ID: 1144107232

View in Genome Browser
Species Human (GRCh38)
Location 17:11997260-11997282
Sequence GACGTGGCGAGTGCGGGGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 46, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144107232_1144107241 1 Left 1144107232 17:11997260-11997282 CCCGGCCCCGCACTCGCCACGTC 0: 1
1: 0
2: 0
3: 46
4: 203
Right 1144107241 17:11997284-11997306 CCCGCGCGCTCCCAGACGCATGG 0: 1
1: 0
2: 1
3: 9
4: 72
1144107232_1144107243 2 Left 1144107232 17:11997260-11997282 CCCGGCCCCGCACTCGCCACGTC 0: 1
1: 0
2: 0
3: 46
4: 203
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107232_1144107248 18 Left 1144107232 17:11997260-11997282 CCCGGCCCCGCACTCGCCACGTC 0: 1
1: 0
2: 0
3: 46
4: 203
Right 1144107248 17:11997301-11997323 GCATGGGCAAGGGAGCCCGCTGG 0: 1
1: 0
2: 0
3: 17
4: 221
1144107232_1144107244 7 Left 1144107232 17:11997260-11997282 CCCGGCCCCGCACTCGCCACGTC 0: 1
1: 0
2: 0
3: 46
4: 203
Right 1144107244 17:11997290-11997312 CGCTCCCAGACGCATGGGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 74
1144107232_1144107245 8 Left 1144107232 17:11997260-11997282 CCCGGCCCCGCACTCGCCACGTC 0: 1
1: 0
2: 0
3: 46
4: 203
Right 1144107245 17:11997291-11997313 GCTCCCAGACGCATGGGCAAGGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144107232 Original CRISPR GACGTGGCGAGTGCGGGGCC GGG (reversed) Exonic
900072087 1:779061-779083 GATGAGGCGAGTGGGCGGCCGGG - Intergenic
900318532 1:2070992-2071014 GACGTGGAGGGTGCTGGGCCCGG + Intronic
900342281 1:2194798-2194820 GCCGGGGCGGGGGCGGGGCCTGG - Intronic
900383449 1:2397460-2397482 GACGTGCCCAGGGCAGGGCCAGG - Intronic
900628256 1:3619488-3619510 CACGTGTCGAGAGAGGGGCCTGG + Intergenic
903012945 1:20343605-20343627 GATGGGGCGAGAGTGGGGCCTGG - Intronic
903374057 1:22854691-22854713 GATGTGCCCAGTGCTGGGCCAGG - Intronic
904055600 1:27668209-27668231 GCCTCGGTGAGTGCGGGGCCTGG - Exonic
904837558 1:33349318-33349340 GGGGTGGGGTGTGCGGGGCCTGG + Intronic
904842843 1:33384639-33384661 GAGATGGAGAGTGAGGGGCCTGG - Intronic
908128173 1:61050632-61050654 GGGGCGGCGAGTGCGGGGCGGGG - Intronic
913222106 1:116667787-116667809 GGCGAGGCGAGCGCGGGGCCAGG + Intergenic
915272079 1:154760625-154760647 GTCGTGGAGAGGCCGGGGCCCGG - Intronic
915333512 1:155127805-155127827 GGCGGGGCGAGGGCGGGGCGGGG + Exonic
915562366 1:156694679-156694701 GACGTGGGGAGTAGGGAGCCAGG + Intergenic
920315976 1:205075843-205075865 GTCGTGGCCAGAGGGGGGCCAGG - Exonic
922196540 1:223364358-223364380 GACGGGGTGAGTGGGGGGGCGGG + Intergenic
922213409 1:223502126-223502148 GCCGTGGCCAGTGAGAGGCCTGG + Intergenic
922267021 1:223993016-223993038 GATGAGGCGAGTGGGCGGCCGGG - Intergenic
924502909 1:244653350-244653372 GACATGGTGAGTGCGGCCCCTGG + Exonic
