ID: 1144107236

View in Genome Browser
Species Human (GRCh38)
Location 17:11997267-11997289
Sequence CGCGGGGGACGTGGCGAGTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 140}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144107236_1144107251 28 Left 1144107236 17:11997267-11997289 CCGCACTCGCCACGTCCCCCGCG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1144107251 17:11997318-11997340 CGCTGGCCCCTCCGTAGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 100
1144107236_1144107243 -5 Left 1144107236 17:11997267-11997289 CCGCACTCGCCACGTCCCCCGCG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107236_1144107241 -6 Left 1144107236 17:11997267-11997289 CCGCACTCGCCACGTCCCCCGCG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1144107241 17:11997284-11997306 CCCGCGCGCTCCCAGACGCATGG 0: 1
1: 0
2: 1
3: 9
4: 72
1144107236_1144107245 1 Left 1144107236 17:11997267-11997289 CCGCACTCGCCACGTCCCCCGCG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1144107245 17:11997291-11997313 GCTCCCAGACGCATGGGCAAGGG 0: 1
1: 0
2: 0
3: 7
4: 101
1144107236_1144107248 11 Left 1144107236 17:11997267-11997289 CCGCACTCGCCACGTCCCCCGCG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1144107248 17:11997301-11997323 GCATGGGCAAGGGAGCCCGCTGG 0: 1
1: 0
2: 0
3: 17
4: 221
1144107236_1144107252 29 Left 1144107236 17:11997267-11997289 CCGCACTCGCCACGTCCCCCGCG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1144107252 17:11997319-11997341 GCTGGCCCCTCCGTAGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 194
1144107236_1144107253 30 Left 1144107236 17:11997267-11997289 CCGCACTCGCCACGTCCCCCGCG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1144107253 17:11997320-11997342 CTGGCCCCTCCGTAGCTCCGGGG 0: 1
1: 0
2: 0
3: 9
4: 131
1144107236_1144107244 0 Left 1144107236 17:11997267-11997289 CCGCACTCGCCACGTCCCCCGCG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1144107244 17:11997290-11997312 CGCTCCCAGACGCATGGGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144107236 Original CRISPR CGCGGGGGACGTGGCGAGTG CGG (reversed) Exonic
900284264 1:1891500-1891522 CTCCGGGGACGGGGCGGGTGGGG + Intergenic
900658666 1:3772473-3772495 GGCTGGGGGCGGGGCGAGTGGGG - Intergenic
901199164 1:7457033-7457055 CGCAGGGGGCGGGGCGGGTGAGG - Intronic
901443471 1:9293132-9293154 CGCGGGGGGCCGGGCGAGGGCGG + Intronic
905863896 1:41366529-41366551 CGCGGGGGGTGTGGCGGGGGCGG - Intronic
915935427 1:160087730-160087752 GGCGGGGGAGGGGGCGGGTGGGG + Exonic
916762851 1:167832835-167832857 CACTGGGGAGGGGGCGAGTGTGG - Intronic
918511497 1:185317790-185317812 CGGGGGGGAAGTGGCGGGTGCGG + Intergenic
920309960 1:205043224-205043246 CGCGGCGGCGGTGGCGGGTGAGG - Exonic
920418282 1:205813031-205813053 CGCGGGGGAGGTGGCCGGGGAGG + Exonic
920522247 1:206635976-206635998 CGCGGGGGACGGGGCTAGAGCGG + Intronic
922770908 1:228182550-228182572 CGCTGGGGACGGGGTGTGTGCGG + Intergenic
923141501 1:231163827-231163849 CGCGGGGGCGGGGGCGACTGGGG + Exonic
1063998898 10:11646555-11646577 TGCTGGGGAGGTGGGGAGTGGGG - Intergenic
