ID: 1144109824

View in Genome Browser
Species Human (GRCh38)
Location 17:12020953-12020975
Sequence CCCGTAGGGTCCCCGGCGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144109805_1144109824 28 Complete closest: 21
total_pairs: 16
max_distance: 1000
Left 1144109805 17:12020902-12020924 CCGAGCGGCGGCGGCGGCTCCGG 0: 1
1: 0
2: 15
3: 157
4: 479
Right 1144109824 17:12020953-12020975 CCCGTAGGGTCCCCGGCGCCAGG 0: 1
1: 0
2: 2
3: 10
4: 107
1144109813_1144109824 9 Complete closest: 20
total_pairs: 38
max_distance: 1000
Left 1144109813 17:12020921-12020943 CCGGGGGCGGCAGCGGCAGCGGC 0: 1
1: 4
2: 31
3: 252
4: 981
Right 1144109824 17:12020953-12020975 CCCGTAGGGTCCCCGGCGCCAGG 0: 1
1: 0
2: 2
3: 10
4: 107
1144109804_1144109824 29 Complete closest: 21
total_pairs: 19
max_distance: 1000
Left 1144109804 17:12020901-12020923 CCCGAGCGGCGGCGGCGGCTCCG 0: 1
1: 2
2: 16
3: 113
4: 533
Right 1144109824 17:12020953-12020975 CCCGTAGGGTCCCCGGCGCCAGG 0: 1
1: 0
2: 2
3: 10
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144109824 Original CRISPR CCCGTAGGGTCCCCGGCGCC AGG Exonic
901276090 1:7991961-7991983 ACAGTAGGGCCCCAGGCGCCAGG - Intergenic
902516817 1:16993910-16993932 CCCATAGGGTCCGCCGGGCCTGG - Intronic
904774919 1:32900867-32900889 CCAGAAGGGACCCCGGGGCCAGG - Intronic
907471110 1:54674019-54674041 CCCTTGGGGTTCCCGGCGCTGGG + Exonic
907482494 1:54754669-54754691 CCTGTGGGGTCCCCCTCGCCTGG - Intergenic
908272843 1:62437286-62437308 CCCGCCGGGTCCCCGGCCCCAGG - Exonic
908473911 1:64470490-64470512 CCCGAGCGGTCCCCGGAGCCCGG - Intergenic
914170043 1:145215180-145215202 CCCCGGGGGTCCTCGGCGCCGGG + Intergenic
914525160 1:148459143-148459165 CCCCGGGGGTCCTCGGCGCCGGG + Intergenic
914598516 1:149176687-149176709 CCCCGGGGGTCCTCGGCGCCGGG - Intergenic
914641243 1:149607991-149608013 CCCCGGGGGTCCTCGGCGCCGGG - Intergenic
920616339 1:207496298-207496320 CCTGTCGGGCCGCCGGCGCCCGG + Exonic
1064354351 10:14604142-14604164 CCGAGAGGGTCCCCGGAGCCGGG + Intronic
1064712487 10:18140998-18141020 GGGGCAGGGTCCCCGGCGCCAGG - Intronic
1069988154 10:72298030-72298052 CCCGTAGGATCGCGGGCGCGCGG + Intergenic
1073563778 10:104518626-104518648 TCCCTAGGGTCCCTGGCCCCAGG - Intergenic
1074412953 10:113243658-113243680 CCCTTAGGGTCCCTGGGTCCTGG + Intergenic
1075748575 10:124744549-124744571 CCCGTAGGGCCTCTGGCGCGGGG - Intronic
1076692208 10:132229681-132229703 CCAGTAAGGGCCCCGGAGCCAGG - Intronic
1077330480 11:1981970-1981992 CCCTTGGGGGCCCCGGCCCCAGG - Intronic
1081861520 11:46335799-46335821 CCCCTGGGGTCCCCTGGGCCTGG - Intronic
1202813458 11_KI270721v1_random:37149-37171 CCCTTGGGGGCCCCGGCCCCAGG - Intergenic
1096123509 12:49103798-49103820 CCCGTAGGGTGTCCTGGGCCGGG - Exonic
1104175971 12:126333053-126333075 CCCTTAGGGACCCTGGCGCTGGG + Intergenic
1104966612 12:132511258-132511280 CCTGTGGGGTCCCCCTCGCCTGG - Intronic
1105202791 13:18194327-18194349 CCTCTAGGGTCCTGGGCGCCCGG - Intergenic
1105704369 13:22960313-22960335 CCCGAAGGGTCCCCTTCGCTGGG - Intergenic
1105857320 13:24385365-24385387 CCCGAAGGGTCCCCTTCGCTGGG - Intergenic
1107774404 13:43822895-43822917 CCCTTGGGGTCCCCGGTTCCAGG - Intergenic
