ID: 1144107235

View in Genome Browser
Species Human (GRCh38)
Location 17:11997266-11997288
Sequence GCGGGGGACGTGGCGAGTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 183}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144107235_1144107243 -4 Left 1144107235 17:11997266-11997288 CCCGCACTCGCCACGTCCCCCGC 0: 1
1: 0
2: 1
3: 11
4: 183
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107235_1144107251 29 Left 1144107235 17:11997266-11997288 CCCGCACTCGCCACGTCCCCCGC 0: 1
1: 0
2: 1
3: 11
4: 183
Right 1144107251 17:11997318-11997340 CGCTGGCCCCTCCGTAGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
1144107235_1144107252 30 Left 1144107235 17:11997266-11997288 CCCGCACTCGCCACGTCCCCCGC 0: 1
1: 0
2: 1
3: 11
4: 183
Right 1144107252 17:11997319-11997341 GCTGGCCCCTCCGTAGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 194
1144107235_1144107245 2 Left 1144107235 17:11997266-11997288 CCCGCACTCGCCACGTCCCCCGC 0: 1
1: 0
2: 1
3: 11
4: 183
Right 1144107245 17:11997291-11997313 GCTCCCAGACGCATGGGCAAGGG 0: 1
1: 0
2: 0
3: 7
4: 101
1144107235_1144107248 12 Left 1144107235 17:11997266-11997288 CCCGCACTCGCCACGTCCCCCGC 0: 1
1: 0
2: 1
3: 11
4: 183
Right 1144107248 17:11997301-11997323 GCATGGGCAAGGGAGCCCGCTGG 0: 1
1: 0
2: 0
3: 17
4: 221
1144107235_1144107244 1 Left 1144107235 17:11997266-11997288 CCCGCACTCGCCACGTCCCCCGC 0: 1
1: 0
2: 1
3: 11
4: 183
Right 1144107244 17:11997290-11997312 CGCTCCCAGACGCATGGGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 74
1144107235_1144107241 -5 Left 1144107235 17:11997266-11997288 CCCGCACTCGCCACGTCCCCCGC 0: 1
1: 0
2: 1
3: 11
4: 183
Right 1144107241 17:11997284-11997306 CCCGCGCGCTCCCAGACGCATGG 0: 1
1: 0
2: 1
3: 9
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144107235 Original CRISPR GCGGGGGACGTGGCGAGTGC GGG (reversed) Exonic
900132539 1:1093490-1093512 GTGGGGGCCGCAGCGAGTGCTGG - Intronic
901769287 1:11522394-11522416 GCTGGGGACGTGGCCAGGGCTGG - Intronic
903724648 1:25431351-25431373 GCGCGGGGCGTGGCGAGGGTCGG + Intronic
904165515 1:28552543-28552565 GCGGGCGTGGTGGCGAGCGCTGG - Intergenic
905630198 1:39514321-39514343 GTGGGGGAGGTGGAGAGGGCGGG + Intronic
905667562 1:39771869-39771891 GTGGGGGAGGTGGAGAGGGCGGG - Intronic
905734764 1:40317318-40317340 GCGGGGGGCGGGGCGGGGGCCGG + Intronic
905862605 1:41361404-41361426 GCGGGGGACGGGGAGGGGGCGGG - Intergenic
908380657 1:63594033-63594055 GCGGGGGACGGGGAGAGGGAAGG - Intronic
912486659 1:110034691-110034713 GCGGCGGAGGTGGCGGGGGCTGG - Exonic
913544389 1:119853243-119853265 GCGGGGGAGGTGGAGAGCTCGGG - Intergenic