1064418235 10:15168726-15168748 GACGGGGCGCGGGCGGGGCGGGG - Intergenic
1064982073 10:21174530-21174552 GTCGCGGGGAGTGCGGGGCCAGG + Intergenic
1065579320 10:27155285-27155307 GAGGTGACGAGGGCGGGGCGCGG + Intronic
1065993119 10:31031924-31031946 GGCGGGGCGAGGGCGGAGCCTGG - Exonic
1069960197 10:72074988-72075010 GATGGGGTGAGTGCTGGGCCAGG - Intronic
1073286671 10:102394014-102394036 GACGGAGCGAGAGAGGGGCCGGG + Intergenic
1074297075 10:112199878-112199900 CACGTGTCAAGTGCAGGGCCAGG - Intronic
1076793346 10:132787754-132787776 GACGCGGGAACTGCGGGGCCGGG + Intergenic
1076885898 10:133262124-133262146 GACGGGGCGGGGGCGGGGCCGGG + Intergenic
1077610744 11:3642001-3642023 GGCGGGGCGTGGGCGGGGCCTGG + Exonic
1078256594 11:9664048-9664070 GGCCTGGCGGGGGCGGGGCCTGG + Intergenic
1080457693 11:32430907-32430929 GGCGCGGAGAGTGCGGGGGCAGG + Intronic
1083880659 11:65546781-65546803 GTCGCGGTGAGGGCGGGGCCCGG - Exonic
1083911395 11:65712274-65712296 GAGGTGGTGAGTCCGGTGCCCGG + Exonic
1084609142 11:70190633-70190655 CACGTGTCGAGGGCGGGACCTGG - Intergenic
1090616851 11:128522526-128522548 GGGCTGGCGAGCGCGGGGCCGGG + Intronic
1097232907 12:57523006-57523028 GCCGCGGTGAGTGCGGGGCCCGG + Exonic
1098008108 12:66020764-66020786 CACGTGTCAAGGGCGGGGCCAGG - Intergenic
1101111720 12:101492834-101492856 CACGTGTCAAGGGCGGGGCCAGG - Intergenic
1102026004 12:109714601-109714623 GACGTGGCGATCACGGGCCCCGG + Exonic
1104624223 12:130338789-130338811 GGTGTGGGGGGTGCGGGGCCGGG + Intronic
1104763682 12:131313260-131313282 TGCGTGGGGAGTGCAGGGCCTGG - Intergenic
1104901059 12:132189756-132189778 GAGGAGTCGAGGGCGGGGCCTGG + Intergenic
1105425623 13:20292492-20292514 GCCGCTCCGAGTGCGGGGCCCGG - Intergenic
1105767900 13:23579283-23579305 GCCGCGGTGAGGGCGGGGCCCGG + Intronic
1107548866 13:41457403-41457425 CGCGTGGCGAGGGCGGTGCCTGG + Intergenic
1112328436 13:98459404-98459426 GACCTGGCAAGTTCAGGGCCCGG - Intronic
1113966434 13:114155875-114155897 GGTGTGGTGGGTGCGGGGCCTGG + Intergenic
1120205288 14:81581129-81581151 CACGTGTCAAGGGCGGGGCCAGG - Intergenic
1122077739 14:99246578-99246600 GCCGTGCCGGGTGCGGGGTCCGG + Intronic
1122481309 14:102049267-102049289 GATGTGGTGAGGGCGGCGCCAGG + Intronic
1122707001 14:103628214-103628236 GACGTCCCAAGTGCGGGGCCCGG - Intronic
1122785338 14:104160906-104160928 GGGGTGGGGAGTGGGGGGCCTGG - Intronic
1124960369 15:34389287-34389309 CAACTGGCGAGGGCGGGGCCTGG + Intronic
1124976998 15:34535508-34535530 CAACTGGCGAGGGCGGGGCCTGG + Intronic
1127468415 15:59267442-59267464 CACGTGGAGAGTGGGTGGCCTGG + Intronic
1127790073 15:62391346-62391368 GCCGGGCCGAGAGCGGGGCCAGG + Intronic
1127798861 15:62460551-62460573 CACGTGGCTAGTGCCGGGCACGG - Intronic