1117647255 14:57865568-57865590 CCCGGGGGGTCCCCGCCGCCAGG + Intronic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1124014296 15:25862972-25862994 GCCGCAGGGTCCTCGGCGCCCGG + Exonic
1124712904 15:32030303-32030325 CCCGGAGCGTACCCAGCGCCGGG + Intergenic
1128866006 15:71115625-71115647 CCCGCGTGGTTCCCGGCGCCGGG - Intronic
1129322257 15:74781977-74781999 CCCGCAGTGCCCCCGGCGCCCGG + Intergenic
1132729156 16:1352095-1352117 CCCGTAGGGCCCGCGCCGGCAGG + Exonic
1134529791 16:14974659-14974681 CTCGCAGCGTCCTCGGCGCCCGG - Intronic
1139851436 16:69953169-69953191 CCCGGAGGGTGCTCGGGGCCGGG - Intronic
1139866557 16:70066303-70066325 CTCGCAGCGTCCTCGGCGCCCGG + Intergenic
1139880413 16:70176081-70176103 CCCGGAGGGTGCTCGGGGCCGGG - Intronic
1140372097 16:74419436-74419458 CCCGGAGGGTGCTCGGGGCCGGG + Intronic
1141553229 16:84819936-84819958 CTTGTAGGCTCCCCGGAGCCCGG - Intergenic
1141741956 16:85899271-85899293 CCCGCGGGGTCCCCGACGCCAGG + Intronic
1141972251 16:87492263-87492285 CCCGCGCGGTCCCCGGCCCCGGG - Intergenic
1142147240 16:88497743-88497765 CACGAAGGGTCCCCCGCCCCAGG + Intronic
1142638140 17:1270458-1270480 CGCGGACGGTCCCCGGCTCCTGG - Intergenic
1143904533 17:10198457-10198479 TCCGCGGGGTCCCAGGCGCCCGG + Exonic
1144109824 17:12020953-12020975 CCCGTAGGGTCCCCGGCGCCAGG + Exonic
1146492428 17:33292396-33292418 CCTGGAGGATGCCCGGCGCCCGG + Exonic
1151478460 17:74356533-74356555 GCCCTAGGGTGGCCGGCGCCTGG + Exonic
1152108114 17:78342339-78342361 CCCCGAGGGACCCCGCCGCCCGG + Intergenic
1152345241 17:79747385-79747407 CCCTGAGAGTCCCCCGCGCCAGG - Intergenic
1152564491 17:81094084-81094106 CCCTCAGTGTCCCCGGGGCCAGG + Intronic
1152781323 17:82228592-82228614 CCCGTGGGGTTCCGGCCGCCTGG - Intronic
1152946492 17:83200497-83200519 GCCGTACGGTCCCCGAGGCCAGG + Intergenic
1159928791 18:74291963-74291985 CCAGTGGGGTTCCCGGCGCGGGG - Exonic
1160454863 18:78993026-78993048 CCAGCAGGGACCCCGGGGCCAGG - Exonic
1161982535 19:7637396-7637418 CCCTTTGGGTCCCCGGAGTCCGG - Intronic
1162033433 19:7926935-7926957 CCTGCAGGGGTCCCGGCGCCTGG - Exonic
1162373344 19:10291558-10291580 GCTGTAGGGTCCCCGGCGCCGGG + Exonic
1162925822 19:13930115-13930137 CACGGAGGCTGCCCGGCGCCTGG + Exonic
1163250272 19:16122662-16122684 CCAGCAGGTTCCCCGGGGCCAGG - Intronic
1165245036 19:34493864-34493886 CCAGGAGGGTCCCCTGTGCCAGG - Intronic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1166126332 19:40717265-40717287 CCCGCCGGGGCCCCTGCGCCGGG - Exonic
1167436209 19:49480317-49480339 CCCATGGAGTCCCCGGCCCCTGG + Exonic
1168640062 19:58025138-58025160 CCTGTAGAGTCCCAGGAGCCTGG + Intergenic
932591532 2:73070818-73070840 CGCGGAGGGTCTCCCGCGCCCGG - Intronic
933875932 2:86622623-86622645 CCCCTAGGGTCCCCTCCACCTGG - Intronic
935361595 2:102250703-102250725 ACCCTAGGGTCCCCGCGGCCTGG - Intergenic
936278618 2:111120385-111120407 CTCTGAGGGTCCCTGGCGCCGGG - Intronic
938598931 2:132817694-132817716 CTGGTAGGGTTCCCAGCGCCTGG + Intronic
941089692 2:161160434-161160456 CCCCTCAGGTCGCCGGCGCCTGG - Exonic
946163106 2:217847928-217847950 CCCAGAGTGTCCCCGGGGCCTGG - Exonic
1173865016 20:46307943-46307965 CCCGGAGGCTCCCGGGCGCGCGG + Intronic