915575772 1:156775651-156775673 CCGGGGGTGGTGGCGGGTGCCGG - Intronic
919297785 1:195723167-195723189 GCGGGGGCCGCTCCGAGTGCGGG + Intergenic
920220360 1:204394326-204394348 GCGGGGCAGGTGGGGGGTGCTGG - Intergenic
920383311 1:205548585-205548607 TCAGGGGGCGTGCCGAGTGCTGG - Intergenic
923107906 1:230868560-230868582 GCGCGGGGCGGGGCGAGGGCGGG - Exonic
923558704 1:235022083-235022105 GCGGGGGACGGAGAGAGTGTAGG - Intergenic
923712130 1:236395867-236395889 GCAGGGGCCCTGGCGAGCGCGGG - Intronic
1064194423 10:13233734-13233756 GCGGGAGAAGAGGCGAGTGAAGG - Exonic
1064255276 10:13738116-13738138 GAGGGTGACATGGGGAGTGCCGG + Intronic
1065637278 10:27744764-27744786 GCGGGGGCGTTGGCGAGTGTGGG - Intronic
1066429219 10:35336459-35336481 GCGGGGGCTGCGGCGAGGGCGGG + Intronic
1071661275 10:87505169-87505191 GCGGGTGCCGTGGCGAATGAGGG - Exonic
1073008220 10:100340539-100340561 ACGGGGGAAGTGGTGAGTGGTGG + Intergenic
1075130651 10:119735985-119736007 GCGGGTGTGGTGGCGAGCGCCGG + Intronic
1075438454 10:122461605-122461627 GCGGCGGACAGGGCGAGGGCCGG - Exonic
1076125274 10:127969308-127969330 GCTCGGGACGTGGAGAGGGCAGG + Intronic
1076749938 10:132537594-132537616 GCGGGGGGCGTGGCTTGTGCGGG - Intergenic
1076779454 10:132716141-132716163 GCAGGGTGCGTGGCGGGTGCAGG - Intronic
1076821554 10:132942373-132942395 GCGGGGGTCGTGGCGGGTCCCGG + Intronic
1077254163 11:1573029-1573051 GGCGGGGACGCGGCGAGTCCGGG + Intergenic
1078093718 11:8283721-8283743 GCGGGGGAGGAGGCGAGGGGCGG + Intergenic
1080663746 11:34317943-34317965 GAGGGGGACGTGGGGAGGGGAGG - Intronic
1083595444 11:63916630-63916652 GTGGGGGTCGTGGAGAGCGCTGG - Exonic
1087188734 11:95230868-95230890 GCGGGCGCCGAGGCGAGAGCGGG + Exonic
1091404522 12:200900-200922 GTGGGGGAGGTGGGGAGTGGGGG - Intronic
1091689228 12:2584418-2584440 ACGGGGGATGTGGGGCGTGCAGG - Intronic
1091916132 12:4272807-4272829 GAGGGGGAGGGGGCGAGTGAGGG - Intergenic
1094375468 12:29783962-29783984 GCGGAGGAGGTGGCGATGGCCGG - Intronic
1094842632 12:34348444-34348466 AGGGGGGACGTGGGGAGTCCAGG + Intergenic
1095431955 12:42144385-42144407 GTGGGGGACGCGGCGGGCGCGGG - Intronic
1101773821 12:107775744-107775766 GCGGGGGTCCTGGCCAGTTCGGG - Exonic
1103446688 12:120999544-120999566 GCTGGGGACGTGGAGGGTGGTGG - Exonic
1103698404 12:122835203-122835225 GCGGGGGGCGGGGCGTGTGCCGG + Intronic
1103698585 12:122835753-122835775 GCGGGGGACGGCGCGGGGGCAGG + Intronic
1104841492 12:131828149-131828171 GCGGGGGTCGGGGCGCCTGCGGG - Intergenic
1106227658 13:27797104-27797126 GCTGGAGAAGAGGCGAGTGCGGG - Intergenic
