ID: 1144109808

View in Genome Browser
Species Human (GRCh38)
Location 17:12020904-12020926
Sequence GAGCGGCGGCGGCGGCTCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1052
Summary {0: 1, 1: 5, 2: 29, 3: 166, 4: 851}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144109797_1144109808 1 Complete closest: 1
total_pairs: 26
max_distance: 1000
Left 1144109797 17:12020880-12020902 CCCAACAATGGCGGCTCCGAGCC 0: 1
1: 0
2: 1
3: 4
4: 34
Right 1144109808 17:12020904-12020926 GAGCGGCGGCGGCGGCTCCGGGG 0: 1
1: 5
2: 29
3: 166
4: 851
1144109793_1144109808 26 Complete closest: 26
total_pairs: 27
max_distance: 1000
Left 1144109793 17:12020855-12020877 CCGCGGCGCCGCTCGGCTCTTCA 0: 1
1: 0
2: 1
3: 1
4: 51
Right 1144109808 17:12020904-12020926 GAGCGGCGGCGGCGGCTCCGGGG 0: 1
1: 5
2: 29
3: 166
4: 851
1144109792_1144109808 29 Complete closest: 29
total_pairs: 32
max_distance: 1000
Left 1144109792 17:12020852-12020874 CCGCCGCGGCGCCGCTCGGCTCT 0: 1
1: 0
2: 0
3: 14
4: 142
Right 1144109808 17:12020904-12020926 GAGCGGCGGCGGCGGCTCCGGGG 0: 1
1: 5
2: 29
3: 166
4: 851
1144109794_1144109808 18 Complete closest: 36
total_pairs: 25
max_distance: 1000
Left 1144109794 17:12020863-12020885 CCGCTCGGCTCTTCACTCCCAAC 0: 1
1: 0
2: 2
3: 17
4: 167
Right 1144109808 17:12020904-12020926 GAGCGGCGGCGGCGGCTCCGGGG 0: 1
1: 5
2: 29
3: 166
4: 851
1144109798_1144109808 0 Complete closest: 0
total_pairs: 28
max_distance: 1000
Left 1144109798 17:12020881-12020903 CCAACAATGGCGGCTCCGAGCCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1144109808 17:12020904-12020926 GAGCGGCGGCGGCGGCTCCGGGG 0: 1
1: 5
2: 29
3: 166
4: 851

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144109808 Original CRISPR GAGCGGCGGCGGCGGCTCCG GGG Exonic
900091953 1:924508-924530 CAGCGGCGGCAGCGGCAGCGCGG - Intergenic
900092190 1:925330-925352 GCGCGGCGGGGGAGGCTGCGGGG + Intronic
900100899 1:961567-961589 GGGCGGCGCTGGGGGCTCCGTGG + Intronic
900119106 1:1041039-1041061 GAGCGGGGGCGGGGCCTGCGGGG + Intronic
900171994 1:1273798-1273820 AGGCGGCGGCGGCGGCGCTGCGG - Exonic
900227633 1:1540450-1540472 GAGCGGCGGCGGACGATCCAGGG - Intronic
900269174 1:1778424-1778446 GCTCGGCGGCGCCGGCGCCGGGG - Intronic
900325884 1:2108440-2108462 GTGGGGCCGTGGCGGCTCCGAGG + Intronic
900507735 1:3038150-3038172 GAGCAGCGGCAGAGGTTCCGAGG + Intergenic
900578039 1:3393999-3394021 CCGCGGCGGCGGCGGCTCCAGGG + Intronic
900654170 1:3746985-3747007 GAGGGGCGGCGGATGCTCGGAGG + Intergenic
900786760 1:4654631-4654653 GAGCAGCGCGGGCGGCTCTGCGG + Intergenic
901022175 1:6261032-6261054 CGGCGGCGGCGGCGGCGCCTAGG - Intergenic
901056021 1:6448951-6448973 GGGCGGCGGTGGCAGCTCCCTGG - Exonic
901066614 1:6497394-6497416 GTCCGGCGGCGGCGGCTCTGCGG - Intronic
901279933 1:8026162-8026184 GAGGAGCGGCGGCTGCCCCGCGG + Exonic
901443430 1:9293044-9293066 CAGCGGCGGCGGCGGCACCCCGG + Exonic
901443648 1:9293622-9293644 GAGAAGCCGCGGCGGCTCCGGGG - Intronic
901641334 1:10694583-10694605 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
901673039 1:10867101-10867123 GAGCGGCTGCGGGGGCGGCGGGG - Intergenic
902286200 1:15410066-15410088 GGGCAGCGGCGGCGGCGGCGGGG + Exonic
902475759 1:16686108-16686130 CCGCGGCGGCTGCTGCTCCGAGG + Intergenic
902950984 1:19882642-19882664 TGGCGGCGGCGGCGGCTGCGAGG + Exonic
902951016 1:19882749-19882771 GAGCGAGGGAGGCGGCGCCGGGG + Intronic
903055495 1:20633505-20633527 TGGCGGCAGCGGCGGCTGCGGGG + Exonic
903132731 1:21290232-21290254 GCGCGGCGGCGGCGGCGCCAGGG - Intronic
903174919 1:21575043-21575065 AAGCGGGGGCGGAGGCTGCGAGG + Intronic
903724550 1:25431053-25431075 GAGAGACGGCGGCGGCGGCGCGG + Exonic
903822117 1:26111183-26111205 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
903828649 1:26161963-26161985 GGGCGGCGGCGGCGGCTCGGAGG + Exonic
903907431 1:26696588-26696610 CAGCGGCTGCGGCGGCCCCACGG - Exonic
903907539 1:26696958-26696980 GAGCGGCGGCGGCGGGGGCCTGG + Exonic
904215398 1:28914774-28914796 GCGAGGCGGCGGCGGCGGCGCGG + Intronic
904652235 1:32014174-32014196 CAGCAGCGGTGGCGGCTGCGTGG - Exonic
904822955 1:33256831-33256853 CGGCGGCGGCGGCGGCAGCGGGG + Intronic
905137076 1:35808176-35808198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905137124 1:35808343-35808365 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905414381 1:37794388-37794410 GCGGGGCGGCGGCGGCGGCGGGG - Exonic
905648289 1:39639713-39639735 GGGCGGTGGCGGCGCCCCCGAGG - Exonic
905884122 1:41482538-41482560 GAGCGGCGCCGGCGTCTTGGCGG + Exonic
905947767 1:41918106-41918128 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
906027224 1:42683239-42683261 CGGCGGCGGCGGCGACTGCGTGG + Intronic
906637078 1:47416845-47416867 GAGCGGCGGCCCTGGCGCCGCGG - Exonic
907118657 1:51990405-51990427 GAGCGAGGGAGGGGGCTCCGCGG - Intronic
907278088 1:53327951-53327973 GAGACGCGGCGGCGGCGGCGCGG - Exonic
907278105 1:53328015-53328037 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
907341539 1:53739168-53739190 CGGCGGCTGCGGCGGCTGCGGGG - Intergenic
907429960 1:54406034-54406056 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
907689179 1:56645328-56645350 CGGCGGCGGCGGCGGCTACGCGG + Exonic
908128184 1:61050653-61050675 GCGGGGCCGCGGCGGCTCCAAGG - Intronic
908355845 1:63324099-63324121 CAGCGGCCGCGGCGGCGCCCAGG - Exonic
908401219 1:63774378-63774400 CGGCGGCGGCGGCGGCTCCCAGG - Exonic
909001429 1:70221714-70221736 CGGCGGAGGCGGCGGCACCGAGG + Exonic
910758984 1:90717498-90717520 GCGCGGCGGTGGCGGCGCGGAGG + Intergenic
910787999 1:91021664-91021686 GAGCGGCGGCCGCCGCCGCGGGG - Intronic
911498897 1:98661916-98661938 GGGCGGCGGCGGCGAGTCCCGGG + Intronic
911696427 1:100895184-100895206 GAGCGGCGGCCGTTGCCCCGGGG + Exonic
912955576 1:114152703-114152725 GCGCAGCTGCGGCGTCTCCGGGG - Exonic
912993490 1:114511122-114511144 GGGCGGCGGCGGCGGCGACGCGG - Exonic
913109093 1:115641971-115641993 GTGCAGCGGCGGCGGCGGCGGGG + Exonic
913250633 1:116909955-116909977 GATCGGCGGGGCCGGCTCCCGGG + Intergenic
913518263 1:119623290-119623312 GCGCGGGGGCGGCGGCGCTGCGG - Exonic
913615722 1:120558177-120558199 CGGCGGCGGCGGCGGCTACTGGG + Intergenic
914574554 1:148952725-148952747 CGGCGGCGGCGGCGGCTACTGGG - Intronic
915070317 1:153261057-153261079 CTTCGGCGGCGGCGGCTCAGGGG + Exonic
915070518 1:153261786-153261808 CGGCGGCGGCGGCTCCTCCGTGG + Exonic
915325324 1:155078919-155078941 CGGCGGCGGCGGCGGCTCCGGGG + Exonic
916535359 1:165698559-165698581 GAGTGGCGGACGCAGCTCCGCGG + Exonic
916651668 1:166839617-166839639 GGGCGGGGGCGGCGGCGGCGCGG + Intronic
916890259 1:169106618-169106640 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
917291616 1:173477260-173477282 GGGCGGCGGGGGCGGGGCCGCGG - Exonic
917438632 1:175045745-175045767 GCCCGGCAGCGGCGGCTCCATGG + Intergenic
917817503 1:178725501-178725523 GAATGGCGGCGGCGGCGCTGCGG + Intronic
918066450 1:181105148-181105170 GAGGGCTGGGGGCGGCTCCGCGG + Intergenic
919712098 1:200738942-200738964 CGGCGGCGGCGGCGGCTGAGGGG + Intergenic
919847015 1:201648713-201648735 GAGCAGCGGCGGCGGCGACGAGG + Exonic
919892005 1:201982583-201982605 GCGCGGCGGGGGCGGGCCCGCGG + Intronic
920184524 1:204151870-204151892 TAGCGTCTGCCGCGGCTCCGAGG - Exonic
920528483 1:206685276-206685298 GGGCTGCGGCGGCGGGGCCGGGG - Exonic
920528505 1:206685321-206685343 CGGCGGCGGCGGCTGCGCCGGGG - Exonic
921023672 1:211259127-211259149 GAGCGGCGGCCACGCCTCGGTGG + Intronic
921217705 1:212951363-212951385 GAGCGGCGGCGGGAGCTCCGCGG - Exonic
921707983 1:218345849-218345871 AAGCGGCGGCGGCAGCAACGTGG + Intergenic
922287546 1:224183250-224183272 CGGCGGCGGCGGCGGCTCCCCGG - Exonic
922730728 1:227947738-227947760 GGGCGGGGGCGGCGGGGCCGGGG - Intronic
922762553 1:228141762-228141784 GATCTGCGCCGGCGGCTCCCAGG + Intronic
922958619 1:229626014-229626036 GAGCGGCGGCGGGGGCGGCGGGG - Exonic
923478193 1:234356999-234357021 CAGCGGCGGCGGCTGAACCGGGG - Intergenic
924754779 1:246931477-246931499 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1062774568 10:135096-135118 GAGCGGCTGCCGCGGCTTCGCGG + Intronic
1062982534 10:1737212-1737234 CAGCGGCGGCGGCGGCTGCCGGG - Exonic
1063418239 10:5890304-5890326 GCCCGGCGGCGGCGGCAGCGGGG + Intronic
1064208973 10:13347779-13347801 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1064209080 10:13348113-13348135 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1064231050 10:13529226-13529248 GGGCGGCGGCGTCGTCCCCGGGG - Intergenic
1064244270 10:13656918-13656940 GCGCGGCGGCGGCGGCGACGAGG - Exonic
1064981954 10:21174162-21174184 GCGCGGCGGCGGCGGCGAGGCGG - Intronic
1065023159 10:21517135-21517157 CGGCGGCGGCGGCGGCTGCCGGG + Exonic
1065140529 10:22714650-22714672 GGGAGGCGGCTGCGGCGCCGCGG + Intergenic
1065188870 10:23192958-23192980 GAGCGGCGGCTGCGGCGGCGCGG + Exonic
1065214899 10:23439571-23439593 GCGCGGCGCCGGCGGCTCCCGGG - Exonic
1065390187 10:25175067-25175089 GAGCGGCGGTGGCGGCAGCCGGG + Exonic
1065520569 10:26567283-26567305 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1065660282 10:27998925-27998947 AGGCGGCGGCGGCGGCGCCCGGG - Intronic
1066080710 10:31928530-31928552 CGGCGGCGGCGGCGGCGCCGCGG - Intronic
1066094075 10:32056206-32056228 CGGCAGCGGCGGCGGCACCGGGG + Exonic
1066429338 10:35336877-35336899 CAGCAGCGGCGGCGGCGGCGGGG - Exonic
1067024988 10:42836937-42836959 CAGCGGCGGGCGCGGGTCCGAGG - Intergenic
1067111871 10:43407220-43407242 GGGCGGCGGCGGCGGCTTCCCGG - Intronic
1068690161 10:59906310-59906332 GGGCGGCGGCGGTGGCGGCGGGG - Exonic
1069386174 10:67884927-67884949 GTGCGGCGGCGGCGGCGCTGTGG + Exonic
1069698329 10:70404224-70404246 CGGCGGCGGCGGCGGCTGAGAGG + Intergenic