1128078389 15:64842023-64842045 GAGGAGGTGAGGGCGGGGCCCGG + Exonic
1129322776 15:74783827-74783849 GGTGTGGCGAGTGCTGGGTCAGG - Intronic
1129767362 15:78178829-78178851 GAGCTGGCGAGGGAGGGGCCGGG + Exonic
1132273253 15:100544634-100544656 GAGGAGGCAGGTGCGGGGCCCGG - Exonic
1132592036 16:730256-730278 GACGAGGCGGCTGCGGGTCCTGG + Exonic
1132659416 16:1054812-1054834 GGCCTGGCCGGTGCGGGGCCAGG + Intergenic
1132929356 16:2451047-2451069 GATGTGGCGAGGGCCGGGCCAGG - Intronic
1133698606 16:8288319-8288341 CACGTGTTGAGGGCGGGGCCCGG - Intergenic
1134018042 16:10902796-10902818 ACCATGGTGAGTGCGGGGCCTGG + Exonic
1134566612 16:15257296-15257318 CACGTGTCAAGGGCGGGGCCAGG - Intergenic
1134735882 16:16499403-16499425 CACGTGTCAAGGGCGGGGCCAGG + Intergenic
1134849917 16:17470991-17471013 GAGGCGGAGAGGGCGGGGCCTGG + Intergenic
1136419582 16:30123306-30123328 GCCGGGGCAAGGGCGGGGCCTGG - Intronic
1136570550 16:31094117-31094139 GAGGAGGCGAGTGAGTGGCCAGG - Intronic
1137019878 16:35414693-35414715 GACGGGGCGGGGGCGGGGACGGG - Intergenic
1137531598 16:49281872-49281894 GAGGCGGCGGGGGCGGGGCCAGG - Intergenic
1138016495 16:53433554-53433576 GACTTGGCGGGTAGGGGGCCAGG + Intergenic
1139691666 16:68645569-68645591 GGTGTGGGGAGTGCAGGGCCGGG + Intronic
1141665477 16:85463215-85463237 GGCTGGGTGAGTGCGGGGCCAGG - Intergenic
1142304776 16:89279055-89279077 CCCGTGGTGAGTGCGGGGCCCGG - Exonic
1142805798 17:2370516-2370538 TACGAGGCCACTGCGGGGCCGGG - Intronic
1142848151 17:2691969-2691991 GGCGTGGCGGGGGCGGGGGCGGG - Intronic
1143647795 17:8242955-8242977 GAGGTGGCGGTTGCGGGGGCTGG - Intronic
1143822949 17:9579343-9579365 AAAGTGGAGAGTGCAGGGCCTGG + Intronic
1144107232 17:11997260-11997282 GACGTGGCGAGTGCGGGGCCGGG - Exonic
1147150312 17:38510367-38510389 GGCGCGGCGGGCGCGGGGCCTGG + Exonic
1148108699 17:45132599-45132621 GGCGGTGCGAGGGCGGGGCCAGG + Exonic
1151704053 17:75757561-75757583 GACGTGGCGGGGGTGGGGCAGGG - Exonic
1151939030 17:77281369-77281391 GGCGGGGCGGGGGCGGGGCCGGG + Intronic
1157442535 18:47721734-47721756 GAAGAGGAGAGTGTGGGGCCTGG + Intergenic
1158478945 18:57803596-57803618 GTGGTGGCGAGTGCGGCCCCCGG - Intergenic
1160261419 18:77297836-77297858 GACGTGGCCTGTGAGGGACCCGG + Intergenic
1160895646 19:1400775-1400797 GACGGGGCCTGTGTGGGGCCAGG + Intronic
1160930720 19:1568370-1568392 GACGTCGCGGGGGCGGGGCCGGG - Intergenic
1160978865 19:1807338-1807360 GTGGTGTCGAGTGCGGGGCTAGG - Intronic
1160980244 19:1813290-1813312 GACGAGGCTAGGGCGGGTCCAGG + Intergenic
1161018019 19:1992983-1993005 TACGAGGCGGGGGCGGGGCCAGG - Intronic
1161337567 19:3722568-3722590 GCCGTGGCGGGGGCGGGGCGGGG + Intronic
1162398403 19:10430943-10430965 GGCGGGGCGCGCGCGGGGCCAGG - Intronic