1107248512 13:38327037-38327059 CCGGGAGTTGTGGCGAGTGCCGG + Intergenic
1110572975 13:77026700-77026722 GCGGGGGCCGGGGCGCGCGCGGG - Intronic
1111672603 13:91348485-91348507 GCGGGCGGCGTGGCGTGGGCGGG + Intergenic
1113517454 13:110914630-110914652 GCGGGGGACGTGGGGCGTGCCGG - Intronic
1113676318 13:112209950-112209972 GCGGGGGACAGGCGGAGTGCAGG + Intergenic
1117197570 14:53355728-53355750 GCGGGGGAGATGGCCAGGGCAGG + Intergenic
1119704664 14:76776300-76776322 GCGGGGGAGGGGGCGAGGGAGGG - Intronic
1125894876 15:43293762-43293784 GGGGGGGAGGTGGGGTGTGCGGG + Intronic
1125894940 15:43293911-43293933 GCGGGGGGAGTGGGGTGTGCGGG + Intronic
1126746409 15:51830021-51830043 GCGGGGGACGTGGGGCGCGCTGG + Intronic
1128880861 15:71241721-71241743 GCGGGGGACGTGGGCAGGACAGG - Intronic
1132273247 15:100544622-100544644 GCGGGGCCCGGGGCGGGTGCGGG - Intronic
1132649687 16:1014813-1014835 GGAGGTGACGTGGCGAGGGCTGG + Intergenic
1132683821 16:1154067-1154089 GCGGGGGGCGTGGGGAGGGTGGG + Intronic
1132742541 16:1422343-1422365 GCTTGGGAAGTGGGGAGTGCTGG - Intergenic
1132786157 16:1658061-1658083 GCGGGAGGCGTGGGGAATGCAGG - Intronic
1132929399 16:2451226-2451248 GCGGGGCAGGTGGCGCGGGCGGG + Intronic
1132947149 16:2537986-2538008 GCGGGCGACGGGGCGGGCGCAGG + Exonic
1133285310 16:4688062-4688084 TCGGGGGCCGCGGCGAGAGCAGG - Intronic
1133737140 16:8624520-8624542 GCGGGTGTCGTGGCGCGCGCTGG - Intronic
1135242063 16:20816468-20816490 GCTGGGGATGTGGCCTGTGCTGG - Intronic
1136129710 16:28211955-28211977 GCGCCGGAAGTGGCGAGCGCCGG + Intergenic
1136315923 16:29454752-29454774 GCGGGGGTCGCGGCGAGGCCAGG + Exonic
1136381682 16:29898980-29899002 GCTGGGGAGGCGGCGGGTGCTGG + Exonic
1136430500 16:30194094-30194116 GCGGGGGTCGCGGCGAGGCCAGG + Exonic
1137565270 16:49528771-49528793 GCCGGGGAGGTGGAGAGGGCGGG + Intronic
1138497107 16:57415488-57415510 GCCTGGGACGTGGAGACTGCGGG - Intronic
1139466880 16:67158970-67158992 GAGGGGGAGGTGGGGAGTACTGG + Intronic
1139471003 16:67178164-67178186 GCGGGGGAGGTGCCTAGAGCCGG - Intronic
1139583420 16:67886179-67886201 GCAGGGGCCATGGGGAGTGCAGG - Exonic
1141753034 16:85972175-85972197 GCTTGGGATGTGGGGAGTGCTGG - Intergenic
1142030486 16:87836062-87836084 GCTGGGGACGGGGAGAGTCCAGG + Intronic
1142586996 17:979910-979932 GGAGGGGGCGTGGCGAGGGCGGG - Intergenic
1144107235 17:11997266-11997288 GCGGGGGACGTGGCGAGTGCGGG - Exonic
1144980097 17:19162986-19163008 GCCGGGGACGTGGAGGGAGCGGG - Intergenic
1144988125 17:19215246-19215268 GCCGGGGACGTGGAGGGAGCGGG + Intergenic
1145019080 17:19415963-19415985 GCAGGGGGCGTGGTGGGTGCTGG + Exonic