1069698350 10:70404342-70404364 AGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1070328333 10:75401880-75401902 CAGCGGCGGCGGCGGCGGCGCGG - Exonic
1070592715 10:77812010-77812032 GAGCCGCGCCTGCTGCTCCGTGG + Exonic
1070768350 10:79069023-79069045 GAGCGGCGGCGGCGGGCGCCGGG + Exonic
1070800831 10:79243557-79243579 CGGCGGCGGCGGCGGCGCGGGGG - Intronic
1072454105 10:95561261-95561283 GCTCGGCGGCGGCAGCGCCGGGG - Intronic
1072673149 10:97446295-97446317 GAGCGGCGGCAGAGGCTACGGGG + Exonic
1073122596 10:101131709-101131731 TTACGGCGGCGGGGGCTCCGCGG + Exonic
1073289325 10:102405568-102405590 AAGCGGGGGCCGCGGCTCCATGG - Intronic
1074169677 10:110919819-110919841 CGGCGGCGGCGGCGCCTCCCAGG - Intronic
1074829912 10:117241093-117241115 GAGCGGCGGCGGCGGGGCGCTGG + Exonic
1074843284 10:117375437-117375459 GTGTGGCGGCGGCGGCAGCGGGG + Exonic
1075031830 10:119029401-119029423 GAGCGGCGCCCGAGGCGCCGGGG + Intergenic
1075430325 10:122374867-122374889 GCGAGGTGGCGGCGGCTGCGGGG + Intronic
1075587156 10:123666311-123666333 GCCGGGCGGCGGCGGCGCCGAGG + Intergenic
1075697479 10:124447611-124447633 CGGCGGCGGCGGCGGCTCGGGGG - Exonic
1075697482 10:124447614-124447636 GGGCGGCGGCGGCGGCGGCTCGG - Exonic
1076372495 10:129964388-129964410 GCGCGGCGGCGGCGGCGGCGAGG - Intergenic
1076722093 10:132397176-132397198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1076792883 10:132786114-132786136 CGGCGGCGGCGGCGGCTCCGGGG + Intergenic
1076890704 10:133281834-133281856 GCCCTGCGGCGCCGGCTCCGGGG - Intronic
1077008068 11:368564-368586 GAGTGGTGGGGCCGGCTCCGCGG - Intergenic
1077360645 11:2138967-2138989 GACAGGCGGTGGCGGCACCGGGG + Intronic
1077492759 11:2869786-2869808 CAGCGGCGGGGCCGGCTCTGCGG + Intergenic
1077923104 11:6655883-6655905 GGGCGGGGGCGGGGGCTCCGCGG - Intergenic
1078190834 11:9091567-9091589 GGGCGGTGGCGGCGGCGGCGCGG + Exonic
1078210289 11:9265045-9265067 GAGTGGCGGCGGCGGCGGAGGGG - Exonic
1079689401 11:23403531-23403553 CGGCGGCGGCGGCGGCGCGGGGG - Intergenic
1079689404 11:23403534-23403556 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1080034872 11:27700414-27700436 GCGCGGCGGCGGCAGCGTCGGGG + Intronic
1081870728 11:46381555-46381577 GAGCGGGGGCGGGGACGCCGGGG + Intronic
1082280613 11:50267858-50267880 GGGCGGCGGTGGCGGCTCCCGGG + Intergenic
1082787507 11:57324889-57324911 TAGCAGCGGCGGCGGCGGCGGGG - Intronic
1083342433 11:61967448-61967470 CGGCGGCGGCGGTGGCTGCGCGG + Exonic
1083342443 11:61967476-61967498 GAGCGGCGGCGGGGGCCTTGGGG + Exonic
1083448461 11:62726818-62726840 GGGCTCCGGCGGCGGCTGCGCGG + Exonic
1083448563 11:62727220-62727242 CGGCGGCGGCGGCGCCTGCGCGG - Exonic
1083623651 11:64060936-64060958 CCGCGGCGGCGGCGGCGGCGGGG + Intronic
1083657693 11:64237570-64237592 CAGCGGCAGCGGCAGGTCCGGGG - Exonic
1083659810 11:64246791-64246813 GGGCGGCGGCGGGGGCGCCCGGG + Exonic
1083779403 11:64910179-64910201 GAGCGCCGGGGTCGGCTCTGAGG + Exonic
1083952020 11:65961854-65961876 GTGCCGCGGCGGCTGCTCGGTGG - Exonic
1084053480 11:66616363-66616385 GAGCGGCGCCGGCGGCAGAGAGG - Intergenic
1084146146 11:67266409-67266431 CGGAGGCGGCGGCGGCTCCGGGG + Exonic
1084151355 11:67289317-67289339 CGGCGGCGGCGGCGGCAGCGCGG - Exonic
1084174327 11:67415740-67415762 TGGCGGCGGCAGCGGCTCGGCGG - Intronic
1084265678 11:68004023-68004045 GAGCGGCGGCTCCGCCTCCATGG + Exonic
1084621128 11:70270877-70270899 GAGCGGGCGAGGAGGCTCCGCGG - Exonic
1084786934 11:71448114-71448136 GAGGGGCCGCTGGGGCTCCGGGG - Intronic
1084810160 11:71607248-71607270 GCGAGGCGGCCGCGGCTCCCTGG + Intergenic
1085205830 11:74731362-74731384 CAGCAGCGGCGGCGGCGCGGCGG + Intronic
1087014623 11:93543239-93543261 GCGCGGCGGCGGCGGCGGCGGGG - Intronic
1087761811 11:102110659-102110681 GGGCGGGGGCGGAGGCGCCGGGG + Exonic
1088522268 11:110712474-110712496 GAGCGGAGGGGGCGGGCCCGAGG - Intronic
1089046326 11:115504326-115504348 CGGCGGCGGCGGCGCCTCCCGGG - Exonic
1089432691 11:118436647-118436669 GGTCGGCGGTGGCGGCCCCGGGG + Exonic
1089543716 11:119206450-119206472 CGGGGGCGGCAGCGGCTCCGGGG + Exonic
1089694856 11:120210844-120210866 GAGAGGGGGCAGCGGCTCCGCGG - Exonic
1089993429 11:122882901-122882923 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1090238208 11:125164816-125164838 AGGCGGCGGCGGCGGCGCGGCGG + Intronic
1090238280 11:125165145-125165167 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1090293888 11:125569551-125569573 GAGCCGCGGCGGCGGAGCTGTGG + Exonic
1090817787 11:130314447-130314469 CGGCGGCGGCGGCGGCCCGGGGG + Exonic
1091474085 12:754117-754139 CAGCGGCGGCGGCAGCGCCAAGG + Exonic
1091550286 12:1530981-1531003 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1091823258 12:3491752-3491774 GAGCGGCGGCGGCGGCGCGGTGG - Intronic
1092253534 12:6914552-6914574 CGGCGGCGGCTGCGGCTCCCGGG - Intronic
1092335408 12:7628703-7628725 GGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1092418229 12:8308482-8308504 GGGAGGCTGAGGCGGCTCCGGGG - Intergenic
1094375402 12:29783748-29783770 CAGCGGCGGCGGCGGCGCGATGG - Exonic
1095752372 12:45727543-45727565 GTGAGGCGGCGGCGGCGCGGCGG + Intergenic
1096461190 12:51822032-51822054 GGGCGGTGGCGGCGGTTCCGGGG - Intergenic
1096647801 12:53047861-53047883 GAGGGAGGGCGGCGGCTCTGGGG - Intronic
1097033256 12:56104685-56104707 CAGAGGCGGCGGCGGCTCAGGGG + Exonic
1097190406 12:57216829-57216851 GAGCGGCGGGAGCGGCGGCGCGG - Exonic
1097232383 12:57520651-57520673 GAGCGACGGGGGCGGTGCCGCGG - Intergenic
1097676068 12:62603467-62603489 GAGAGGCGGCGCCGGCGCCCGGG - Exonic
1097929631 12:65169838-65169860 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1098255429 12:68611075-68611097 AAGCCGCGGCGGCGGCCGCGCGG + Intronic
1098550372 12:71755138-71755160 GGCCGGCGGCGGCGGCGGCGGGG + Exonic
1100391733 12:94150073-94150095 CGGCGGCGGCGGCGGCTCCCCGG - Intronic
1102197156 12:111033973-111033995 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1102197157 12:111033976-111033998 CGGCGGCGGCGGCGGCGCGGCGG + Intergenic
1102197409 12:111034854-111034876 CGGCGGCGGCGGCGGCCCCCGGG - Intronic
1102457137 12:113077853-113077875 TGGCGGCGGCGGCGGCAGCGGGG - Exonic
1102853952 12:116277494-116277516 AGGCGGCGGCGGCGGCTCCGGGG - Intergenic
1102853960 12:116277514-116277536 CCGCGGCGGCGGCGGCTCCGAGG - Intergenic
1102854056 12:116277803-116277825 CGGCGGCGGCGGCGGCTCGCGGG + Intergenic
1103433068 12:120904248-120904270 GGGCGGCGGCGGCGGCGGCCGGG + Exonic
1103509876 12:121467057-121467079 TCGCGGCGGCGGCGGCGTCGCGG + Intronic
1103749870 12:123151158-123151180 GAGCGGCGGCGGCGGCGGCGGGG + Intergenic
1103764669 12:123271665-123271687 GGGCGGCGGCGGCGGCGGCGAGG + Exonic
1103800356 12:123533735-123533757 CGGCGGCGGCGGCGGCAGCGGGG + Intergenic
1104049563 12:125186488-125186510 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
1104049652 12:125186807-125186829 GAGCGGCGGCGCCCGGCCCGGGG - Intergenic
1104841458 12:131828041-131828063 GCGCTGCGGCGGCGGCTCCGGGG + Intergenic
1104961610 12:132490729-132490751 GCGCGGGGGCGGCGCCTCGGGGG - Exonic
1104961623 12:132490766-132490788 TCGCGGCGGCGGCGGCGCGGGGG - Exonic
1104983451 12:132583779-132583801 GAGAGGCGTCTGCGGCCCCGGGG - Exonic
1105022817 12:132828695-132828717 GAGGGGCGGCGGCGGGGCCTGGG - Exonic
1105678069 13:22696600-22696622 TGGCGGCGGCGGTGGCTGCGCGG + Intergenic
1105678079 13:22696628-22696650 GAGCGGCGGCGGGGGCCCTGGGG + Intergenic
1106057725 13:26254312-26254334 GAGCGGCGGAGCCGGCGCCCAGG + Exonic
1106269330 13:28138603-28138625 TGGTGGCGGCGGCGGCTCCTCGG + Exonic
1106322966 13:28659278-28659300 TGGCGGCGGCGGCGGCAGCGTGG + Intronic
1106478031 13:30114805-30114827 GGGAGGCGGCGGCGGCGGCGGGG + Intergenic
1106956265 13:34942451-34942473 GAGCGGCTGCAGCATCTCCGCGG + Exonic
1106956412 13:34942913-34942935 CAGCGGTGGTGGCGGCACCGGGG + Exonic
1107851413 13:44576560-44576582 TGGCGGCGGCGGCGGCCCCGGGG - Exonic
1108227465 13:48303971-48303993 GGGCGGCGGCGGCGGTGCCGGGG - Exonic
1108313948 13:49220352-49220374 GAACGGCAGCGACGGCCCCGAGG + Exonic
1108635889 13:52334024-52334046 GAGGGCCTGCGGGGGCTCCGAGG + Intergenic
1108651921 13:52489224-52489246 GAGGGCCTGCGGGGGCTCCGAGG - Intergenic
1108688925 13:52845819-52845841 GAGGGGCAGCAGCGGCTCCGCGG - Exonic
1110558511 13:76886257-76886279 TGGCGGCGGCGGCGGCGGCGGGG - Exonic
1110596585 13:77326776-77326798 CGGCGGCGGCGGCGGCGGCGAGG - Intronic
1110705865 13:78601961-78601983 CAGCGGCGGCGGCGGCGGCCGGG - Exonic
1111950875 13:94708127-94708149 GAGCGGGGGGAGCGGCTCCGGGG - Intergenic
1112505083 13:99970584-99970606 CGGCGGCGGCGGCGGCGCCGGGG + Exonic
1112733692 13:102394694-102394716 GGGCAGCGGCGGCGGGACCGGGG + Intronic
1113541867 13:111115434-111115456 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1113759649 13:112838490-112838512 GCGCGGCAGGGGCGGCTCCGGGG - Intronic
1115028391 14:28767464-28767486 CGGCGGCGGCGGCGGTTGCGGGG - Exonic
1115235793 14:31207670-31207692 GGGCGACGGCGGCGGCGGCGCGG + Intronic
1115399144 14:32938833-32938855 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1115474569 14:33800608-33800630 GGGCGGGGGCGGCGGCGCGGGGG + Exonic
1115654426 14:35429785-35429807 GGGCGGCGGAGGCGGCACAGAGG + Intergenic
1115851784 14:37595141-37595163 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1115851785 14:37595144-37595166 CGGCGGCGGCGGCGGCGCGGCGG + Intronic
1116817863 14:49599795-49599817 CCGCGGCGGCGGCAGCGCCGCGG + Intronic
1116817920 14:49599937-49599959 GGGCCGGGGCGGGGGCTCCGGGG + Intronic
1117176685 14:53153026-53153048 AGGCGGCGGCGGCGGCGCCTGGG - Exonic
1117353511 14:54902660-54902682 CAGCGGCTGCGGCGGGTCCATGG - Exonic
1117424424 14:55580264-55580286 CGGCGGCGGCGGCGGCGCCTCGG + Intronic
1117602581 14:57390672-57390694 GAGTGGCGGCAGCGGCGGCGGGG + Exonic