1163312912 19:16524966-16524988 GGCGTGGCGAGGGCAGGGCGGGG - Intronic
1163433458 19:17281977-17281999 GCCGTGGTGAGGGCGGGGCCGGG + Exonic
1163577221 19:18117972-18117994 GCCCAGGCGAGTGCGGGGGCGGG - Intronic
1164986727 19:32653725-32653747 GGCGTGGCGGGGGCGGGGACGGG + Intronic
1165319425 19:35076250-35076272 GAGGAGGAGAGTGTGGGGCCTGG - Intergenic
1165394878 19:35558639-35558661 GACGTGGCGGGCGCTGTGCCGGG - Exonic
1165511491 19:36268983-36269005 GACGCGGCGGCTGCGGGGCCTGG - Intergenic
1165512039 19:36271506-36271528 GACGCGGCGGCTGCGGGGCCTGG - Intergenic
1165512587 19:36274005-36274027 GACGCGGCGGCTGCGGGGCCTGG - Intergenic
1165513138 19:36276548-36276570 GACGCGGCGGCTGCGGGGCCTGG - Intergenic
1165513693 19:36279101-36279123 GACGCGGCGGCTGCGGGGCCTGG - Intergenic
1165514242 19:36281635-36281657 GACGCGGCGGCTGCGGGGCCTGG - Intergenic
1165514796 19:36284174-36284196 GACGCGGCGGCTGCGGGGCCTGG - Intergenic
1165515348 19:36286705-36286727 GACGCGGCGGCTGCGGGGCCTGG - Intergenic
1165515898 19:36289243-36289265 GACGCGGCGGCTGCGGGGCCTGG - Intergenic
1165516449 19:36291778-36291800 GACGCGGCGGCTGCGGGGCCTGG - Intergenic
1165517001 19:36294306-36294328 GACGCGGCGGCTGCGGGGCCTGG - Intergenic
1165517554 19:36296829-36296851 GACGCGGCGGCTGCGGGGCCTGG - Intergenic
1165518106 19:36299364-36299386 GACGCGGCGGCTGCGGGGCCTGG - Intergenic
1165518657 19:36301899-36301921 GACGCGGCGGCTGCGGGGCCTGG - Intergenic
1165519205 19:36304429-36304451 GACGCGGCGGCTGCGGGGCCTGG - Intergenic
1165519754 19:36306944-36306966 GACGCGGCGGCTGCGGGGCCTGG - Intergenic
1165520305 19:36309474-36309496 GACGCGGCGGCTGCGGGGCCTGG - Intergenic
1165623765 19:37269108-37269130 GACGCGGCGGCTGCGGGGCCTGG + Intergenic
1165624308 19:37271648-37271670 GACGCGGCGGCTGCGGGGCCTGG + Intergenic
1165624855 19:37274175-37274197 GACGCGGCGGCTGCGGGGCCTGG + Intergenic
1165625392 19:37276713-37276735 GACGCGGCGGCTGCGGGGCCTGG + Intergenic
1165625925 19:37279238-37279260 GACGCGGCGGCTGCGGGGCCTGG + Intergenic
1165626469 19:37281765-37281787 GACGCGGCGGCTGCGGGGCCTGG + Intergenic
1165627008 19:37284290-37284312 GACGCGGCGGCTGCGGGGCCTGG + Intergenic
1165627551 19:37286814-37286836 GACGCGGCGGCTGCGGGGCCTGG + Intergenic
1165628086 19:37289338-37289360 GACGCGGCGGCTGCGGGGCCTGG + Intergenic
1165628628 19:37291864-37291886 GACGCGGCGGCTGCGGGGCCTGG + Intergenic
1165629168 19:37294389-37294411 GACGCGGCGGCTGCGGGGCCTGG + Intergenic
1165629711 19:37296915-37296937 GACGCGGCGGCTGCGGGGCCTGG + Intergenic
1165630253 19:37299442-37299464 GACGCGGCGGCTGCGGGGCCTGG + Intergenic
1165630792 19:37301980-37302002 GACGCGGCGGCTGCGGGGCCTGG + Intergenic
1165784454 19:38453020-38453042 GACGTGGCGAGGGCGGAGCGGGG + Intronic