1145245821 17:21268710-21268732 GCGGGGGCCATGGCAATTGCTGG - Intergenic
1147469676 17:40647820-40647842 GCGAGGGGCGGGGCGAGCGCGGG - Exonic
1147994705 17:44354402-44354424 GCGGGGGCGGCGGCGAGGGCTGG - Exonic
1148234772 17:45961425-45961447 GTGGGGGACCTGGTGGGTGCCGG + Intronic
1148798266 17:50207916-50207938 GGAGGGGGCATGGCGAGTGCTGG + Intergenic
1149993673 17:61396335-61396357 GCGGGGGACGCGGGGAGAGCGGG - Intergenic
1151438478 17:74113409-74113431 GCGGGGGCGGGGGCGAGGGCAGG + Intergenic
1152580942 17:81165455-81165477 GCGGGGGATGTGGGGGGAGCAGG - Intronic
1152586953 17:81193459-81193481 GCTGGGGACGTGCCCAGTGGTGG - Intronic
1153377766 18:4400176-4400198 GCTGGGGAGATGGGGAGTGCAGG - Intronic
1156092362 18:33487191-33487213 GCGTGGGACAGGGCGAGTGTGGG + Intergenic
1156350430 18:36297658-36297680 GCGGGGGGCGGGGCGGGGGCGGG - Intergenic
1157327286 18:46678391-46678413 GTCAGGGACGTGGAGAGTGCAGG - Intronic
1160172463 18:76566543-76566565 CCGGAGGACGGGGAGAGTGCTGG + Intergenic
1160675865 19:390944-390966 GCGGGGGCCGGGGCGGGGGCCGG - Intergenic
1161189421 19:2944827-2944849 GGGCGGGACATGGTGAGTGCCGG - Exonic
1161209989 19:3061459-3061481 GCGGGGGACGGGGCGGCTCCGGG - Intronic
1162760416 19:12885529-12885551 GAGGGGGACGTGGCGGGACCGGG + Exonic
1163547382 19:17948232-17948254 GCGGGGGAGGGAGCGAGAGCGGG + Intergenic
1164759811 19:30720201-30720223 GCTGGGGACGCGGCGAGGACAGG + Intergenic
1164769306 19:30795937-30795959 GAGGGGAAGGTGGCCAGTGCAGG - Intergenic
1165422385 19:35728679-35728701 GCGGGTGTCATGGCGAGTTCAGG + Intronic
1165826272 19:38707690-38707712 TCGGGGGAGGTGGCCACTGCAGG - Intronic
1165861616 19:38912071-38912093 GTGCGGGACCTGCCGAGTGCGGG - Intronic
1166720347 19:44992760-44992782 GCGGTGGTCGTGGTGGGTGCAGG - Exonic
1167197963 19:48043841-48043863 GCGGGTGAGGTGGGGAGTGAGGG - Exonic
1167311242 19:48739117-48739139 GCGTGGGAAGCGGCGAGTGGCGG - Exonic
1167517976 19:49934264-49934286 GGGGGGGAGGTGGGGAGGGCCGG + Intronic
927713974 2:25341286-25341308 GCGGGGGAGGGGGCGGGGGCCGG - Intronic
928928013 2:36598015-36598037 GCGGGGGCCGAGGCGGGTGGGGG - Exonic
929452744 2:42047948-42047970 GCGGGGGAGGGGGCGGGGGCGGG + Intergenic
929537406 2:42792407-42792429 GAGGGGGAGGAGGCGAGGGCAGG + Intronic
931994112 2:67823556-67823578 GTGGGAGACATGGAGAGTGCAGG - Intergenic
932213226 2:69948765-69948787 GCGGGGGGCGTGGGCAGAGCGGG - Intergenic
932216188 2:69967490-69967512 GCGGGGGATGTGGATAGTGAAGG + Intergenic
932567270 2:72917821-72917843 GCGGGGGAGGTGAGGGGTGCGGG + Exonic
932611478 2:73203073-73203095 GCGGGGGACTGGGCGGGGGCTGG + Intronic
932790144 2:74648128-74648150 GCGCTGGCCGTGGCGGGTGCCGG - Intronic