1117920792 14:60723768-60723790 GCGCGGCGGCGGCGGCGGCGTGG + Exonic
1118339102 14:64879833-64879855 TGGCGGCGGCGGCGGCGCAGGGG + Exonic
1118350999 14:64972366-64972388 GGGCGGCGGCGGCGGCGCAGGGG - Intronic
1118849484 14:69573097-69573119 CGGCGGCGGCGGCGGCCGCGGGG + Exonic
1119410308 14:74426150-74426172 GCGCGGCGGCGGCGGCGGCGGGG - Intergenic
1119438526 14:74612806-74612828 GAGCGAAGGCGGCGGCGCCAGGG - Intergenic
1119519700 14:75277102-75277124 GAGCGGCCGCGGCCGGGCCGGGG + Intergenic
1119601967 14:75982471-75982493 GAGGGTCGGCGTCCGCTCCGCGG + Intronic
1119743260 14:77027565-77027587 GACGGGCGGCGGCGGCCCGGGGG + Exonic
1119759656 14:77141544-77141566 GTGCGGCGGCGGCGGCGCGGGGG - Intronic
1120167902 14:81220357-81220379 CGGCGGCGGCGGCGGCCGCGCGG + Intronic
1120788023 14:88554722-88554744 GTGCGGCTGCGGCGGCCGCGCGG - Exonic
1120993574 14:90398189-90398211 GGGAGGAGGCGGCGGCGCCGCGG + Intronic
1121075000 14:91060502-91060524 GGGCCGCGGCAGCGGCTGCGAGG - Exonic
1122081691 14:99271293-99271315 CAGCGGCGGCAGCGGCGCGGCGG - Intronic
1122130725 14:99603446-99603468 AAGCGGTGGCGGCGGCGGCGGGG - Exonic
1122162301 14:99793310-99793332 CGGCGGCGGCGGCGGGCCCGGGG + Intronic
1122183495 14:99971987-99972009 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1122221233 14:100240054-100240076 GTGCGGCGGCGGGGGCGCGGCGG + Intronic
1122300146 14:100726882-100726904 CGGCGGCGGCGGCAGCTCCCCGG + Exonic
1122445019 14:101761787-101761809 CGGCGGCGGCGGCGGCCGCGGGG + Exonic
1122581987 14:102777136-102777158 GCGCGGCGGCGGGGGCGCGGCGG + Intergenic
1122630135 14:103103976-103103998 GAGCGGAGGCAGCGGCTCGGCGG - Exonic
1122635378 14:103127269-103127291 AGGCGGCGGCGGCGGGGCCGGGG + Exonic
1122707473 14:103629847-103629869 GGGCGGCGGCGGCCGTTCCCGGG + Intronic
1122779157 14:104136372-104136394 GCGCGGCGGCGGCGGGCGCGCGG + Intergenic
1122779617 14:104138248-104138270 GAGGGGCGTCGGCGCCTCCTGGG + Intergenic
1122779871 14:104139062-104139084 CAGCAGCGGCGGCGGCTCGCGGG - Exonic
1122975332 14:105168543-105168565 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1123001926 14:105300473-105300495 GAGCAGCGGCGGCGGCTCCTCGG - Exonic
1123004532 14:105314900-105314922 GAGCGGCGGGGCCGGCGCCATGG + Exonic
1123039961 14:105486457-105486479 GATCGGCTGCGGGGGCTGCGGGG - Intergenic
1123048547 14:105529965-105529987 GAGCGGGGGCTGAGGATCCGCGG - Exonic
1124220350 15:27845686-27845708 GAGCGACGGAGGAGGCTCCTGGG - Intronic
1124629003 15:31326727-31326749 TACAGGCGGCGGCGGCTGCGGGG - Intergenic
1124957179 15:34367176-34367198 CAGCGGCGGCGGCGGCGCTCTGG + Exonic
1124971126 15:34490500-34490522 GGGCGGCGGGGGCGGCGGCGGGG - Intergenic
1125516367 15:40323542-40323564 GAGGGGAGGCGGCGGCTGCCGGG - Intergenic
1125524799 15:40368123-40368145 GCGCTGCACCGGCGGCTCCGCGG + Exonic
1125728895 15:41882113-41882135 ACGCGGCGGAGGCGGCTTCGTGG - Exonic
1126034959 15:44537199-44537221 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1126766962 15:52019278-52019300 TGGCGGCAGCGGCGTCTCCGAGG - Exonic
1126852399 15:52805379-52805401 AGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1127165765 15:56243783-56243805 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1127439022 15:58987716-58987738 AAGCGGCGGCGGCGGCTGTAGGG + Intronic
1128028661 15:64460804-64460826 GGGCGGAGGTGGCGGCTCCCGGG + Intronic
1128344127 15:66842819-66842841 GGGCGGCGGCGGCGCCGGCGCGG + Intergenic
1128482767 15:68054386-68054408 CAGCAGCGGCGCCGTCTCCGCGG - Intronic
1128799895 15:70490617-70490639 GAGGGGCAGCGGCGGGTCCCTGG - Intergenic
1128841472 15:70854235-70854257 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
1129082467 15:73052632-73052654 CAGCGGCGGCGACAGCGCCGCGG - Exonic
1129742122 15:77994367-77994389 GAGCGGCGGCGGCAGAGCTGGGG - Intronic
1129893783 15:79089485-79089507 CGGCGGCGGCGGCGGCGCAGGGG + Intronic
1130040856 15:80404405-80404427 GTGTGGCGGCGGCGGCGCCTGGG + Exonic
1130115461 15:81001575-81001597 AAGCGGCGCCGGCGGCAGCGGGG - Exonic
1130152783 15:81324142-81324164 GAGCGGCGGCGCTGGATCCCGGG + Intronic
1130348052 15:83067065-83067087 GGGCGGCGGCGGCGGCCCCGCGG + Exonic
1130362959 15:83207681-83207703 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1130370666 15:83283651-83283673 GAGCCGCGTCCGCCGCTCCGAGG - Intronic
1131056710 15:89379204-89379226 GCTCGGCGGCTGCGGCTCCGGGG - Intergenic
1131144431 15:90002021-90002043 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1131268425 15:90932388-90932410 GAGCGCCGGCTGCGGCACCTGGG - Intronic
1131367664 15:91853715-91853737 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1131367719 15:91853881-91853903 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1131466086 15:92655748-92655770 CTGCGGCGGAGGCGGCTGCGCGG + Exonic
1131692784 15:94845006-94845028 GGGAGGCGGCGGCGCTTCCGCGG + Intergenic
1131827015 15:96330404-96330426 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1131827372 15:96332033-96332055 GCGGGGCGGCGGCGGCTCCCCGG - Exonic
1132055675 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG + Exonic
1132498722 16:275598-275620 GCGCGGCGGCGGCGGATTCCAGG + Intronic
1132523399 16:401773-401795 GGGCGGGGGCGGGGCCTCCGGGG + Intronic
1132580088 16:680706-680728 GGGCGGCGGCGGTGGCACCGGGG + Intronic
1132604651 16:788627-788649 GCGCGACGGCGGCGGCGGCGCGG + Exonic
1132709875 16:1261693-1261715 GGGCGGCGGCAGCGACTCTGGGG + Intergenic
1132839488 16:1972146-1972168 GAGCGGCGGCGGCGGCAACATGG + Exonic
1132885105 16:2179053-2179075 CGGCGGCGGCGGCGGCTCGCGGG + Exonic
1132889380 16:2196485-2196507 CAGAGGCGGCGGCGGCCCCGCGG + Exonic
1132926023 16:2429487-2429509 GAGCGGCGGCGGTGAGTGCGGGG + Exonic
1133079289 16:3305691-3305713 GAGCGGCGGCGGCCGCAGGGAGG + Intronic
1133212873 16:4272868-4272890 TGGCGGCGGCGGCGGCGGCGAGG + Exonic
1133634671 16:7653911-7653933 GATCGGGGGCGGGGGCGCCGCGG - Exonic
1133784357 16:8963367-8963389 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1133801927 16:9091702-9091724 CAGCGGCGGCGGCGGCAGTGGGG + Exonic
1134143578 16:11742646-11742668 AGGGGGCGGCGGCGGCCCCGCGG - Exonic
1134163956 16:11915570-11915592 TTGCGGCGGCGGCGGCTCCCTGG - Exonic
1134172080 16:11976756-11976778 AAGCGGCAGCGGCGGCGGCGCGG + Exonic
1134419324 16:14071340-14071362 GAGCGGCGGCGGCGGCGGCCGGG + Intronic
1134527789 16:14957760-14957782 GGGAGGCGGCGGCGGCGCAGGGG - Intergenic
1135296538 16:21283936-21283958 CAGCGGCGGAGGCGGCGGCGAGG + Intronic
1135821870 16:25692319-25692341 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1135822009 16:25692804-25692826 GAGCGGCGGCGGAGGCGCCCAGG + Exonic
1135976119 16:27109855-27109877 CAGAGGCGGCGGCGGGACCGGGG + Intergenic
1136110894 16:28063205-28063227 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1136242163 16:28951235-28951257 GACCGGCCCCGGGGGCTCCGGGG - Exonic
1136419535 16:30123186-30123208 TGGCGGCGGCGGCGGCTCAGGGG - Exonic
1136485934 16:30571664-30571686 GCGGGGAGGCGGCGGCTCCAGGG - Exonic
1136498834 16:30659685-30659707 GGGCGGCGGCGGCGACGACGAGG - Exonic
1136505101 16:30698248-30698270 GAGCGGCAGCGGCGGTTCGCTGG + Intronic
1137655259 16:50153560-50153582 CGGCGGCGGCGGCGGCCCTGCGG + Intronic
1137668617 16:50266484-50266506 CAGCGGCGGCGGCGGCAGCAAGG - Intronic
1137988671 16:53131124-53131146 GAGCAGCGGCCGCTGCCCCGCGG - Intronic
1138179320 16:54931408-54931430 CGGCGGCGGCGGCGGCCGCGGGG - Exonic
1138247625 16:55479279-55479301 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1138595418 16:58026802-58026824 GGGCGGCGGAAGCGGCTCCCGGG - Intronic
1138619100 16:58197772-58197794 GGGTGGCGGCGGCGGCGCGGCGG + Exonic
1139451188 16:67029194-67029216 CGGCGGCGGCGGCGGCGGCGTGG + Intronic
1140068052 16:71626639-71626661 CTGCGGCTGCGGCGGCTCCGGGG - Exonic
1140946249 16:79770749-79770771 GAGCGGGGCCGGCCGCTTCGCGG - Intergenic
1141608579 16:85169249-85169271 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1141627116 16:85267149-85267171 GAGCAGCGGCGGTGGCTGCCTGG + Intergenic
1141682596 16:85553290-85553312 CAGCGGCGGCGGCGGCGGCCTGG - Intergenic
1141700432 16:85639734-85639756 GGGCGGCGGTGGAGGCTCCACGG - Intronic
1141831164 16:86510608-86510630 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1141831313 16:86511244-86511266 GGGCGGCTGCGGCGGCGCGGCGG + Exonic
1142014945 16:87740416-87740438 GAGGGGAGGCGGCTGCTCCTGGG - Intronic
1142336096 16:89490350-89490372 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1142336137 16:89490496-89490518 GCTCGGCGGCGGCGCCTCCCCGG + Exonic
1142379022 16:89721429-89721451 GAGCGGGGGCGCTGGCACCGCGG + Intronic
1142395346 16:89828562-89828584 GGGCAGCTGCGGCGGCGCCGCGG + Exonic
1142417206 16:89949181-89949203 GAGCAGCGGCGGCGTCCCCGGGG - Intronic
1142474395 17:180817-180839 GGGGCGCGGCGCCGGCTCCGAGG + Intronic
1142549796 17:731989-732011 CAGCGGCTGCAGCCGCTCCGGGG - Intergenic
1142631582 17:1229414-1229436 GGGCGGCGGCGGAGACTCCGGGG - Intergenic
1142764777 17:2058893-2058915 GAGCGGCGGGGGCGGCGCGCAGG + Exonic
1142836798 17:2593599-2593621 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143223654 17:5282376-5282398 GGGCGGCGGCGGCGGCGGCTCGG + Exonic
1143527220 17:7479595-7479617 CGGCGGCGGCGGCGGCAGCGGGG - Intronic
1143527257 17:7479684-7479706 CGGCGGCGGCGGCGGCGCTGGGG - Intronic
1143590877 17:7885306-7885328 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1143597304 17:7923023-7923045 GAGCGGGAGAGGCGGCTGCGAGG + Exonic
1143830300 17:9645678-9645700 GAGCGGCGGCGGCGGGGCCGGGG - Exonic
1144021030 17:11240630-11240652 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1144021161 17:11241057-11241079 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1144109808 17:12020904-12020926 GAGCGGCGGCGGCGGCTCCGGGG + Exonic