1065637279 10:27744765-27744787 GGCGGGGGCGTTGGCGAGTGTGG - Intronic
1070767802 10:79066756-79066778 CGTGGGGGACGGGGTGTGTGGGG - Intergenic
1071661276 10:87505170-87505192 AGCGGGTGCCGTGGCGAATGAGG - Exonic
1074169591 10:110919528-110919550 CGGGCGGGGCGGGGCGAGTGGGG + Exonic
1075119109 10:119651509-119651531 CGGGGGTGACGTGGCCAGAGAGG - Exonic
1076749939 10:132537595-132537617 TGCGGGGGGCGTGGCTTGTGCGG - Intergenic
1076985972 11:236353-236375 CGCCGGGGGCGGGGCGAGTCCGG - Exonic
1077254162 11:1573028-1573050 CGGCGGGGACGCGGCGAGTCCGG + Intergenic
1078100991 11:8330216-8330238 CACGAGGGACATGGGGAGTGGGG + Intergenic
1080503576 11:32892538-32892560 CACGCGGGCCGCGGCGAGTGCGG + Intergenic
1083303759 11:61752552-61752574 CGCGGCGGGCGGGGCGCGTGGGG + Intergenic
1084891111 11:72237571-72237593 CCTGGGGGAAGTGGCCAGTGGGG + Exonic
1085737585 11:79052621-79052643 CAGGGGGGATGTGGCGAGGGAGG + Intronic
1090835062 11:130448347-130448369 CGCGGGGGCAGAAGCGAGTGAGG + Intergenic
1091404523 12:200901-200923 TGTGGGGGAGGTGGGGAGTGGGG - Intronic
1091916133 12:4272808-4272830 GGAGGGGGAGGGGGCGAGTGAGG - Intergenic
1096493183 12:52023892-52023914 CGGGGGCGAGGTGACGAGTGTGG - Intronic
1100869404 12:98894891-98894913 CGCGGGGGGCGGGGGCAGTGGGG - Intronic
1101773822 12:107775745-107775767 CGCGGGGGTCCTGGCCAGTTCGG - Exonic
1103925290 12:124420558-124420580 CGCGTGGGGCGTGGGGCGTGGGG - Intronic
1104665796 12:130646446-130646468 AGCGAGGGAGGTGGCGAGGGAGG - Intronic
1104847938 12:131856110-131856132 CCCGGTGGAGGTGGAGAGTGTGG - Intergenic
1104980219 12:132570252-132570274 CGCGGGGGACGGGGCCTGTGTGG + Intronic
1104986651 12:132601234-132601256 CACGGGGGCCGTGCCGAGTAGGG - Intergenic
1105792205 13:23812601-23812623 AGCGAGGGACGGGGAGAGTGAGG - Intronic
1110572976 13:77026701-77026723 CGCGGGGGCCGGGGCGCGCGCGG - Intronic
1113813147 13:113154173-113154195 CGCGGGGGAGGAGGGGCGTGGGG + Intergenic
1113888461 13:113724254-113724276 CGCCGGGCACGTGGCGTGTGAGG - Intronic
1114270524 14:21097996-21098018 CGGGGGGGATGTGGCGGGGGAGG - Intronic
1114474245 14:22982553-22982575 GGCGGGGGCCGGGGAGAGTGGGG - Exonic
1119704665 14:76776301-76776323 GGCGGGGGAGGGGGCGAGGGAGG - Intronic
1126407016 15:48331890-48331912 CGCGGGGGGCGGGGGGGGTGGGG + Intronic
1128230399 15:66030787-66030809 CACGGGGGACGTGGCCTCTGTGG - Intronic
1128425902 15:67542517-67542539 CGCGTGGCGCGTGGCGAGTCGGG - Intergenic
1129694825 15:77734692-77734714 CGCTGGGGCCCTGGGGAGTGTGG - Intronic
1132683820 16:1154066-1154088 GGCGGGGGGCGTGGGGAGGGTGG + Intronic
1132724651 16:1333542-1333564 CGCGGGGGGCGGGGCGAGCGCGG + Intergenic
1132875702 16:2135939-2135961 CGGGGCGGACGGGGCGAGGGGGG + Intergenic
1132929398 16:2451225-2451247 CGCGGGGCAGGTGGCGCGGGCGG + Intronic
1140097074 16:71884210-71884232 CGCGGGGGAGGGGGAGAGGGAGG - Intronic
1142196753 16:88742580-88742602 CTCGGGAGGCGTGGGGAGTGGGG - Intronic
1142198579 16:88750454-88750476 TGTGGGGGCTGTGGCGAGTGCGG - Intronic
1142199741 16:88755451-88755473 GGCTGGGAACGTGGCGGGTGGGG - Intronic
1142216366 16:88831906-88831928 CATGGGGGAGGTGGCCAGTGAGG + Intronic
1142586997 17:979911-979933 CGGAGGGGGCGTGGCGAGGGCGG - Intergenic