939841151 2:147188370-147188392 GCGGGGTACGGGGCGAGGGGAGG + Intergenic
941911759 2:170770984-170771006 GCGGGGGAGGTGGCGGGGGCGGG - Intergenic
1172093807 20:32450993-32451015 GCGGGGGTCAAGGCGAGTGGAGG + Intronic
1173555356 20:43961760-43961782 TCTGGGGACGTGGGGAGTGCCGG + Intronic
1173823056 20:46030926-46030948 GCGGGGGAGGGGGCGGATGCTGG - Intronic
1174339293 20:49886091-49886113 GAGGGGGACGGGGCAGGTGCAGG - Intronic
1176131795 20:63499387-63499409 CCGGGAGACGGGGCGAGAGCCGG + Intergenic
1176215335 20:63945118-63945140 ATGGGGGACGTGGCGAGTTTAGG + Intronic
1179197964 21:39183486-39183508 GCGGAGGGCGTGGCCTGTGCGGG - Exonic
1179565619 21:42246023-42246045 GCGGGGGACATGGTGAGGGAGGG + Intronic
1179629710 21:42668896-42668918 GCGTGGGACGTGGCGGGGGGTGG - Intronic
1180159361 21:45992206-45992228 GCGGGCGACGAGGTGAGTGAGGG + Exonic
1181283510 22:21736088-21736110 GCGCGGGGCGGGGCGAGAGCAGG + Intergenic
1183039317 22:35164732-35164754 CCGGGCGTGGTGGCGAGTGCCGG - Intergenic
1183294212 22:37020049-37020071 GGTGGGGTCGTGGCGAGTGGCGG + Intronic
1184216699 22:43072294-43072316 CCGGGCGTGGTGGCGAGTGCCGG - Intronic
952877515 3:37959015-37959037 CAGGGGGACCTGGTGAGTGCTGG + Intronic
953908745 3:46881701-46881723 GCAGGGGACGAGGCGAGGGTGGG + Intronic
954619061 3:51985477-51985499 GCTGGGGAGGTGGGCAGTGCAGG + Intronic
954717457 3:52533724-52533746 GCGGTGGGCATGGCGGGTGCGGG - Exonic
955228400 3:57079215-57079237 GCGGGGGTCGAGGTGAGTGCGGG - Exonic
955904594 3:63793523-63793545 GAGGGGGTTGTGGGGAGTGCTGG - Intergenic
956667308 3:71654366-71654388 GCGGGGGGCGGGGGGAGTACAGG - Intergenic
968288743 3:197523081-197523103 GCGGGGGCCCTGGGGAGTACAGG + Intronic
968871039 4:3242547-3242569 GCGTGGGACGTGGTCAGGGCAGG + Exonic
968958384 4:3730489-3730511 GCTGGGGGCGTGGGGGGTGCTGG + Intergenic
969714280 4:8860953-8860975 GCGGGGGCGGGGGCGAGGGCGGG + Intronic
971257971 4:25031016-25031038 GCGGGGGAGGGGGCCAGCGCCGG + Intergenic
983889194 4:173013543-173013565 TTGGGGGACGTGGGGGGTGCGGG - Intronic
985542276 5:492549-492571 GCTGGGAACGAGGAGAGTGCAGG + Intronic
985550051 5:528355-528377 GCGGGGGACCTGGCAAGGCCCGG + Intergenic
993457185 5:88140845-88140867 ACGGGGGGCGGGGCGAGTGGTGG - Intergenic
993501573 5:88672868-88672890 GCGGGCGAGGTGAGGAGTGCGGG + Intergenic
996832620 5:127756400-127756422 GCCCGGGAAGTGGGGAGTGCTGG + Intergenic
997560971 5:134846022-134846044 GCGGCGGCCGCGGCGGGTGCTGG + Exonic
1000296299 5:159916301-159916323 GCGGGGGGCGGGGCGGGGGCAGG - Intergenic
1001238058 5:170046339-170046361 GTGGGGGAAGTGGAGAGTGGGGG + Intronic