1144185134 17:12789721-12789743 GGGCGACGGCGGCGGCACTGCGG - Exonic
1144781215 17:17809586-17809608 GGACGGCGGCGGGGGCTCCTGGG - Intronic
1144910054 17:18673029-18673051 CGGCGGCGGCGGCGGCGCCCGGG - Exonic
1144971285 17:19111263-19111285 CGGCGGTGGCGGCGGCTCCGCGG + Intergenic
1144991590 17:19237434-19237456 CGGCGGTGGCGGCGGCTCCGCGG + Exonic
1145694205 17:26774511-26774533 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1146009214 17:29180278-29180300 CGGCGGCGGCGGCCGCTCGGTGG - Intronic
1146132634 17:30291961-30291983 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1146339604 17:32007668-32007690 CGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1146356923 17:32142450-32142472 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1146371132 17:32266152-32266174 CGGGGGCGGCGGCGGCTGCGGGG - Intergenic
1146716202 17:35089076-35089098 AGGCGGCGGCGGCGGCGCTGGGG - Intronic
1146763486 17:35498065-35498087 GAGCGGCGGCGAGGGCGGCGGGG + Intronic
1147134761 17:38428462-38428484 GGGTGGCAGCGGCGGCTCTGCGG - Exonic
1147486364 17:40818905-40818927 CGGCGGCGGCGGCGGCTACGGGG - Exonic
1147486389 17:40818992-40819014 AAGCTCCGGCGGCGGCTACGGGG - Exonic
1147752450 17:42744739-42744761 GAGCGGCGGGGGCGGGCTCGGGG - Intronic
1147994707 17:44354407-44354429 GGGCGGCGGGGGCGGCGGCGAGG - Exonic
1148060054 17:44830076-44830098 CGGCGGAGGAGGCGGCTCCGGGG - Intronic
1148323786 17:46771927-46771949 GAGGCGCGGCGGCGGCGCGGCGG - Intronic
1148551068 17:48551101-48551123 GGGCGGTGGCGGCGGCGGCGGGG - Exonic
1148556597 17:48582230-48582252 CACCGGCGGCGGCGGCGCGGAGG + Intronic
1148804914 17:50259173-50259195 GGGGGGCGGCGGGGGCTCAGGGG + Intergenic
1149614754 17:57988310-57988332 GGGCGGCGGCGGCCGGGCCGGGG - Intergenic
1150060586 17:62065372-62065394 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1150250090 17:63700230-63700252 GGGGGTCGGCGGCGGCGCCGGGG - Intronic
1150407976 17:64919169-64919191 GGGCGGCGGCGGCGGCGGCGGGG + Intronic
1150407979 17:64919175-64919197 CGGCGGCGGCGGCGGGGCCGGGG + Intronic
1150692751 17:67378866-67378888 GAGCGGCGGGGGCTGCGACGCGG + Intronic
1150791890 17:68205754-68205776 CGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1151711412 17:75809081-75809103 GAGCGGCGGGGGCGGGGGCGGGG + Intronic
1152049232 17:77959232-77959254 CGGCGGCGGCGGCGGCTCCGCGG - Intergenic
1152542055 17:80981480-80981502 CAGCGGCCGCGGCGGCCACGCGG - Intergenic
1152542135 17:80981751-80981773 GAGGGGCTGCGGCAGCGCCGGGG - Intergenic
1152589298 17:81203526-81203548 GAGCGGAGGCGCCCTCTCCGAGG + Exonic
1152628651 17:81399802-81399824 GCGCGGCGGCAGCGGCGCTGCGG - Exonic
1152729025 17:81960944-81960966 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1152732146 17:81977658-81977680 GGCAGGCGGCGGAGGCTCCGCGG + Exonic
1152750896 17:82062030-82062052 GAGGGGCGGAGGGGGCTCTGAGG - Intronic
1152817833 17:82418662-82418684 GAGCGGAGGCGGCGGCCGCGAGG + Exonic
1152924522 17:83080987-83081009 GAACGGAGGCTGCGGCTGCGGGG - Intronic
1153006188 18:500485-500507 GTAGGGCGGCGGCAGCTCCGCGG - Intronic
1153052190 18:909449-909471 GAGCCTCGGCGGCGGCGCGGGGG + Exonic
1153765131 18:8367500-8367522 GAGCGGCGGCACCTGTTCCGCGG + Intronic
1153935222 18:9914594-9914616 TGGCGGCGGCGGCGGCGCCAGGG - Intronic
1154174488 18:12076537-12076559 CGGCGGCGGCGGCGGCGCCGCGG - Intergenic
1154241557 18:12657959-12657981 GTTGGGCGGCGGCGGTTCCGGGG - Exonic
1154304007 18:13217837-13217859 CAGCGGCGGCAGCGGCTCAGTGG - Intronic
1154954677 18:21242396-21242418 GAGCGGCCGCGGGGACTCCGGGG + Intronic
1157376983 18:47176137-47176159 GGGCGGCGGCGGAGTCCCCGGGG - Intronic
1157383938 18:47247081-47247103 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1157383959 18:47247156-47247178 AAGCGGCGACGGCGGCTGCGGGG + Intronic
1158259108 18:55588155-55588177 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1158436001 18:57435842-57435864 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1158436007 18:57435854-57435876 GGGCGGCGGGGGCGGCGGCGGGG + Exonic
1158893573 18:61894253-61894275 GAGCGGCGGCCGCCGGCCCGGGG - Intergenic
1158954139 18:62523552-62523574 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1159040576 18:63320037-63320059 CAGCGGCGGCGGCGGCAGCGCGG + Exonic
1160025389 18:75211660-75211682 AGGCGGCGGCGGCGGCCGCGCGG - Intronic
1160204794 18:76823137-76823159 GCGCGGCGCCGGCTGCCCCGGGG + Intronic
1160242354 18:77132780-77132802 GACTGACGGCGGCGGCTCCGAGG + Intronic
1160453445 18:78980154-78980176 GCGGGGCGGCGGCGGCTGCGCGG - Intergenic
1160453596 18:78980668-78980690 GCGCGGCGGCGGAGGCACCGTGG - Intronic
1160706217 19:531497-531519 GGGCGACGGCGGCGGCCTCGGGG + Intergenic
1160706308 19:531787-531809 GGGCGGCGGCGGCGGCGCAGAGG + Exonic
1160853546 19:1206044-1206066 GCGCGGCGGCGGGGGCTCCACGG - Intronic
1160903317 19:1440050-1440072 CAGCGGCGGCGGCTGAACCGGGG + Exonic
1160904715 19:1446676-1446698 GGGCGGCGGGGGCGGCTGCGGGG + Intronic
1160930588 19:1567995-1568017 GGGCGGCGGCGGCGGCGGCGTGG - Exonic
1160930694 19:1568284-1568306 CGACGGCGGCGGCGGCTCCTCGG + Intergenic
1160967821 19:1754300-1754322 TGGCGGCGGCGGGGGCTGCGGGG - Exonic
1160967917 19:1754583-1754605 GAGCGGCGGCGGCCCCAGCGCGG + Exonic
1160991838 19:1863312-1863334 GGGCGGCGGGGGTGGCCCCGGGG + Exonic
1161029495 19:2051118-2051140 GTGGGGCGGCGGCGGCACTGCGG - Exonic
1161069657 19:2253726-2253748 GGGCGGCGGCGGCGGCTGCAGGG + Exonic
1161103232 19:2431703-2431725 GAGCTGCTGTGGCGGCCCCGAGG + Intronic
1161384826 19:3985326-3985348 GAGCGGCGGCGGGGCCTCCGCGG - Intronic
1161397981 19:4054692-4054714 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1161450703 19:4343856-4343878 AGGCGGCGGCGGCGGGGCCGGGG + Exonic
1161461544 19:4400501-4400523 GAGCGGCTGAGGCGGCGCCGGGG - Exonic
1161494910 19:4581462-4581484 TCGCGGCGGCCGCGGCTCCGAGG - Intergenic
1161494994 19:4581668-4581690 GCGCGCTGGCGTCGGCTCCGGGG + Intergenic
1162021362 19:7869926-7869948 GGGCGGCGGCGGCGGGCCGGGGG + Exonic
1162027709 19:7903919-7903941 GCGCGGCGGCGGTGGCGGCGGGG + Exonic
1162145509 19:8610661-8610683 CAGCGGCGGCGACGGCGCGGAGG - Intronic
1162333430 19:10045081-10045103 GAGCGGCGATGGCGGCTGGGAGG - Intergenic
1162470927 19:10871662-10871684 GCGCAGCGGCGGCGGCGGCGGGG + Exonic
1162470940 19:10871707-10871729 CAGCGGCGGCGGCGGCGGTGGGG + Exonic
1162535837 19:11262472-11262494 CGGCGGCGGCGGCGGGGCCGGGG - Intronic
1162535840 19:11262478-11262500 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1162572144 19:11480030-11480052 CAGCAGCGGCGGCGGGCCCGCGG + Intronic
1162751755 19:12833843-12833865 CGGCGGCGGCGGCGGCTGAGGGG - Intronic
1162752683 19:12838505-12838527 AGGCGGCGGCGGCGGCGGCGCGG - Intronic
1162797825 19:13095686-13095708 GCGCGGCAGCGGCGGCTGCCTGG - Exonic
1162929879 19:13952554-13952576 GAGCGGCGGCGGCGGCCCCGGGG + Exonic
1162954500 19:14090779-14090801 GTGCGGCGGCGGCGGCGGCGGGG - Intronic
1163106329 19:15125029-15125051 CAGCGGGGGCGGCGGCCGCGGGG + Exonic
1163154497 19:15432543-15432565 GGGCGGCGGCGGCGGCGCGGGGG + Intronic
1163282312 19:16325322-16325344 GGGCGGCGGCGGCGGCTCCGGGG - Exonic
1163358309 19:16829450-16829472 CAGCGGTGCCGGCGGCCCCGCGG + Exonic
1163442457 19:17328770-17328792 GGGCGGGGGCGGCGGCAGCGGGG - Exonic
1164693587 19:30227733-30227755 CGGCGGCGGCGGCGGCTGCCGGG - Intergenic
1165243010 19:34482133-34482155 GAAGGGCAGCGGCGGCCCCGAGG + Exonic
1165454033 19:35900517-35900539 GGGACCCGGCGGCGGCTCCGCGG - Exonic
1165493913 19:36141038-36141060 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1165745980 19:38229618-38229640 GCGCGGCGGCAGCGGCGCCCCGG - Intronic
1165760068 19:38315882-38315904 GCTTGGCGGCGGCGGCTGCGGGG - Exonic
1165774246 19:38395554-38395576 GTGGGGCGGCCGCGGCTACGAGG + Exonic
1165854188 19:38870112-38870134 GGGCGGGGGCGGGGCCTCCGGGG - Exonic
1166304253 19:41928592-41928614 AGGCGGCGGCGGCGGCGCGGGGG + Intronic
1166375315 19:42324306-42324328 TGGCGGCGGCGGTGGCCCCGAGG + Intronic
1166546994 19:43639787-43639809 CGGCGGCGGCGGCGGCACCATGG - Exonic
1166682616 19:44778123-44778145 GGCCGGCGGAGGCGGCCCCGGGG + Exonic
1166883010 19:45940369-45940391 TGGCGGCGGCGGCGGCTGCTGGG + Exonic
1166888057 19:45973451-45973473 TTGCGGCGGCGGCGGCGGCGGGG + Exonic
1166888064 19:45973469-45973491 CGGGGGCGGCGGCGGCTGCGGGG + Exonic
1167080856 19:47275247-47275269 TAGCGGCGGCGGCGGCTCAGCGG - Exonic
1167311197 19:48738935-48738957 GAGCGGCGGGCGGGGCTCTGGGG - Intronic
1167557470 19:50205297-50205319 CGGCGGCGGCGGCGGCGCCAGGG - Intronic
1167596770 19:50432229-50432251 GAGGGGCGGCGGCCAGTCCGGGG + Intergenic
1167613476 19:50518296-50518318 CAGCGGCGGGGGCGGCCCTGGGG - Exonic
1167622737 19:50568302-50568324 GAGCGGCGCCGGCGGGCCCGAGG - Intergenic
1167643702 19:50695085-50695107 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1167797546 19:51719647-51719669 GGGTGGCGGCGGCGGCGCGGGGG - Exonic
1168076326 19:53982549-53982571 CGGCGGCGGCGGCGGCGCCGTGG + Exonic
1168154543 19:54465415-54465437 GCGCGGCGGCGACGCCTTCGGGG - Exonic
1168247004 19:55117487-55117509 GGGCGGCGGCGGCGGCTGCCCGG - Exonic
1168276075 19:55279512-55279534 GGGCGGCGGCGGCGGCTCCTCGG - Exonic
1202693092 1_KI270712v1_random:105042-105064 GAGAGGCGGCGGCGGCGGAGAGG + Intergenic
1202710758 1_KI270714v1_random:18307-18329 GGGCGGCGGCTGCGGCACAGGGG + Intergenic
925413072 2:3651156-3651178 CGGCGGTGGCGGCGGATCCGTGG + Intergenic
925609896 2:5693677-5693699 GAGCGGCGGCGGGTGCTGCTTGG - Exonic
926217105 2:10912366-10912388 CAGCGGCGGCGGCGGCTGCAGGG + Exonic
926422954 2:12716888-12716910 GGGGGGGGGCGGAGGCTCCGTGG + Exonic
927053707 2:19351971-19351993 GAGGCGCCGCTGCGGCTCCGCGG + Exonic
927472215 2:23385242-23385264 GGACGGCGGCGGCGGCGCGGGGG - Exonic