1175847024 20:62064840-62064862 CCCGCGGGGCCCCCGGCGGCCGG + Exonic
1176380619 21:6110790-6110812 CCCGCAGTGCCCCCAGCGCCCGG + Intergenic
1179742853 21:43427450-43427472 CCCGCAGTGCCCCCAGCGCCCGG - Intergenic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
949926692 3:9047584-9047606 CCCGCAGGGACCCCGGCGCAGGG + Intronic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
961369120 3:126418909-126418931 CCCGTAGTGTCCCCTGCCCTTGG - Intronic
964876167 3:161371519-161371541 CCGGGAGGCTCCCAGGCGCCCGG - Exonic
968323453 3:197791566-197791588 CCCGTCGGAGACCCGGCGCCGGG + Intronic
969249659 4:5958611-5958633 CCTGTGAGGTCCCCGGCGCCAGG + Exonic
969618118 4:8265462-8265484 TCTGTAGGGTCCCAGGGGCCTGG - Intergenic
976199064 4:82561715-82561737 CCCATAGCGTCCCGGGCGCGGGG - Intronic
989983324 5:50667612-50667634 CCCCGGGGGTCCTCGGCGCCGGG - Intronic
990381774 5:55226788-55226810 CCCCTCGGGTTCCCCGCGCCGGG - Intronic
991927414 5:71719106-71719128 CCCGCCGGGTTCCAGGCGCCTGG - Intergenic
1001652784 5:173327663-173327685 CCCAGAGGGTCCCCGGAGCTGGG - Intronic
1003886069 6:10522541-10522563 GCTGTAGGGTCCCCAGGGCCTGG - Intronic
1006083521 6:31580983-31581005 CCCTGGGGGTCCCCGCCGCCAGG + Exonic
1006614709 6:35318484-35318506 CCGGTCCCGTCCCCGGCGCCGGG - Intronic
1014079581 6:117270993-117271015 CGCGAAGGGTCCCCCGGGCCCGG - Exonic
1018866196 6:167748528-167748550 CCCGTTGGAGCCCCGGCCCCAGG - Intergenic
1019057125 6:169231906-169231928 CGCGTAGCGTCCCCGGCGCCAGG + Intronic
1019508969 7:1407744-1407766 CCCGGACGGTCACCGGCCCCTGG - Intergenic
1019522722 7:1467977-1467999 CCCAGAGGGTCCCAGGCCCCAGG + Intergenic
1025940961 7:66075982-66076004 CCAGCAGGGTCCCCCGGGCCGGG - Intronic
1030375092 7:108745274-108745296 CCCATAGGGTCTCCAGAGCCTGG + Intergenic
1031629696 7:124032357-124032379 GCAGTAGGGACCCGGGCGCCGGG + Exonic
1032781978 7:135170806-135170828 CCGGAAGTGTCCCGGGCGCCGGG - Intergenic
1032802329 7:135326982-135327004 CAGGTAGGGTCCCTGGAGCCAGG + Intergenic
1034820989 7:154216139-154216161 CCCGTGGGGTCCCTGGAGCCAGG - Intronic
1035023071 7:155809988-155810010 GCTGTAGTGTCCCCGGCGGCGGG - Intronic
1038761186 8:30384989-30385011 CCCGAGGGAGCCCCGGCGCCCGG + Exonic
1039591984 8:38757181-38757203 GCCGTAGGGTCCCCGCCGCTGGG - Intronic
1039618208 8:38974066-38974088 CCCGTCGGCGCCCCGGAGCCAGG - Intergenic
1046848945 8:118951753-118951775 GCCGACGGGTGCCCGGCGCCTGG - Intronic
1048296720 8:133220269-133220291 CCTGCAGGGTCCCCAGCACCAGG - Intronic
1049456415 8:142693298-142693320 CCTGGAGGATCCCCGGCTCCAGG + Intergenic
1049600581 8:143505604-143505626 CCCGAAGGGTCCCAGACGCCTGG + Intronic
1049710487 8:144060880-144060902 GCCCTCGGGTCTCCGGCGCCGGG + Intronic
1054285395 9:63163643-63163665 CCCGTGGGCTCCCCAGCGGCCGG - Intergenic
1054389425 9:64601380-64601402 CCCGTGGGCTCCCCAGCGGCCGG + Intergenic
1060881990 9:127123800-127123822 CCCGCAGGGTGCCCGGCAGCAGG - Intronic
1061144056 9:128787045-128787067 CCCGCAGGGTCGGCGGCGCTGGG + Intergenic
1062525613 9:136976966-136976988 CCCGCAGGGTCCCGAGGGCCAGG - Intergenic
1192374884 X:70549461-70549483 CTCCTAGGGTCCCCGGTTCCAGG + Intronic