1166105968 19:40598211-40598233 GCCGCGGCGGGGGCGGGGCCGGG + Intronic
1166299181 19:41904515-41904537 GAGGTGGGCAGGGCGGGGCCAGG + Intronic
1166677696 19:44749280-44749302 GACGTGGGGGGGGGGGGGCCAGG + Intronic
1167940564 19:52942711-52942733 GGCGGGGCGGGGGCGGGGCCGGG + Intronic
1168235976 19:55063290-55063312 GGCGTGGCTAGTCCGGGGGCGGG + Intronic
926130910 2:10302761-10302783 GGCGTGGAGGGGGCGGGGCCCGG + Intergenic
926419839 2:12685744-12685766 GAGGTGGCATGTGAGGGGCCTGG - Intergenic
927102923 2:19801586-19801608 GACGTGCTGAGAGCCGGGCCAGG - Intergenic
927846038 2:26473389-26473411 GAAGTGGTGAGTGCAGGCCCTGG - Exonic
929497801 2:42461596-42461618 GGAGTGGAGAGTGTGGGGCCGGG - Intronic
930979367 2:57504045-57504067 CACGTGTCAAGGGCGGGGCCAGG - Intergenic
937869357 2:126776697-126776719 GGCGGGGCCAGGGCGGGGCCGGG - Intergenic
941911755 2:170770978-170771000 GAGGTGGCGGGGGCGGGGGCGGG - Intergenic
946747497 2:222860931-222860953 GCGGTGGCGCGTGCGGGGCTGGG - Exonic
947800871 2:232928009-232928031 GGCGGGGCGGGTGCGGGGGCCGG + Intronic
948013741 2:234671152-234671174 GATGTGGGGAGTGCGGGGGTTGG + Intergenic
948615277 2:239194582-239194604 GGAGTGGGGAGTGCTGGGCCAGG - Intronic
948711840 2:239830068-239830090 GAGGTGGAGAGTGCGAGGGCAGG + Intergenic
1169191389 20:3660900-3660922 GCCGTGGCGAGGGTGGGGACGGG - Exonic
1169354734 20:4897114-4897136 TATGTGGCAGGTGCGGGGCCTGG - Intronic
1171473650 20:25390922-25390944 GAGGTGGCCGGGGCGGGGCCGGG - Exonic
1173221898 20:41137986-41138008 GACGAAGCGGGGGCGGGGCCCGG - Intronic
1175199176 20:57266323-57266345 GCCCGGGCGAGTGCGGGGCGAGG - Exonic
1175687646 20:61043369-61043391 GATGTGGGGAGTGCTGTGCCTGG + Intergenic
1175919962 20:62446174-62446196 CAGGTGGCGAGGGCGGGGCGGGG + Intergenic
1176131643 20:63498947-63498969 GCGGGGGCGGGTGCGGGGCCCGG + Intronic
1176548380 21:8211575-8211597 GACGCGGCGCGTGCGCGGGCGGG + Intergenic
1176556272 21:8255781-8255803 GACGCGGCGCGTGCGCGGGCGGG + Intergenic
1176567311 21:8394610-8394632 GACGCGGCGCGTGCGCGGGCGGG + Intergenic
1176575211 21:8438823-8438845 GACGCGGCGCGTGCGCGGGCGGG + Intergenic
1179453423 21:41480969-41480991 GCCGTGGAGAGCGCGGGGCTTGG - Intronic
1180981992 22:19882896-19882918 GAGGCGGGGAGGGCGGGGCCAGG + Intronic
1181670618 22:24424055-24424077 GCCGTCGGGGGTGCGGGGCCGGG + Intronic
1183393943 22:37560990-37561012 GAAGTGGGGGGTGGGGGGCCCGG + Intronic
1183522446 22:38303329-38303351 GATCTGGCGTGTGCCGGGCCCGG + Intronic
1184412242 22:44331918-44331940 GCGGCGGCGAGCGCGGGGCCCGG - Intergenic
1184453691 22:44597450-44597472 GAGGGGGCTGGTGCGGGGCCTGG - Intergenic
1184911117 22:47534943-47534965 GACATGGCGAGGGCCAGGCCGGG - Intergenic