927606563 2:24491495-24491517 GAGCCGCGGCGCCGGGCCCGAGG + Intergenic
927652299 2:24920051-24920073 CCGCGGCGGCGGCGGCTGCTAGG + Intergenic
927652345 2:24920203-24920225 GCGCGGCGCCGGCGGCTCCGGGG + Intergenic
929133500 2:38602158-38602180 GCGCGGCGGCGGCGGCGGGGAGG - Intronic
929537505 2:42792747-42792769 GCGCGGCGGCGGCAGCGCTGGGG + Intergenic
929604187 2:43224565-43224587 GGGCGGCGCCGGCGGCTGCGCGG + Exonic
929778359 2:44942296-44942318 CGGCGGCGGCGGCGGCTCCAGGG + Exonic
929966913 2:46542993-46543015 GGGCCGGGGCGGGGGCTCCGGGG + Exonic
930136110 2:47905619-47905641 CTGCGGCGGCGGCTGCTGCGGGG + Exonic
930358216 2:50346865-50346887 CGGCGGCGGCGGCGGCGCAGGGG - Intronic
931253509 2:60552425-60552447 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
931602595 2:64019220-64019242 CAGCGGCGGAGGCGGCGCTGCGG - Intergenic
932073403 2:68643214-68643236 GAGCAGCGGGGGAGGCTCCTCGG + Intergenic
933279957 2:80322562-80322584 GCGCGGCGGCGGAGGCCGCGGGG + Intronic
933666856 2:84971277-84971299 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
933684717 2:85133711-85133733 CGGCGGCGGCGGCGGCAGCGGGG + Exonic
933772774 2:85754554-85754576 AGGCGGCGGCGGCGGCGGCGTGG - Exonic
933858401 2:86441301-86441323 GAGCGGCGGAAGCGGCTCCGAGG + Exonic
933875997 2:86622946-86622968 GGGCGGGGGCCGCGGCTCGGTGG + Exonic
934248017 2:90324088-90324110 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248189 2:90324702-90324724 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248362 2:90325312-90325334 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248373 2:90325350-90325372 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248405 2:90325467-90325489 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934261189 2:91478099-91478121 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
934296816 2:91749019-91749041 GGGCCGCGGCGGCGGCGGCGAGG - Intergenic
934566976 2:95346595-95346617 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
934662924 2:96152779-96152801 GAGGGGCGGGGGTGGCTCCCAGG + Intergenic
935592444 2:104855295-104855317 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
935592558 2:104855612-104855634 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
935592610 2:104855816-104855838 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
935592737 2:104856230-104856252 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
935592783 2:104856392-104856414 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
936122700 2:109760441-109760463 GGGCGGCGGCGGCGGCGGCGCGG + Intergenic
936126703 2:109794590-109794612 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
936221993 2:110611032-110611054 GGGCGGTGGCGGCGGCGGCGCGG - Intergenic
936412844 2:112275739-112275761 GAGCGGCAGCGCCGGCAGCGCGG + Exonic
936939640 2:117871067-117871089 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
937160958 2:119760252-119760274 CTGCGGCGGCGGCTGCTCGGGGG + Exonic
937931084 2:127205658-127205680 GAGGGGCGACGCTGGCTCCGTGG - Exonic
938455670 2:131460945-131460967 GGGCCGGGGCGGGGGCTCCGGGG + Intergenic
939153799 2:138501739-138501761 CGGCGGCGGCGGCGGCTCCTGGG - Intergenic
939629759 2:144517166-144517188 CGGCGGCGGCGGCGGCGCCCAGG - Intronic
940830035 2:158456928-158456950 GGGCGGCGGCGGCGGCCTCTGGG + Intergenic
940971970 2:159904793-159904815 GGGCGGCGGGGGCGGGGCCGGGG - Intergenic
941119109 2:161507855-161507877 CCGCGGCGGCGGCGGCGGCGGGG - Intronic
941951452 2:171160697-171160719 GCGCGGCGGCGGAGGCGTCGAGG + Exonic
941986673 2:171517565-171517587 CAGCGGCGGCGGCTGAACCGGGG - Intergenic
942046550 2:172102427-172102449 GAGCGGCGGCGGCGCCGGCCCGG - Exonic
942346219 2:175005266-175005288 CGGCGGCGGCGGCGGCGACGGGG + Intronic
942446143 2:176080247-176080269 CGGCGGCGGCGGGGGCGCCGGGG - Exonic
942450900 2:176107586-176107608 CGGCGGCGGCGGCGGCAGCGCGG + Exonic
942458177 2:176151929-176151951 GGGCGCCGGCGGAGGCGCCGGGG - Exonic
943645930 2:190408195-190408217 GACCGGCGGCGGCGACTGTGAGG + Intergenic
944271266 2:197786641-197786663 GAGCGGCGTCCGCGGCTTCTCGG - Intronic
944811135 2:203328449-203328471 GAGCGGCGGCCGCAGCGCCAAGG - Exonic
945241550 2:207681450-207681472 GGGCGGCGGCGGGGGCACCCGGG - Intergenic
946692418 2:222319502-222319524 GGGCGGCGGTGGCGGGGCCGGGG + Intergenic
946692489 2:222319771-222319793 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
946921449 2:224585236-224585258 GCGCTGGCGCGGCGGCTCCGCGG + Exonic
947506657 2:230713050-230713072 CCGCGGCGGCGGCGGCTGCGCGG - Exonic
947623330 2:231604600-231604622 GAGCTGGGGCCGAGGCTCCGAGG + Intergenic
947669170 2:231925871-231925893 GAGCGGCGAAGGCGGCCGCGTGG - Intronic
947840502 2:233204557-233204579 CAGCGGCGGCCGCGGCGTCGGGG - Exonic
948468626 2:238163893-238163915 GCGCGGCGCCCGCGGCCCCGGGG - Exonic
948487238 2:238288710-238288732 GGGCGGCGGCGGCGGGCGCGGGG - Intronic
948645369 2:239400852-239400874 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
948874850 2:240820826-240820848 GAGGCGAGGCGGCGGGTCCGCGG - Intergenic
1168854948 20:1002001-1002023 GACCGGGGGCGGCGGCTCTGGGG - Intronic
1169065595 20:2692870-2692892 GGGCGGCGGCGGCCGCGGCGGGG + Exonic
1169278453 20:4248786-4248808 GGGCGGCGGCGGCGGCGTGGTGG - Exonic
1169278484 20:4248861-4248883 GGGCGGCGGCGGGGGCAGCGCGG - Exonic
1169557618 20:6767679-6767701 CGACGGCGGCGGCGGCGCCGTGG - Exonic
1171210075 20:23310122-23310144 GTGCGGAGGCTGCGGCTCCTGGG - Intergenic
1172037337 20:32019235-32019257 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1172073657 20:32277705-32277727 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG + Intronic
1172277230 20:33686292-33686314 GACAGGCGGCGGCGGCGGCGCGG + Exonic
1172474532 20:35226890-35226912 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1172482245 20:35277893-35277915 AAGCGGCGGCCGCGGCGCCCCGG - Intergenic
1172618721 20:36306448-36306470 GAGAGGCGGCGGCGGCGCAGCGG + Exonic
1172618824 20:36306765-36306787 AATCGGGGGCGGCGGCACCGGGG + Intronic
1172698077 20:36835848-36835870 CAGCGGCGGCGGCGGCGGGGAGG - Intronic
1172698078 20:36835851-36835873 GAGCAGCGGCGGCGGCGGCGGGG - Intronic
1173649047 20:44651550-44651572 GAGCGCGCGCGGGGGCTCCGGGG - Intronic
1174287772 20:49484204-49484226 CGGCGGCGGCGGCGGCTGCCTGG + Intergenic
1174357823 20:50010104-50010126 CAGCGGCGGCGGCGGCGGCGAGG + Intergenic
1175349842 20:58309879-58309901 GTGCGGCGGCAGCGGCGCCAGGG + Exonic
1175429100 20:58890246-58890268 CCGCGGCGGCGGCGGCCTCGGGG - Intronic
1175429371 20:58891234-58891256 CGGCGGCGGCGGCGGCTGGGAGG - Intronic
1175429534 20:58891705-58891727 TGGCGGCGGCGGCGGCGGCGGGG - Intronic
1175872798 20:62216443-62216465 TGGCGGTGGGGGCGGCTCCGTGG - Exonic
1175899935 20:62355937-62355959 GAACAGCGGGGGCGGCTCCCAGG - Intronic
1175945027 20:62554683-62554705 GAGTGGTGGCGGCGGCTCTGGGG + Intronic
1176029798 20:63006476-63006498 GAGCAGCGGCGGCGGCGGCGCGG - Exonic
1176068922 20:63216016-63216038 GGGCGGCGGCGGCGGCTGCTGGG + Exonic
1176159644 20:63641796-63641818 GAGCGGGGCCGGGGACTCCGAGG - Intronic
1176194430 20:63830898-63830920 CAGCTGCGGCGCGGGCTCCGGGG - Intronic
1176548360 21:8211521-8211543 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176548595 21:8212230-8212252 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176556251 21:8255724-8255746 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176556489 21:8256438-8256460 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176567291 21:8394556-8394578 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176567526 21:8395265-8395287 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176575190 21:8438766-8438788 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176575428 21:8439480-8439502 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176576572 21:8443299-8443321 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1178544176 21:33479644-33479666 AAGGGGCGGCGGGGGCTCCGCGG + Intronic
1178906889 21:36643957-36643979 GAGGGGCGGCTGTGCCTCCGTGG - Intergenic
1179213661 21:39348851-39348873 GGGCGCCGGCGGCGGCTCCAGGG + Intronic
1179516861 21:41914526-41914548 GAGCAGAGTCGGGGGCTCCGGGG - Intronic
1179561585 21:42219221-42219243 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1180064341 21:45405141-45405163 CAGCGGCGGCGGCTGCAGCGCGG + Intronic
1180095858 21:45555154-45555176 GGGCGGCGGGGGCGGCGCAGGGG + Intergenic
1180095873 21:45555187-45555209 GGGCGGCGGGGGCGGCGCAGGGG + Intergenic
1180110314 21:45644259-45644281 CAGCCGCCGCGGCCGCTCCGGGG - Intronic
1180110319 21:45644264-45644286 GAGCGGCCGCGGCGGCTGGAGGG + Intronic
1180183172 21:46126989-46127011 GAGCCGCAGCTGCAGCTCCGAGG - Intronic
1180559045 22:16601351-16601373 CAGCGGCGGCGGCGCGTCCGCGG + Intergenic
1180908353 22:19431536-19431558 AAGCGGCGGCGGTGGCTCCATGG - Exonic
1180949414 22:19714469-19714491 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1180949415 22:19714472-19714494 CGGCGGCGGCGGCGGCGCGGAGG + Exonic
1180960629 22:19760819-19760841 GGGCGGCGGCGGCGGCCCGCGGG + Intronic
1180960687 22:19761049-19761071 CGGCGGCGGCGGCGGGCCCGGGG - Exonic
1180965139 22:19784309-19784331 CAGCAGCGGCGGCGGGTCCTGGG + Exonic
1181006774 22:20017159-20017181 GAGTGGTGGCGGAGGCTACGCGG - Intronic
1181024042 22:20117623-20117645 GCGCGGCGGCGGCGGCGGCTCGG - Exonic
1181478026 22:23180576-23180598 CGGCGGCGGCGGCGGCACGGCGG + Exonic
1181902677 22:26169317-26169339 GAGGGGCCGCGGCGGCGCCGGGG - Intergenic
1182236950 22:28883644-28883666 CGGCGGCGGCGGCGGCTTTGTGG - Exonic
1182296254 22:29312399-29312421 GAGGGGCGGCGGGGGCCCCGAGG - Exonic
1182355360 22:29720295-29720317 GGGCGGCGGCGGCAGCGGCGAGG - Exonic
