378 9:35072185-35072207 AGGGGGCGAGTGAGGGGCCGTGG - Intronic
1053163563 9:35829500-35829522 GCGGGGCGAGGGCGGGGCTGGGG - Exonic
1061802816 9:133121358-133121380 CCTCGGCGAGGGCGGGGCCGCGG - Intronic
1203469663 Un_GL000220v1:111026-111048 ACGCGGCGCGTGCGCGGGCGGGG + Intergenic
1203477484 Un_GL000220v1:154998-155020 ACGCGGCGCGTGCGCGGGCGGGG + Intergenic
1195566683 X:106347150-106347172 ACGGGGCGGGTGGGGGGCAGGGG + Intergenic
1199456915 X:148039375-148039397 AGTTGGGGAGTGCGGGGGCGGGG - Intergenic
1200086650 X:153610368-153610390 GCGTGGAGGGTGCGGGGCTGAGG - Intergenic