1203253260 22_KI270733v1_random:127878-127900 GACGCGGCGCGTGCGCGGGCGGG + Intergenic
1203261315 22_KI270733v1_random:172959-172981 GACGCGGCGCGTGCGCGGGCGGG + Intergenic
951101888 3:18698218-18698240 GACGTGGGGAGAGAGGGACCAGG + Intergenic
953246450 3:41198928-41198950 GACGGGGCAGCTGCGGGGCCAGG + Intronic
954795856 3:53161135-53161157 GGCCTGGCGGGGGCGGGGCCTGG + Exonic
959398373 3:105869055-105869077 GGCGGGGCGGGGGCGGGGCCGGG + Intronic
960730226 3:120719206-120719228 GACGTGGGGAGGGTGGAGCCAGG + Intronic
961199221 3:125030836-125030858 CAGCTGGCGAGTGAGGGGCCTGG - Intronic
961359414 3:126357545-126357567 GGCGGGGCCAGGGCGGGGCCAGG - Intergenic
961551206 3:127671608-127671630 CACGTGGTGAGTGTGGGGACAGG + Exonic
967858245 3:194134256-194134278 CACGTGGCGGGCGCCGGGCCGGG - Intergenic
968514260 4:1009793-1009815 GACGGGGAGGGGGCGGGGCCTGG - Intergenic
968522328 4:1039618-1039640 GGGGTGGCGGGTGCTGGGCCGGG + Intergenic
968609564 4:1550915-1550937 GCCATGGCCAGTGCAGGGCCTGG + Intergenic
968850393 4:3074276-3074298 GGCGTGGCGAGGCCGGGGCGGGG - Intergenic
968913270 4:3486293-3486315 GTCGGGGCGGGTGCTGGGCCAGG + Intronic
969295659 4:6269588-6269610 GGCGGGGCGGGGGCGGGGCCGGG + Intergenic
974172120 4:58280382-58280404 GATGTGTCAAGTGTGGGGCCAGG + Intergenic
977689917 4:99894548-99894570 GGCGGGGCGCGTGCGGGGCGGGG - Intergenic
977694336 4:99949907-99949929 GCCGTGGCGAGCGCGCGGCGGGG - Intronic
978530037 4:109703457-109703479 GAAGGGCCGAGGGCGGGGCCGGG - Exonic
980354553 4:131724944-131724966 GACGCGGCGGCTGCGGGGACTGG - Intergenic
980355084 4:131727450-131727472 GACGCGGCGGCTGCGGGGACTGG - Intergenic
980356172 4:131732428-131732450 GACGCGGCGACTGCGGGGACTGG - Intergenic
980356707 4:131734916-131734938 GACGCGGCGGCTGCGGGGACTGG - Intergenic
980357246 4:131737404-131737426 GACGCGGCGGCTGCGGGGACTGG - Intergenic
980357789 4:131739899-131739921 GACGCGGCGGCTGCGGGGACTGG - Intergenic
980358859 4:131744879-131744901 GACGCGGCGGCTGCGGGGACTGG - Intergenic
980359399 4:131747352-131747374 GACGCGGCGGCTGCGGGGACTGG - Intergenic
980359942 4:131749820-131749842 GACGCGGCGGCTGCGGGGACTGG - Intergenic
980360481 4:131752315-131752337 GACGCGGCGGCTGCGGGGACTGG - Intergenic
980361564 4:131757270-131757292 GACGCGGCGGCTGCGGGGACTGG - Intergenic
980362648 4:131762225-131762247 GACGCGGCGGCTGCGGGGACTGG - Intergenic
980363188 4:131764701-131764723 GACATGGCGGCTGCGGGGACTGG - Intergenic
980378090 4:131976284-131976306 GACATGGCGGCTGCGGGGACTGG + Intergenic
986712772 5:10499803-10499825 GAAGTGGCCAGTGAGGGGGCAGG - Intergenic
1004755891 6:18609766-18609788 GTCTTGGGGAGTGAGGGGCCAGG - Intergenic
1005761708 6:28973567-28973589 GATGTGGGAAGTACGGGGCCGGG - Intergenic
1005847511 6:29792891-29792913 GTCCTGGCGAGGGCGGGGCTCGG + Intergenic