1182576471 22:31276565-31276587 GGGCGGCGGCGGGGGCGCCCGGG - Intronic
1183394167 22:37561825-37561847 GAGCGGGGGCGGCTGCACCCTGG - Intronic
1183427210 22:37746315-37746337 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1183452859 22:37906269-37906291 GAGGGGCGGAGGCGGGGCCGCGG - Intronic
1183486402 22:38089492-38089514 GAACGGCGGCGGGGGCGCCCAGG + Intronic
1183517106 22:38272965-38272987 CGGCGGCGGCGGAGACTCCGGGG - Exonic
1183702251 22:39457320-39457342 GAGCGGCCGCGCCGGGTCCCCGG + Intergenic
1183702322 22:39457502-39457524 CAGCGGCGGCGGCGGCTCCGCGG - Exonic
1183743165 22:39679388-39679410 GGGCGGCGGGGGCGACACCGAGG + Exonic
1184037766 22:41926595-41926617 GCGCGGCGCCGGCAGCTGCGGGG - Intronic
1184160162 22:42693028-42693050 GAGCAGCCGCGGCAGCTCCTCGG + Exonic
1184164569 22:42720140-42720162 GAGGGGCGCCTGCGGATCCGAGG + Intronic
1184337537 22:43862528-43862550 GACGCGCGGCGGAGGCTCCGCGG + Intergenic
1184523803 22:45009869-45009891 CGGCGGCGGCGGCGGCTGGGCGG - Intronic
1184593858 22:45502815-45502837 GCGCGGCGGAGGCGGGGCCGCGG - Intronic
1184680919 22:46071728-46071750 GGGCGGGGACGGCGGCGCCGCGG + Intronic
1184759601 22:46537150-46537172 GGGCGGCGGCGGCGGCGCCATGG + Exonic
1184767031 22:46577395-46577417 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1185020260 22:48370422-48370444 GTGCGGAGGTGGAGGCTCCGTGG - Intergenic
1185258563 22:49849463-49849485 GCGCGGTCGCGGCGCCTCCGGGG + Intergenic
1185296700 22:50058282-50058304 GTGCAGCGGCGGCGGCCCCGGGG + Intergenic
1185335163 22:50268070-50268092 GAGCTGGGGCGGCGGGGCCGGGG - Intronic
1185345063 22:50307423-50307445 CTGCGGCGGCTGCGGCTCCGCGG - Intronic
1185398448 22:50604210-50604232 GCGCGGGGGCTCCGGCTCCGAGG - Exonic
1185409435 22:50674426-50674448 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203253239 22_KI270733v1_random:127821-127843 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203254622 22_KI270733v1_random:132357-132379 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203261294 22_KI270733v1_random:172902-172924 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203261533 22_KI270733v1_random:173613-173635 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203262678 22_KI270733v1_random:177436-177458 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
950215277 3:11154465-11154487 GGGCGGCGGCGGGGGCGCCGGGG - Intronic
950316306 3:12004643-12004665 CGGCGGCGGCGGCGGCTGCTGGG - Exonic
950729789 3:14947615-14947637 CGGCGGCGGCGGCGGCACCGGGG + Intronic
951717404 3:25664321-25664343 GAGCGGCGGCTGCGGCCTCAGGG - Exonic
952316734 3:32238596-32238618 GGGCGTCCGCGGCGCCTCCGCGG + Intergenic
952382895 3:32818209-32818231 GGGCGGCGGCGGGGGCCCTGGGG + Exonic
952744452 3:36764222-36764244 CGGGGGCGGCGGCGGCTGCGGGG + Intergenic
952929256 3:38346948-38346970 AAGCGGAGGAGGCGGCCCCGTGG - Intronic
953027567 3:39153701-39153723 GGGAGGAGGCGGCGCCTCCGGGG - Intronic
953246642 3:41199603-41199625 GACCTGCGGTGGCGGCTCGGCGG - Exonic
953909285 3:46883515-46883537 CGGCGGCGGCGGCTGCCCCGAGG + Exonic
953989879 3:47475828-47475850 CGGCGGCGGCGGCGGCGACGGGG + Exonic
954004223 3:47578875-47578897 CAGCGGCGGCAGCGGCGGCGCGG - Exonic
954223082 3:49166295-49166317 GAGCAGCGGAGGCGGCGCAGAGG - Exonic
954265936 3:49470365-49470387 GAGCGGCGGTGGCGGCGTCCTGG + Exonic
954389230 3:50260242-50260264 GTGAGGCGGCGACGGCTCCGCGG + Intergenic
954402833 3:50328027-50328049 GGCCGGAGGCGGCGGCTCAGAGG - Exonic
954409678 3:50364999-50365021 GGACGGCGGCGGCGGCACGGAGG + Intronic
954437423 3:50503467-50503489 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
954615556 3:51967347-51967369 CGGCGGCGGCGGCGGCACGGCGG + Exonic
954778965 3:53045629-53045651 GGGCGGCGGCGGCGGCACGTTGG - Intronic
954778999 3:53045747-53045769 GAGGGGCGGCGGCGGCGCCGGGG - Intronic
955060460 3:55488229-55488251 GGGCGGCGGAGGCGGCTCCGTGG + Intronic
955818776 3:62874801-62874823 GAGCAGCGGCGGCGGGGCCGGGG - Exonic
955911570 3:63863949-63863971 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
956658976 3:71581620-71581642 GGGCAGCGGCAGCGGCGCCGGGG - Intronic
956813594 3:72888202-72888224 CGGCGGCGGCGGCGGCCCCCAGG - Exonic
956818309 3:72929006-72929028 GAGAGGCGGCGGTGGCTGCGCGG - Intronic
957939793 3:86990764-86990786 GAGCGGCGGCGGCAGCTCGGGGG - Exonic
958026891 3:88059269-88059291 CGGCGGCGGCGGCGGCGCAGGGG + Exonic
958554398 3:95655765-95655787 GAGCGCGGGCGGCAGCTCTGCGG + Intergenic
959591895 3:108090920-108090942 CGGCGGCGGCGGCGACCCCGCGG - Exonic
960747725 3:120908364-120908386 CAGCGGCGGCGGCGTCCCAGAGG - Intronic
961012910 3:123448125-123448147 GGGCGGCGGCGGCGGCTCGGCGG - Exonic
961202487 3:125055852-125055874 GAGCGGCGGCGGCCACCGCGAGG + Exonic
961692664 3:128681161-128681183 CTGCGGAGGCGGCGGCCCCGAGG + Intergenic
961827168 3:129605283-129605305 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
961827627 3:129606985-129607007 CGACGGCGGCGGCGGCTACGGGG - Intergenic
961895918 3:130167692-130167714 GGGAGGCTGAGGCGGCTCCGGGG - Intergenic
962277955 3:134030037-134030059 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
962301863 3:134250565-134250587 CAGCAGCGGCGGCGGCGGCGGGG + Exonic
962575526 3:136752164-136752186 GGGCGGCGGCGACGGCGGCGGGG - Intronic
962919139 3:139935428-139935450 GAGCGGCAGCGGCGGTGGCGGGG + Exonic
964450787 3:156810763-156810785 CAGAGGCAGCGGCGGCTCAGGGG - Intergenic
965881762 3:173396063-173396085 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
966182246 3:177197690-177197712 GGGAGGCGGCGGCGGCGCGGCGG + Intergenic
966362829 3:179148527-179148549 GGGCGGCGGCGGCGGCGCCGAGG - Exonic
967028715 3:185586345-185586367 CAGCGGCGGCGACAGCTCTGGGG + Exonic
968293488 3:197556030-197556052 GCGCGGAGGAGGCGGCTCGGCGG - Intronic
968353406 3:198080973-198080995 GCCCGGCGGCGGCTGCACCGGGG - Intergenic
968479131 4:826113-826135 GAGCTGCGGCGGCGGCTGAAGGG + Exonic
968481803 4:836460-836482 GAGCGGCGACGGTGGCTGCATGG + Intergenic
968583014 4:1403615-1403637 GGGAGGCGGCGGCGGCCTCGGGG - Exonic
968646777 4:1745017-1745039 GGGCGGGGACAGCGGCTCCGTGG - Exonic
968659508 4:1793296-1793318 GCGCGGTGGCGGCGGCGTCGCGG + Exonic
968701289 4:2059367-2059389 CGGCGGCGGCGGCAGCTCAGGGG - Intergenic
969006053 4:4021008-4021030 GGGAGGCTGAGGCGGCTCCGGGG - Intergenic
969436632 4:7192711-7192733 GCGCGGCGGCGGCGGAGCCCCGG - Exonic
969531756 4:7734285-7734307 GGGCGGCGGTGGCGGCTACTGGG + Exonic
969806895 4:9616282-9616304 GGGAGGCTGAGGCGGCTCCGGGG + Intergenic
970333012 4:15003723-15003745 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
970333032 4:15003782-15003804 GGGCAGCGGCGGCGGCGACGCGG - Exonic
971018946 4:22515673-22515695 CGGCGGCGGCGGCGGCGCCGCGG - Exonic
971279798 4:25233913-25233935 CGGCGGCGGCGGCGGCAGCGGGG - Intronic
971406031 4:26321258-26321280 GGGCGGCGGCGGCGGCGGCGAGG + Intronic
971457807 4:26860791-26860813 GCGCCGCGGCGGCGGCGGCGCGG + Intronic
972265338 4:37454004-37454026 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
975610508 4:76198074-76198096 GAGTGGGGGCGGCTGCTCCTGGG - Intronic
975778966 4:77819619-77819641 CGGCGGCGGCGGCGGCGACGGGG + Intergenic
980827379 4:138089048-138089070 GAGCGGCGGCAACGGCGCGGCGG - Intergenic
981615459 4:146639374-146639396 CAGCGGCGGCGGGGGCTCGGAGG + Exonic
982712276 4:158769194-158769216 GAGCTGCGGCGGCGGCATCATGG + Exonic
982712287 4:158769251-158769273 GGGCAGCAGCGGCAGCTCCGCGG + Exonic
982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG + Intergenic
982745824 4:159103438-159103460 CGGCGGCGGCGGCGGCTGGGCGG + Intergenic
983538023 4:168878334-168878356 GGCCGCCGGCGGCGGCTGCGAGG - Intronic
983577006 4:169271016-169271038 GGGAGGCGGCGGCGGCGGCGTGG - Exonic
984778652 4:183505078-183505100 GAGCGGCTGCGGGGTCCCCGCGG + Exonic
984973434 4:185209954-185209976 CAGCAGCAGCGGCGGCGCCGGGG + Intronic
986330811 5:6714616-6714638 CAGCGGAGGGGGCGGCCCCGGGG + Exonic
986813662 5:11385167-11385189 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
986858794 5:11903689-11903711 CGGCGGCGGCGGCTGCTGCGGGG - Intronic
987050805 5:14144910-14144932 CGGCGGCGGCGGCGGCCTCGGGG + Intronic
987087978 5:14487507-14487529 CGGCGGCGGCGGCGGCAGCGGGG + Exonic
987388660 5:17354477-17354499 GAGCGGCGGCGGGGGCCTTGGGG + Intergenic
989812570 5:45695868-45695890 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
990955028 5:61332326-61332348 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
990955035 5:61332353-61332375 CAGCGGCGGCGGCGGCGGCGCGG + Exonic
990955116 5:61332692-61332714 CAGCGGTGGCGGCGGCGGCGCGG + Exonic
991474372 5:67004155-67004177 GAGCGGCGGCCCAGGCTGCGGGG + Intronic
992105723 5:73448035-73448057 GGGCGGCGGCGGCGGCGGCGCGG - Exonic
992431597 5:76715993-76716015 GAGCGGCGGCTGAGGGACCGCGG + Intergenic
992473112 5:77077231-77077253 GAGCGGCGGCGGCGCAGCGGGGG + Exonic
992627636 5:78649075-78649097 CAGCGGCGGCGGCGTCTCCCGGG + Intronic
993726924 5:91380098-91380120 GAGCGGCGGCGGCCGCGCCGTGG + Intronic
994072735 5:95620476-95620498 GTGCGGCGGCGGCGGGCCCTGGG + Exonic
994107322 5:95961732-95961754 CGGCGGCGGCGGCGGCACCCCGG - Exonic
994353873 5:98774015-98774037 GGGCGGCGGCGCGGGCGCCGTGG - Exonic
995571703 5:113488382-113488404 CCGCGGCGGCAGCGGCTGCGGGG - Exonic
996978210 5:129460148-129460170 GAGCGGGGGAGGCAGCCCCGCGG - Intergenic
998128286 5:139638411-139638433 CAGGGGAGGAGGCGGCTCCGCGG + Intergenic
998137239 5:139680529-139680551 GAGCCTCGGCGGTGGCTCCCAGG + Exonic
998166673 5:139848286-139848308 GCGCGGCCGCGGCGGCGGCGGGG + Exonic
998200488 5:140114307-140114329 CAGTGGCGGCGGCGGCGGCGGGG + Exonic
998236398 5:140402050-140402072 TCCCGGCGGAGGCGGCTCCGAGG - Exonic