1001909294 5:175502002-175502024 GCTTGGGAAGTGGGGAGTGCTGG + Intronic
1002913078 6:1505985-1506007 GCGGTGGAACTGGCAAGTGCTGG - Intergenic
1004194244 6:13489008-13489030 GCGGGGCGCGTGGAGAGAGCAGG + Intergenic
1007219851 6:40269836-40269858 GCGGGGGACGTGACAAGGACAGG + Intergenic
1007665414 6:43510387-43510409 GCAGGGGGCGGGGCGAGCGCCGG - Exonic
1015503048 6:133953065-133953087 GCGGGGGACGGGGAAAGTGACGG + Intronic
1019105448 6:169663783-169663805 GGTGGGGACGTGGAGGGTGCTGG + Intronic
1020274371 7:6615697-6615719 GCGGGGGCCGGGGCGGGGGCGGG - Exonic
1022715181 7:32891978-32892000 GAGGGCGGCGTGGCGAGGGCGGG - Intronic
1027421186 7:78019592-78019614 GCGGCGGACGCGGCGCGGGCGGG - Exonic
1029169848 7:98622747-98622769 GCTGGGCACCTGGCGAGGGCTGG - Intronic
1033662061 7:143408891-143408913 GCGGGGGGCGGGGCCAGCGCCGG + Exonic
1034951075 7:155297605-155297627 GCGGGGCGCGTGGCGGCTGCGGG - Intergenic
1035602069 8:902757-902779 GCGGGGGCGGTGGAAAGTGCAGG + Intergenic
1036676701 8:10839867-10839889 GCAGCGGACGGGGCGCGTGCTGG + Exonic
1047259205 8:123241095-123241117 GCGGGGGACGCGGCGGGCGCTGG + Intronic
1048484225 8:134832149-134832171 GCAGGGGGCGCGGCGAGAGCTGG + Intergenic
1049145783 8:141000696-141000718 CTGGGGGACGTGGGGAGTCCGGG - Intronic
1049257444 8:141621427-141621449 GCTGGGGCAGTGGCGAGTCCAGG + Intergenic
1049389480 8:142360606-142360628 GCGGGGGCCCTGGGGAGGGCCGG - Intronic
1053435223 9:38069442-38069464 CCGCGGGAGGTGGCGTGTGCAGG - Intergenic
1057259606 9:93576488-93576510 GCGGGGGACGGGCCGCGCGCGGG - Exonic
1058682378 9:107451237-107451259 GTGGGGGACGTGGTGGGTGGTGG + Intergenic
1059375141 9:113875910-113875932 GCGGGGGGCGCGGGGAGGGCAGG + Intergenic
1059474410 9:114532842-114532864 GCGGGGGGCGGGGGGAGGGCGGG + Intergenic
1060477940 9:123999663-123999685 GCGGGGGCGGCGGCGAGCGCCGG - Intergenic
1061248414 9:129413365-129413387 GCGGGGGGCAGGGCGAGAGCAGG - Intergenic
1062106360 9:134757125-134757147 GCGGGGCATATGGCAAGTGCGGG + Intronic
1062421035 9:136482901-136482923 GCGGGTGAGGGGGCGAGCGCGGG - Intronic
1062421041 9:136482919-136482941 GCGGGTGAGGGGGCGAGCGCGGG - Intronic
1062655916 9:137604759-137604781 GCGGGGGGCGGGGCAGGTGCTGG + Intergenic
1185641980 X:1593393-1593415 GCGGGGGAGGTGGGGGGTGCTGG + Intronic
1187114411 X:16334444-16334466 GCAGGTCACGTGGCGAGAGCAGG + Intergenic
1189677157 X:43473098-43473120 GCGGGGGATGGAGGGAGTGCAGG + Intergenic
1199783301 X:151082596-151082618 GCGGGGCGCGTGGGGAGTGAAGG + Intergenic
1200038267 X:153347068-153347090 GCTGGGAATGTGGCGACTGCGGG + Exonic
1200147788 X:153935317-153935339 GCGGGGGAGGGGGCGGGGGCGGG + Exonic