1142623754 17:1179987-1180009 CGCGGGGGGCGGGGCGGGGGTGG + Intronic
1143016433 17:3893246-3893268 CGCCGGGGGCGTGGCGAGGTCGG - Intronic
1144107236 17:11997267-11997289 CGCGGGGGACGTGGCGAGTGCGG - Exonic
1144269517 17:13602337-13602359 CGCGGGGAACCTGGAGAGGGAGG - Intergenic
1147469677 17:40647821-40647843 CGCGAGGGGCGGGGCGAGCGCGG - Exonic
1147610974 17:41801641-41801663 CTCGGGGAATGTGGCAAGTGTGG - Intergenic
1148578630 17:48728261-48728283 CGCGGGGTACGCGGCCAGGGTGG + Exonic
1149496463 17:57121387-57121409 CGGGGGGGGGGTGGTGAGTGTGG + Intergenic
1149993674 17:61396336-61396358 GGCGGGGGACGCGGGGAGAGCGG - Intergenic
1151679497 17:75616003-75616025 CCCGAGGGGTGTGGCGAGTGTGG + Intergenic
1152721010 17:81923836-81923858 CACGGGGGACCTGGCCAGAGAGG + Intronic
1153040902 18:812307-812329 GGCGGAGGAGGTGGAGAGTGAGG - Intronic
1153812315 18:8762850-8762872 CACGGGGAAAGGGGCGAGTGTGG + Intronic
1156092361 18:33487190-33487212 AGCGTGGGACAGGGCGAGTGTGG + Intergenic
1156350431 18:36297659-36297681 CGCGGGGGGCGGGGCGGGGGCGG - Intergenic
1160234413 18:77074593-77074615 CTCGGGGAACATGGCGAGAGTGG + Intronic
1161299511 19:3536025-3536047 CGGTGGGGACGTGGAGAGGGTGG + Intronic
1163241697 19:16067589-16067611 CGTGGGGGACGTGGGGTGCGCGG - Exonic
1163760580 19:19134228-19134250 AGTGAGGGACGTGGGGAGTGTGG + Intronic
1167002861 19:46756187-46756209 CGCGTGGGCCGTGGCCAGCGGGG - Exonic
1167197964 19:48043842-48043864 AGCGGGTGAGGTGGGGAGTGAGG - Exonic
1167613357 19:50517789-50517811 CGCGGCCGCCGTGGCCAGTGGGG - Exonic
1168343804 19:55641044-55641066 CGCCGGGGACGCGGGGACTGGGG - Intronic
925288631 2:2731621-2731643 CGTGGGGGGCGTGGTGGGTGGGG - Intergenic
926062619 2:9813687-9813709 CCTGGGTGCCGTGGCGAGTGGGG + Intergenic
926095714 2:10079896-10079918 CGCGGGGAGCGCGGTGAGTGTGG - Exonic
928928014 2:36598016-36598038 GGCGGGGGCCGAGGCGGGTGGGG - Exonic
934763613 2:96869060-96869082 CGCGGGGAGCGTGGCGAGCCCGG + Intronic
941911760 2:170770985-170771007 GGCGGGGGAGGTGGCGGGGGCGG - Intergenic
942116788 2:172735897-172735919 CGCGGCGGACGAGGCGGGGGCGG + Exonic
946277659 2:218643346-218643368 AGGGGGGGACGTGGCGGGGGAGG - Exonic
946322030 2:218959910-218959932 CGCGGGGGACGAGGCGCTGGGGG + Exonic
948712433 2:239833432-239833454 CACGGGGGACATGGAGAATGGGG + Intergenic
948991828 2:241559394-241559416 CGCGGGGAACGGGGCGCGCGGGG - Intronic
1169191393 20:3660907-3660929 CGGCGGGGCCGTGGCGAGGGTGG - Exonic
1176234833 20:64049376-64049398 CGCGGCGGGCGCGGCGAGGGCGG + Exonic
1179197965 21:39183487-39183509 CGCGGAGGGCGTGGCCTGTGCGG - Exonic
1179565618 21:42246022-42246044 GGCGGGGGACATGGTGAGGGAGG + Intronic
1179659117 21:42863366-42863388 CATGGGGGACGTGGCACGTGGGG - Intronic
1179910961 21:44448683-44448705 CGCGGGGGGCGTGCCGTGAGAGG + Intergenic
1180159360 21:45992205-45992227 GGCGGGCGACGAGGTGAGTGAGG + Exonic
1180211022 21:46295568-46295590 CCAGGGGGACATGGCGACTGTGG + Intronic
1184841451 22:47054719-47054741 CGCCTGGGAGGTGGCCAGTGAGG + Intronic
953908744 3:46881700-46881722 GGCAGGGGACGAGGCGAGGGTGG + Intronic
954577779 3:51686270-51686292 CGCAGAGGGCGTGGCCAGTGTGG + Intronic