999248224 5:150166823-150166845 GGCCGGCAGCGGCGGCTCCAGGG + Exonic
999300011 5:150485529-150485551 CCGCGCCCGCGGCGGCTCCGAGG - Intergenic
1001070308 5:168579568-168579590 CGGCGGTGGCGGCGGCTCCGGGG - Exonic
1001328232 5:170744725-170744747 GAGCCAAAGCGGCGGCTCCGCGG + Intergenic
1002085152 5:176770123-176770145 GAGGGGCAGCGGCTGCTCCCTGG - Intergenic
1002160580 5:177312003-177312025 GAGGGTGGGCTGCGGCTCCGTGG - Exonic
1002184223 5:177446854-177446876 GGGAGGCGGCGGCGGCCCGGGGG - Exonic
1002291848 5:178205369-178205391 GGGCCGCGCCGGCGGCTGCGTGG + Intronic
1002431164 5:179204791-179204813 GACCGGCGGCGGAGGGTCAGCGG - Intronic
1002591068 5:180291969-180291991 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1002712565 5:181204211-181204233 GAGTGGGGGCAGCGGCTGCGTGG + Intronic
1002712768 5:181205062-181205084 GAGCCTCGGCGCCGGTTCCGGGG + Exonic
1002889005 6:1317547-1317569 GAGGGTTGGCGGCGGCTGCGGGG - Intergenic
1002897996 6:1390169-1390191 GAGCGCGGGCGGCGGCGGCGCGG + Exonic
1002927244 6:1611567-1611589 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1002927247 6:1611570-1611592 CGGCGGCGGCGGCGGCGCGGGGG + Exonic
1002927308 6:1611786-1611808 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1002928476 6:1618573-1618595 GAGAGGCGGAGGAGGCTCCAGGG + Intergenic
1003123239 6:3335266-3335288 CAGCAGCGGCGGAGGCTCCGAGG + Intronic
1003212336 6:4079104-4079126 GGGCCGGGGCTGCGGCTCCGCGG + Exonic
1003995801 6:11538190-11538212 GGGGGGCGGCGGCGGGTGCGCGG - Intergenic
1003995811 6:11538216-11538238 GGGCGGCGGCGGCGGCTGCGAGG - Intergenic
1004044686 6:12012442-12012464 CGGCGGCGGCGGCGGCGCCTGGG - Exonic
1004216779 6:13711242-13711264 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1004216848 6:13711479-13711501 CGGCGGCGGCGGCGGCTGCCCGG + Exonic
1004650251 6:17600891-17600913 CTGCGGGGGCGGCGGCGCCGCGG - Exonic
1005267359 6:24126158-24126180 CGGCGGCGGCGGCGGCTGCGCGG + Intronic
1005526800 6:26659441-26659463 GGGCGGCGCCGGCGGCTGCCAGG - Exonic
1005895206 6:30172022-30172044 GGGCGACGGCGGCGGCTGCACGG + Exonic
1006193496 6:32223366-32223388 GAGGGGCGGAGGTGGCTCCCGGG + Intronic
1006472513 6:34236751-34236773 CAGCGGCGGCGGCGGCTGGCGGG + Intergenic
1006558564 6:34889504-34889526 CGGCGGCGGCGGTGGCTCTGGGG + Exonic
1006725580 6:36196999-36197021 GAGCGGGGGCGGGGGCATCGGGG + Intronic
1007368221 6:41409225-41409247 GAGAGGCGAAGGCGGCTGCGCGG - Intergenic
1007429945 6:41770911-41770933 GAGCCGCGGCGGCGGGTCAGTGG + Exonic
1007630309 6:43269753-43269775 CCCCGGCGGCGGCGGCTCCTCGG + Intronic
1007784207 6:44270790-44270812 CGGCGGCGGTGGCGGCCCCGGGG + Exonic
1008387741 6:50913279-50913301 CTGCGGCGGCGGTGGCTGCGTGG + Intergenic
1009437591 6:63635917-63635939 GGGCGGCGGCGGCTGCAACGAGG + Exonic
1010703303 6:79077772-79077794 AGGCGGCGGCGGCGGGGCCGCGG - Intronic
1011226613 6:85114981-85115003 GGGCGGGGGCGGGGGCGCCGGGG + Intergenic
1013117768 6:107115417-107115439 GACCGGCGGCGGCGGCGCTCGGG + Intergenic
1013170828 6:107635069-107635091 CGGCGGCGGCGGCGGCTGCTCGG - Exonic
1013273258 6:108561084-108561106 AGGCGGCGGCGGCGGCGCCCGGG + Exonic
1013349194 6:109290548-109290570 CAGCGACGGCCGCCGCTCCGAGG + Intergenic
1013619327 6:111873026-111873048 GCGCGGCCGAGGCGGCTCCGGGG + Exonic
1013836605 6:114342429-114342451 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1014137625 6:117907484-117907506 GGGCGGCGGCGGCGGCGGCACGG + Intergenic
1014246896 6:119078799-119078821 CGGCGGCGGCGGCGGCTGCGCGG - Intronic
1014724952 6:124962568-124962590 GAGCGGCGGCGGCGGGCCCCAGG + Exonic
1014802363 6:125791040-125791062 GGGCGGGGGCGCCGGCTCCTGGG - Exonic
1014947595 6:127516071-127516093 AGGAGCCGGCGGCGGCTCCGGGG - Exonic
1015149271 6:130019994-130020016 CGGCGGCGGCGGCCGCGCCGGGG + Intronic
1015773540 6:136792282-136792304 GAGAGGAGGCGGCGGCGCGGCGG - Exonic
1016330092 6:142945919-142945941 GAGCGGCCGCCGCGGCTGCGAGG - Intergenic
1016378718 6:143450808-143450830 GAGCGGCGGCGGCTGCGCGGCGG + Intronic
1016949530 6:149566500-149566522 GGACAGCGGCGGCGGCTCGGGGG - Exonic
1017164162 6:151391559-151391581 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1017311554 6:152982704-152982726 GGGCGGCGGCAGCGGTTCCTGGG - Intronic
1017671968 6:156777703-156777725 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1017672322 6:156778985-156779007 CGGCGGCGGCGGCGGCTATGGGG + Exonic
1018613394 6:165663259-165663281 CGGCGGCGGCGGCGGCGGCGTGG - Intronic
1018669615 6:166167885-166167907 GAGCCGCGGCGGCAGCGCTGGGG + Intronic
1018914615 6:168125419-168125441 GAGCAGGGGCTGCGGCTCCCCGG + Intergenic
1019153148 6:170022536-170022558 GTGCGGCGACCGCAGCTCCGTGG + Intergenic
1019194291 6:170272233-170272255 CATCGGCCGCGGCGGCTCTGTGG + Intergenic
1019298498 7:291162-291184 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1019474364 7:1236791-1236813 GGGCGGCGGCGGGGACTGCGCGG + Exonic
1019711490 7:2520034-2520056 GGGCGGCGGCGGCGGCGCCCGGG + Exonic
1019828289 7:3301497-3301519 GAGCGGGCGCGGCCACTCCGCGG - Exonic
1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG + Intergenic
1021451050 7:20784418-20784440 CGGCGGCGGCGGCGGCTCGGCGG - Exonic
1021451251 7:20785336-20785358 GGGCAGCGGCGGCGGCGGCGGGG - Exonic
1021827987 7:24573550-24573572 GAGCGGCGGCAGCGGCGGCGCGG + Exonic
1021828053 7:24573757-24573779 AGGCGGCGGCGGCGGCGCCGCGG + Intronic
1022103793 7:27184541-27184563 CGGCGGCGGCGGCGGCTGCCGGG - Exonic
1022375231 7:29806432-29806454 GCGGGGCGGCGGCGGCTCCCAGG + Intergenic
1022923420 7:35037699-35037721 GGGCGGCGGGGGCGGGGCCGCGG - Intronic
1023319329 7:38976152-38976174 AAGCGGGGGCGGCTGCTCAGCGG + Intergenic
1024043821 7:45574463-45574485 GGGCGCGGGCGGCGGCGCCGGGG - Intronic
1025261715 7:57424790-57424812 GAGCGCCGACGGCGGCCCCCGGG + Intergenic
1026482403 7:70790221-70790243 GTTGGGAGGCGGCGGCTCCGAGG - Exonic
1026797972 7:73377986-73378008 CAGCGGCGGTGGCGACCCCGAGG - Intergenic
1026806740 7:73433806-73433828 CAGCGGCGGTGGCGGCTAGGCGG + Exonic
1027138199 7:75639204-75639226 CGGCGGCGGCGGCGGCACCAAGG + Intronic
1027244653 7:76358921-76358943 CAGCTGAGGCGGCGGCTGCGCGG + Exonic
1028762314 7:94509848-94509870 GAGCAGCGGCGGCGGGGCTGGGG + Exonic
1029123245 7:98281896-98281918 GGGCGGCGGCGGGGGCGCGGCGG - Exonic
1029281563 7:99438956-99438978 CGGCGGCGGCGGCGGCGGCGAGG + Intronic
1029456207 7:100673813-100673835 CGGCGGCGGCGGCGGCGGCGCGG - Exonic
1029629914 7:101743826-101743848 GGGGGGCGGGGGCGGATCCGGGG - Intergenic
1029640539 7:101816757-101816779 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1029730127 7:102433488-102433510 CAGCGGCTGCGGCGGCCGCGGGG + Intronic
1029834762 7:103297496-103297518 GCGGCGCGGCGGCGGCTCTGGGG + Exonic
1030138701 7:106284564-106284586 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
1032215278 7:129952682-129952704 GGGCGGCGGCGGCGGCTGACGGG - Exonic
1032525590 7:132576748-132576770 GAGCAGCGGCGGCGGCTCTCGGG + Exonic
1033099979 7:138461132-138461154 CAGCGGCGGCGGCGGCGGCGCGG - Intronic
1033288602 7:140062708-140062730 GAGCGGCTGCTGCGGCAGCGTGG - Exonic
1033299948 7:140176702-140176724 GGCCGGCGGTGGCGGCTGCGGGG + Intronic
1033390722 7:140924831-140924853 GAGCGGCCCGGGCGGCGCCGCGG + Intergenic
1033406354 7:141073971-141073993 GAGCCGAGGCGGCTGCTTCGGGG + Intergenic
1033654318 7:143362670-143362692 GAGCGGCTGGGGCGGCGGCGCGG - Exonic
1034222997 7:149460171-149460193 CAGTAGCGGCGGCGACTCCGGGG - Intronic
1034228007 7:149497741-149497763 GGGCCGCGGCGCCGGCTCCCAGG - Exonic
1034262299 7:149764723-149764745 GAGCGGGGGCGGCGCCACCTCGG + Exonic
1034306280 7:150047662-150047684 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1034324788 7:150220542-150220564 GGCCGGCGCCAGCGGCTCCGAGG + Intergenic
1034618274 7:152436656-152436678 CAGCGGCGGCGGCGCGTCCGCGG - Intergenic
1034733984 7:153412220-153412242 GAGCCACAGCGGCCGCTCCGAGG + Intergenic
1034768403 7:153748689-153748711 GGCCGGCGCCAGCGGCTCCGAGG - Intergenic
1034800566 7:154052988-154053010 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1035169564 7:157010032-157010054 GGGCGGCGGCGGCGGCGGCACGG - Exonic
1035169595 7:157010144-157010166 GGGCGCAGCCGGCGGCTCCGAGG + Exonic
1035203321 7:157279899-157279921 GGACGGCGGCGGCCGCTCCCAGG - Intergenic
1035274258 7:157737878-157737900 GGGCGGGGGAGGAGGCTCCGAGG + Intronic
1036665088 8:10732569-10732591 GAGCGGCGGCGGAGGATCCCGGG + Intronic
1036789497 8:11708660-11708682 CAGCGGCGGCGGCGGCCGCCAGG - Exonic
1037260455 8:17001922-17001944 CAGCAGCGGCGGCCGCTCCCCGG + Exonic
1037529218 8:19757329-19757351 CAGCGGCGGCGGCGGCGGCTCGG + Intronic
1037769203 8:21789118-21789140 TGGCGGCGGCGGCGGCGCCGGGG + Intronic
1037882252 8:22579030-22579052 GCGCGGAGGCGGCGGCTTCTCGG + Exonic
1039467911 8:37797107-37797129 GCGCGGCGGCGGGGACCCCGGGG + Intronic
1039595450 8:38787122-38787144 CGGGGGCGGCGGCGGCGCCGGGG - Intronic
1039618236 8:38974159-38974181 GGCCGGCGGAGGCGGCGCCGTGG + Exonic
1039868842 8:41528927-41528949 GAGCGGCGGTGTCCGCCCCGGGG - Intergenic
1040038839 8:42896759-42896781 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1040038840 8:42896762-42896784 CGGCGGCGGCGGCGGCGCGGCGG + Intronic
1041357414 8:57014784-57014806 GAGCGGCTGCGGCTGCACCTTGG + Intergenic
1041552604 8:59118809-59118831 GAGCGGCGGTGGCCGGGCCGCGG - Intronic
1041689925 8:60678793-60678815 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1041689928 8:60678796-60678818 CGGCGGCGGCGGCGGCGCGGGGG + Exonic
1041690145 8:60679618-60679640 GAGCAGCGGCGGCGGCGGCTCGG + Intronic
1041690398 8:60680417-60680439 CGGCGGCGGCGGCGGCTCCCGGG + Intronic
1041839166 8:62248948-62248970 GAGCGGCGGCCGCGGGGCCGAGG + Exonic
1041919804 8:63168843-63168865 CGGCGGCGGCGGCGGCTCTCGGG + Exonic