1005987600 6:30884313-30884335 GGCGTGGCGGGCGCGGGGCCTGG + Intronic
1006517708 6:34553912-34553934 GTGGTGGCGGGTGCGGGGGCCGG - Intronic
1012474437 6:99604632-99604654 GAAGGGGCGAGCGCTGGGCCTGG - Intergenic
1013246880 6:108295144-108295166 GATGTGTTGGGTGCGGGGCCTGG + Exonic
1014286569 6:119505552-119505574 GATGTCGGGAGTGTGGGGCCAGG - Intergenic
1015951846 6:138561301-138561323 GCGGTGGCGGGTGCGGGGCATGG + Intronic
1016826157 6:148390257-148390279 GAAGTGGTGAGTGGGGGTCCTGG + Exonic
1018893079 6:167996304-167996326 GACGGGGTGACTGTGGGGCCAGG + Intronic
1022089286 7:27097018-27097040 GACGTGGCCAGCGCGGGGGCCGG + Intergenic
1022102049 7:27174549-27174571 AACGTGGCTGGTGGGGGGCCTGG + Intronic
1025834318 7:65080956-65080978 GCTGAGGCGAGTGCGCGGCCAGG + Intergenic
1025904088 7:65770476-65770498 GCTGAGGCGAGTGCGCGGCCAGG + Intergenic
1027001457 7:74657483-74657505 GACGAGGCAAGCGCGGCGCCCGG - Intergenic
1027202801 7:76073772-76073794 CACGAGGCAAGAGCGGGGCCCGG + Intergenic
1029112205 7:98218120-98218142 GAAGTGGTTAGAGCGGGGCCTGG - Intronic
1029349621 7:100003925-100003947 GAGGGGGTGAGAGCGGGGCCTGG + Intergenic
1032151616 7:129434377-129434399 GAGGTGGAGGGGGCGGGGCCTGG + Intronic
1032691122 7:134287973-134287995 CACGTGTCAAGTGCGGGACCAGG + Intergenic
1032834306 7:135659288-135659310 GACGTGTCGAGGGAGGGACCTGG + Intergenic
1036208803 8:6825558-6825580 GACGTGGGGAGAGTGTGGCCTGG - Intronic
1036811149 8:11868243-11868265 GGCGGGGGGTGTGCGGGGCCGGG - Intronic
1036910830 8:12755566-12755588 GGCCTGGCGAGGGCGGGGCCGGG + Intronic
1037243364 8:16803716-16803738 CACGTGTCAAGTGTGGGGCCAGG - Intergenic
1038566347 8:28622722-28622744 ACCGTGGAGAGGGCGGGGCCGGG + Intronic
1045277673 8:100722119-100722141 GGCGGGGCGAGTGCGGCGCGGGG - Exonic
1045432024 8:102123742-102123764 CAGGAGGCGAGTGCGGGGCGTGG - Intronic
1053643111 9:40106719-40106741 GACGCGGCGGCTGCGGGGACTGG + Intergenic
1053763036 9:41358770-41358792 GACGCGGCGGCTGCGGGGACTGG - Intergenic
1054541644 9:66269884-66269906 GACGCGGCGGCTGCGGGGACTGG - Intergenic
1057495453 9:95556798-95556820 GACTTGGGAAGTGTGGGGCCAGG + Intergenic
1061503901 9:131019889-131019911 GGCGTGGGCGGTGCGGGGCCCGG - Intronic
1062622844 9:137430363-137430385 GGCGTGGCCAGTCCGGGGCGTGG - Intronic
1203469662 Un_GL000220v1:111025-111047 GACGCGGCGCGTGCGCGGGCGGG + Intergenic
1203477483 Un_GL000220v1:154997-155019 GACGCGGCGCGTGCGCGGGCGGG + Intergenic
1188482919 X:30653202-30653224 GACGTCACGGGGGCGGGGCCTGG - Intergenic
1198388033 X:136147378-136147400 GGCGGGGCGCGCGCGGGGCCGGG - Exonic
1199456916 X:148039376-148039398 GAGTTGGGGAGTGCGGGGGCGGG - Intergenic
1201158534 Y:11152567-11152589 GAGCTGGGGAGGGCGGGGCCTGG + Intergenic