ID: 1144107243

View in Genome Browser
Species Human (GRCh38)
Location 17:11997285-11997307
Sequence CCGCGCGCTCCCAGACGCAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 30}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144107230_1144107243 12 Left 1144107230 17:11997250-11997272 CCATGGCTGCCCCGGCCCCGCAC 0: 1
1: 0
2: 3
3: 49
4: 524
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107223_1144107243 30 Left 1144107223 17:11997232-11997254 CCCACGGTCCACTCCCAGCCATG 0: 1
1: 0
2: 0
3: 21
4: 150
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107228_1144107243 17 Left 1144107228 17:11997245-11997267 CCCAGCCATGGCTGCCCCGGCCC 0: 1
1: 0
2: 5
3: 53
4: 383
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107233_1144107243 1 Left 1144107233 17:11997261-11997283 CCGGCCCCGCACTCGCCACGTCC 0: 1
1: 0
2: 2
3: 23
4: 300
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107236_1144107243 -5 Left 1144107236 17:11997267-11997289 CCGCACTCGCCACGTCCCCCGCG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107224_1144107243 29 Left 1144107224 17:11997233-11997255 CCACGGTCCACTCCCAGCCATGG 0: 1
1: 0
2: 3
3: 21
4: 232
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107229_1144107243 16 Left 1144107229 17:11997246-11997268 CCAGCCATGGCTGCCCCGGCCCC 0: 1
1: 0
2: 3
3: 68
4: 608
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107234_1144107243 -3 Left 1144107234 17:11997265-11997287 CCCCGCACTCGCCACGTCCCCCG 0: 1
1: 0
2: 1
3: 7
4: 151
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107235_1144107243 -4 Left 1144107235 17:11997266-11997288 CCCGCACTCGCCACGTCCCCCGC 0: 1
1: 0
2: 1
3: 11
4: 183
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107226_1144107243 22 Left 1144107226 17:11997240-11997262 CCACTCCCAGCCATGGCTGCCCC 0: 1
1: 0
2: 9
3: 96
4: 747
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107231_1144107243 3 Left 1144107231 17:11997259-11997281 CCCCGGCCCCGCACTCGCCACGT 0: 1
1: 0
2: 1
3: 10
4: 209
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107232_1144107243 2 Left 1144107232 17:11997260-11997282 CCCGGCCCCGCACTCGCCACGTC 0: 1
1: 0
2: 0
3: 46
4: 203
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144107243 Original CRISPR CCGCGCGCTCCCAGACGCAT GGG Exonic
908555591 1:65254320-65254342 CCGCGCGCACCCGCACGCCTCGG + Intronic
1074864532 10:117537149-117537171 CCGCGCGCTCCGAGAGGAATGGG + Intergenic
1076863728 10:133157046-133157068 CCGTCTGCTCCCAGCCGCATTGG + Intergenic
1077492821 11:2870006-2870028 CCGCGCGCTCCCTCCCGCCTGGG + Intergenic
1092187837 12:6493983-6494005 CCGCGCGTTGCCAGACTCAGAGG + Exonic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1104942065 12:132399822-132399844 CCGCGGGCTCCCGGACGCCTGGG + Intergenic
1110706261 13:78603706-78603728 GCGCGCGCGCGCAGACGCACGGG - Intergenic
1113866870 13:113532293-113532315 CCGTGAGCCCCCAGACGCACAGG + Intronic
1119643811 14:76334450-76334472 CCTCGCGCTCACAGCCGCCTGGG + Intronic
1121731889 14:96193077-96193099 CAGCCAGCTCCCAGATGCATTGG + Intergenic
1135047778 16:19168714-19168736 CCGCGCGCTCCCAGCCGGAGGGG - Intronic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1162962597 19:14136701-14136723 CGGCGCGCGCCCAGACTCCTCGG + Exonic
932256655 2:70293660-70293682 CCGCGGGCTCACAGATGCCTTGG + Exonic
1171123624 20:22584584-22584606 CCGCGCGCTTCCCGCCGCCTCGG - Intronic
1174298827 20:49567958-49567980 CCGCGGGCTCCGAGACCCTTGGG + Intronic
1175283629 20:57821638-57821660 CCGCGAGCTCCCAGGTGAATGGG - Intergenic
950662721 3:14476707-14476729 CCGAGCCCTGCCAGACACATTGG - Intronic
960960516 3:123067398-123067420 CCAAGCGCTCCCGGACGCAGGGG + Intronic
961389152 3:126542182-126542204 GCGCGCGCTCCCCGACGCCCGGG + Exonic
962267653 3:133955150-133955172 CCGAGCTCTGCCAGAAGCATTGG - Exonic
998335893 5:141371902-141371924 CCGCGCGCTCACGGACACGTAGG - Exonic
1002898834 6:1393994-1394016 CCTCGCGCTGCCAGATGCTTCGG + Intronic
1004174552 6:13328465-13328487 CCGCGCGCGCCCAGACGGCCCGG + Intronic
1018794805 6:167177477-167177499 CTGCGAGCCCCCAGACGCACGGG - Intronic
1018821513 6:167377590-167377612 CTGCGAGCCCCCAGACGCACGGG + Intronic
1024808467 7:53178452-53178474 ACGCGGGCTTCCAGATGCATTGG - Intergenic
1038644332 8:29350291-29350313 CCTCGCGCGCCCAGCCGCCTCGG - Exonic
1043529639 8:81135225-81135247 CCAGGTGCACCCAGACGCATGGG - Intergenic
1044569404 8:93700575-93700597 CAGCGCGCGCCCAGGCGCCTTGG + Exonic
1048205959 8:132415419-132415441 CAGAGAGCTCCCAGACTCATGGG - Intronic
1053358241 9:37465118-37465140 CTGCGCGCTCCCCGACGCCTTGG + Intronic
1057869922 9:98709401-98709423 CCGCGCGCTGGCACACGCAGTGG + Intergenic
1062677755 9:137757812-137757834 CCGCACCCACCCAGACGCACAGG - Intronic