ID: 1144107243

View in Genome Browser
Species Human (GRCh38)
Location 17:11997285-11997307
Sequence CCGCGCGCTCCCAGACGCAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 30}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144107233_1144107243 1 Left 1144107233 17:11997261-11997283 CCGGCCCCGCACTCGCCACGTCC 0: 1
1: 0
2: 2
3: 23
4: 300
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107224_1144107243 29 Left 1144107224 17:11997233-11997255 CCACGGTCCACTCCCAGCCATGG 0: 1
1: 0
2: 3
3: 21
4: 232
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107228_1144107243 17 Left 1144107228 17:11997245-11997267 CCCAGCCATGGCTGCCCCGGCCC 0: 1
1: 0
2: 5
3: 53
4: 383
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107236_1144107243 -5 Left 1144107236 17:11997267-11997289 CCGCACTCGCCACGTCCCCCGCG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107234_1144107243 -3 Left 1144107234 17:11997265-11997287 CCCCGCACTCGCCACGTCCCCCG 0: 1
1: 0
2: 1
3: 7
4: 151
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107232_1144107243 2 Left 1144107232 17:11997260-11997282 CCCGGCCCCGCACTCGCCACGTC 0: 1
1: 0
2: 0
3: 46
4: 203
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107230_1144107243 12 Left 1144107230 17:11997250-11997272 CCATGGCTGCCCCGGCCCCGCAC 0: 1
1: 0
2: 3
3: 49
4: 524
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107223_1144107243 30 Left 1144107223 17:11997232-11997254 CCCACGGTCCACTCCCAGCCATG 0: 1
1: 0
2: 0
3: 21
4: 150
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107235_1144107243 -4 Left 1144107235 17:11997266-11997288 CCCGCACTCGCCACGTCCCCCGC 0: 1
1: 0
2: 1
3: 11
4: 183
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107226_1144107243 22 Left 1144107226 17:11997240-11997262 CCACTCCCAGCCATGGCTGCCCC 0: 1
1: 0
2: 9
3: 96
4: 747
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107229_1144107243 16 Left 1144107229 17:11997246-11997268 CCAGCCATGGCTGCCCCGGCCCC 0: 1
1: 0
2: 3
3: 68
4: 608
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30
1144107231_1144107243 3 Left 1144107231 17:11997259-11997281 CCCCGGCCCCGCACTCGCCACGT 0: 1
1: 0
2: 1
3: 10
4: 209
Right 1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144107243 Original CRISPR CCGCGCGCTCCCAGACGCAT GGG Exonic