1042040127 8:64581060-64581082 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
1042785093 8:72537379-72537401 CAGCGGCGGCGGCGGCCGCGGGG - Exonic
1043053343 8:75407903-75407925 GAGATGCGGCGGCGGCCGCGCGG + Intronic
1043563483 8:81522270-81522292 GAGCGGCGGCGGGGGGACCTTGG + Intergenic
1043769722 8:84183352-84183374 AGGCGGCGGCGGCGGCGACGGGG - Intronic
1043847281 8:85177515-85177537 CGGCGGCGGGGGCGGCTGCGGGG - Exonic
1044306354 8:90645605-90645627 GAGTGGCGGCGGCGGCGTGGTGG - Exonic
1044802354 8:95970550-95970572 GAGCGGGGGCGGGGGGTCAGTGG - Intergenic
1045098773 8:98825461-98825483 AAGCGGCGCCGGCGGCCGCGGGG - Intronic
1045516292 8:102863625-102863647 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1046547209 8:115667939-115667961 CGGCGGCGGCGGCGGCCCCTCGG + Intronic
1046547418 8:115669074-115669096 GCGGGGCGGCGGCGGCGGCGCGG - Intronic
1046547429 8:115669103-115669125 GGGCGGCGGCGGCGGGTGCTCGG - Intronic
1046659968 8:116938488-116938510 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1046962423 8:120125131-120125153 GAGAGGCGGAGGCAGCTCCAGGG + Exonic
1048214269 8:132480880-132480902 CGGCGGCGGCGGCGGCACCCAGG + Exonic
1048554002 8:135457700-135457722 AGGCGGCGGCGGCGGCACGGGGG - Exonic
1048882592 8:138883094-138883116 GAGTGGGGGCGGCGGCTGCCAGG - Exonic
1049145971 8:141001240-141001262 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1049405533 8:142450384-142450406 GGGAGGAGGCGGCGGCGCCGAGG - Intronic
1049460912 8:142727325-142727347 TAGCGGCGGCGGCGGGCGCGGGG - Exonic
1049585299 8:143430160-143430182 CGGCGGCGGCGGCGGCGCGGGGG - Exonic
1049585303 8:143430163-143430185 CACCGGCGGCGGCGGCGGCGCGG - Exonic
1049653665 8:143788439-143788461 GAGAGGCAGCGGCGGCCCCAGGG + Intergenic
1049668389 8:143858958-143858980 GGGCGGCGGCGGCGGCCTCCTGG + Exonic
1049669635 8:143863761-143863783 GGGCGGCGGCGGCGGCCTCCTGG + Exonic
1049689786 8:143953447-143953469 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1049718248 8:144103805-144103827 GACCGGCGGAGGGGGCTCAGCGG - Exonic
1049761369 8:144333223-144333245 GGGCGGCGCCGGAGGCCCCGCGG - Exonic
1049936439 9:504973-504995 GAGAGGTGGCGTCGGCCCCGCGG + Intronic
1050744150 9:8857759-8857781 CGGCGGCGGCCGCTGCTCCGCGG - Intronic
1050874042 9:10613177-10613199 CGGCGGCGGCGGCGGCGCTGCGG + Intergenic
1051289113 9:15527703-15527725 CGGCGGCGGCGGCTGCTGCGCGG + Intergenic
1052192789 9:25678177-25678199 CAGCGGCGGCGGCGGCGGCGTGG - Exonic
1052872730 9:33523963-33523985 GCCCGGCGGCGGCTGCACCGGGG + Intergenic
1053011688 9:34637360-34637382 GAGCTGCGGCGGCTGCACCCAGG - Exonic
1053034108 9:34810010-34810032 GGGCGGCGGCGGCGGCGCGTGGG - Intergenic
1053138277 9:35665241-35665263 GAGCCGCGGAGGCGGGGCCGGGG + Exonic
1053240025 9:36487690-36487712 AAGCGGCGGCGGCGGCGGAGGGG + Intergenic
1053690490 9:40584409-40584431 GGGCGGCGGCGGCGGCGCGGCGG - Intergenic
1053697505 9:40651092-40651114 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1053752683 9:41273148-41273170 GCTCGGCGGCGGCTGCACCGGGG - Intergenic
1054258211 9:62837500-62837522 GCTCGGCGGCGGCTGCACCGGGG - Intergenic
1054308797 9:63450501-63450523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1055091119 9:72365284-72365306 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1055514158 9:77020142-77020164 GGGCGGCGGCGGCGGCGGCTGGG - Exonic
1055611776 9:78031582-78031604 CGGCGGCGGCGGCGGCTCGGGGG - Intergenic
1055632246 9:78236299-78236321 GGGCGCGGGCGGCGTCTCCGCGG + Exonic
1056475070 9:86945807-86945829 CAGCGGCGGCGGCGGCCGCTTGG - Exonic
1056799517 9:89681436-89681458 GAGGGGGGGCGGCGGCTGCTGGG - Intergenic
1057024310 9:91724043-91724065 GAGCTGCGGCGGGGGCACCATGG + Exonic
1057152722 9:92809013-92809035 GCCCGGCGGCGGCTGCACCGTGG + Intergenic
1057488651 9:95506156-95506178 GAGCGGCGGGGGCGGGACGGGGG - Intronic
1057682249 9:97199846-97199868 GGGCGGCGCCGGCGGCTGCCAGG - Intergenic
1057773162 9:97984464-97984486 GTGCCGCGGCGGCGGCGCCCGGG + Intronic
1057786002 9:98087739-98087761 GGGCGGCGGCCGAGGCCCCGCGG + Exonic
1058176227 9:101738600-101738622 AAGCGGCGGTGGCGACTCGGTGG - Intergenic
1058504757 9:105656219-105656241 AGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1059061442 9:111038349-111038371 GGGCGGCGGGGAGGGCTCCGCGG + Intronic
1059234502 9:112750692-112750714 GGGCGGCCGCGGCGCCTCGGGGG + Intergenic
1059299787 9:113303062-113303084 AGGCGGAGGAGGCGGCTCCGAGG - Intronic
1059405836 9:114098086-114098108 GAGCGCCGGCGGCGCCCCCGCGG - Intronic
1059483716 9:114611539-114611561 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1059633936 9:116154342-116154364 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
1060468739 9:123930174-123930196 GGGCAGCGGCGGCGGCAGCGCGG - Intergenic
1060566773 9:124599585-124599607 GCGCGGCGGCGGCGGCCGCTCGG + Intronic
1060583371 9:124771065-124771087 GGGAGGCGGCGGGGGCTCGGCGG - Exonic
1060700751 9:125747379-125747401 CGGCGGCGGCGGCGGCGACGAGG - Intronic
1061028954 9:128068264-128068286 GAGCGGGGGCGGCGGGCCGGCGG - Exonic
1061196659 9:129110566-129110588 CAGCCGCGGCGGCGGCGGCGCGG - Exonic
1061208312 9:129176910-129176932 GAGCGGCGGCGGCTGCTCCGAGG + Exonic
1061321825 9:129835638-129835660 GAGGGGCGGCGGCGGCCGGGGGG - Intronic
1061726955 9:132587276-132587298 GGGCACCGGCGGCGGCTGCGAGG + Intronic
1061727419 9:132589455-132589477 CAGCGGCGGGGGCGGCTCGCTGG - Exonic
1061802766 9:133121191-133121213 GCGCGGCGGGGGCGGCGGCGCGG + Intronic
1061808460 9:133149144-133149166 GAGCGGCGCTGGCGGCTGCCGGG - Intronic
1061951214 9:133936899-133936921 GTGAGGCGGCTGCGGCTCTGAGG - Intronic
1062272237 9:135714816-135714838 GAAGGGCGCCGGCGGCTGCGGGG - Intronic
1062277232 9:135736746-135736768 GGCCCGCGGCGGGGGCTCCGTGG + Intronic
1062305905 9:135907126-135907148 GAGCGGCCGCGCCGCCGCCGAGG - Exonic
1062408664 9:136410430-136410452 GCCCGGCAGCGGCGGCTCCATGG + Exonic
1062533208 9:137010663-137010685 GAGCGGCAGCGAGTGCTCCGGGG - Exonic
1062547473 9:137070151-137070173 GAGCGCCGACGGCGGCCCCCGGG - Exonic
1062558713 9:137129598-137129620 AAGCAGCGGCGGCGGATGCGTGG + Intergenic
1062560406 9:137139191-137139213 CGGCGGCGGCGGCGGCTCCGCGG - Intronic
1062574565 9:137200220-137200242 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1062594995 9:137295545-137295567 GCACAGCCGCGGCGGCTCCGAGG + Intergenic
1062659103 9:137619092-137619114 CAGCGGCGGAGGCGGCGCGGGGG + Intronic
1062659130 9:137619172-137619194 CAGCGGCGGCGGCGGCGGCGGGG - Intronic
1062718671 9:138023600-138023622 GAGCGGCGCGCGCGGCACCGCGG + Exonic
1202779853 9_KI270717v1_random:24389-24411 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1202800563 9_KI270719v1_random:170876-170898 GCCCGGCGGCGGCTGCACCGGGG + Intergenic
1203773591 EBV:61239-61261 CAGCGGTGGCGGCGGCCCCGCGG - Intergenic
1203782390 EBV:107926-107948 GAGCGGCGGCGGTTGCGCCCGGG - Intergenic
1203469641 Un_GL000220v1:110968-110990 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203469879 Un_GL000220v1:111682-111704 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203471023 Un_GL000220v1:115501-115523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203477462 Un_GL000220v1:154940-154962 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203477700 Un_GL000220v1:155654-155676 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203478844 Un_GL000220v1:159473-159495 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1185736644 X:2500931-2500953 AAGCGGCGGCGGCGCGGCCGGGG - Exonic
1186496379 X:10015322-10015344 CGGCGGCGGCGGCGGCTCCCGGG + Intergenic
1187419545 X:19122534-19122556 GAGCGGCGGGGGCGGCGCCGAGG - Exonic
1187518142 X:19990921-19990943 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1187535918 X:20141693-20141715 CCGCGGCGGCTGCTGCTCCGAGG + Exonic
1188003525 X:25002645-25002667 GGCCGGCGGCGGCGGCGGCGTGG + Intergenic
1189321507 X:40090271-40090293 GAGGGGAGACGGCGGCGCCGGGG + Intronic
1189324595 X:40105100-40105122 CAGCAGCGGCGGCGGCGGCGAGG + Intronic
1189324596 X:40105103-40105125 CAGCGGCGGCGGCGGCGAGGAGG + Intronic
1189396063 X:40623877-40623899 CTACGGCGGCGGCGGCGCCGAGG + Intergenic
1190008062 X:46758964-46758986 CAGCCGCGGCGGCGGCGCCCCGG + Exonic
1190712929 X:53082575-53082597 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1192034375 X:67546547-67546569 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1192363282 X:70452473-70452495 CGGCGGCGGCAGCGGCTGCGCGG + Intronic
1192394259 X:70762650-70762672 GAGCGGCGGTGGGGGATCGGGGG - Intronic
1192705550 X:73526116-73526138 GAGCGGCGGCTGCGGCTCCGGGG - Intergenic
1195668350 X:107449918-107449940 GCGCGGCAGCGGCGGCGCAGCGG - Intergenic
1195716840 X:107826301-107826323 TAGCGGCGGCGGCGGCGACCGGG + Exonic
1195954792 X:110317828-110317850 GGGCTGCGGCGGCGGCGGCGGGG - Exonic
1196819567 X:119692457-119692479 GGCGGGCGGCGGCGGCGCCGGGG - Intronic
1196851554 X:119943475-119943497 GAGCGAGAGCGGCGGCCCCGCGG + Exonic
1197202991 X:123765040-123765062 GAGCGGCGGAGGCGGCTCAGCGG + Intergenic
1197415264 X:126165966-126165988 CGGCGGCGGCGGCGGCCCGGCGG + Intergenic
1198533581 X:137566823-137566845 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
1198767097 X:140091348-140091370 CGGCGGCGGCGGCGGCTGGGAGG + Intergenic
1198767126 X:140091427-140091449 CGGCGGCGCCGGCGGCTGCGGGG + Intergenic
1199458071 X:148052173-148052195 AGGCGGCGGCGGTGGCTGCGCGG - Intergenic
1199772734 X:150984361-150984383 GGGCGGCGGCGGCGGGGCCCGGG + Intronic
1200000317 X:153056673-153056695 GAGGGGCGGCGGAGTCTCCCGGG - Intronic
1200003237 X:153072641-153072663 GAGGGGCGGCGGAGTCTCCCGGG - Intronic
1200004486 X:153077368-153077390 GAGGGGCGGCGGAGTCTCCCGGG + Intergenic