954717458 3:52533725-52533747 CGCGGTGGGCATGGCGGGTGCGG - Exonic
955228401 3:57079216-57079238 CGCGGGGGTCGAGGTGAGTGCGG - Exonic
958432920 3:94063191-94063213 CGCGGCCGAGGTGGCGAGGGAGG + Exonic
968460583 4:722937-722959 GGCGGGCGATGTCGCGAGTGTGG - Intronic
985462794 4:190122320-190122342 CGCGGGGGACATCGCGAAGGTGG + Intergenic
985511906 5:318091-318113 CGGGGGGGAGGTGGAGGGTGAGG - Intronic
985782938 5:1880496-1880518 CGTGGGGGACGGGGAGACTGGGG + Intronic
994353870 5:98774006-98774028 CGCGGGCGCCGTGGCGGGTCTGG - Exonic
999279791 5:150357678-150357700 CGCGAGGGAAGTGGCGGGCGGGG + Exonic
1001238057 5:170046338-170046360 GGTGGGGGAAGTGGAGAGTGGGG + Intronic
1002399703 5:178984761-178984783 CCCGAGGCACGTGGCGTGTGTGG + Intronic
1002569385 5:180131371-180131393 TGCCGGGGACATGGGGAGTGGGG - Intronic
1005513524 6:26533181-26533203 CGTGGGGGAGGTGGGGGGTGAGG + Intergenic
1006295788 6:33169462-33169484 CGCGGGGAACGTGGAGAGAAAGG - Exonic
1007251816 6:40500315-40500337 CACAGGGGACGTGGAGGGTGAGG + Intronic
1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG + Intergenic
1011274311 6:85614964-85614986 CGCGGGGTACGTGGTGCGAGGGG - Exonic
1013211488 6:107990853-107990875 CGGGGGGGCCATCGCGAGTGTGG - Intergenic
1019052606 6:169194746-169194768 CTAGGGGGAGGTGGAGAGTGAGG - Intergenic
1019475110 7:1240660-1240682 GGCGGGGGCTGTGGGGAGTGGGG + Intergenic
1020012662 7:4815246-4815268 CGCATGGGAGGCGGCGAGTGTGG - Intronic
1020254684 7:6496513-6496535 CAAGGGGGATGTGGCTAGTGGGG - Intergenic
1020274372 7:6615698-6615720 CGCGGGGGCCGGGGCGGGGGCGG - Exonic
1021313268 7:19117483-19117505 CGCGGGGGAGGCGGGGAGGGAGG + Exonic
1026786303 7:73303791-73303813 CGCCAGGGTCGTGGGGAGTGGGG - Intronic
1027421187 7:78019593-78019615 CGCGGCGGACGCGGCGCGGGCGG - Exonic
1028496184 7:91463537-91463559 CGCGGATCCCGTGGCGAGTGTGG + Intergenic
1031986545 7:128167696-128167718 CGCCGGCGAGGTGGCGAGGGCGG + Intergenic
1033120864 7:138665112-138665134 CCCTAGGGAGGTGGCGAGTGGGG - Intronic
1038319482 8:26514105-26514127 CGCGGGGGGCGTGGGCAGGGAGG + Intergenic
1041910673 8:63085759-63085781 GGCGGGGGACGGGGCGGGTGAGG + Intronic
1042903104 8:73747224-73747246 CGCCGGGGACGAGGAGACTGCGG - Intronic
1048330988 8:133470741-133470763 GGCTGGGGGCGAGGCGAGTGAGG + Intronic
1051202208 9:14639372-14639394 AGCGGGGGACGAAGAGAGTGTGG + Intronic
1051419021 9:16871625-16871647 CGCTGGGGAGAAGGCGAGTGAGG + Intergenic
1056710901 9:88991344-88991366 GGCGGGGGACGGGGAGAGGGGGG + Intronic
1057259607 9:93576489-93576511 CGCGGGGGACGGGCCGCGCGCGG - Exonic
1057490632 9:95517031-95517053 CGCGGGGGGCGGGGAGAGGGTGG - Intronic
1059427129 9:114228145-114228167 CGAGTGGGACCTGGGGAGTGGGG + Intronic
1060208984 9:121699093-121699115 CGGGGGCGACGTGGCGGGCGGGG + Intronic
1061868501 9:133507579-133507601 CGCGGGGGATTGGGGGAGTGAGG - Intergenic
1062421036 9:136482902-136482924 CGCGGGTGAGGGGGCGAGCGCGG - Intronic
1062421042 9:136482920-136482942 CGCGGGTGAGGGGGCGAGCGCGG - Intronic
1187600434 X:20823502-20823524 CGGGGGGGAGGGGGGGAGTGGGG + Intergenic
1189821632 X:44874036-44874058 CGCGGGGCCCGGGGCGAGCGCGG - Intronic