ID: 1144110003

View in Genome Browser
Species Human (GRCh38)
Location 17:12021467-12021489
Sequence AGCGGGGCCCACTGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144110003_1144110015 11 Left 1144110003 17:12021467-12021489 CCGCCGCCGCAGTGGGCCCCGCT 0: 1
1: 0
2: 0
3: 9
4: 189
Right 1144110015 17:12021501-12021523 TGGCTGTCGCCGGGCACAGCTGG 0: 1
1: 0
2: 0
3: 15
4: 190
1144110003_1144110016 17 Left 1144110003 17:12021467-12021489 CCGCCGCCGCAGTGGGCCCCGCT 0: 1
1: 0
2: 0
3: 9
4: 189
Right 1144110016 17:12021507-12021529 TCGCCGGGCACAGCTGGAGCCGG 0: 1
1: 0
2: 1
3: 18
4: 161
1144110003_1144110008 -9 Left 1144110003 17:12021467-12021489 CCGCCGCCGCAGTGGGCCCCGCT 0: 1
1: 0
2: 0
3: 9
4: 189
Right 1144110008 17:12021481-12021503 GGCCCCGCTCAGGGCCATCTTGG 0: 1
1: 0
2: 2
3: 12
4: 222
1144110003_1144110013 2 Left 1144110003 17:12021467-12021489 CCGCCGCCGCAGTGGGCCCCGCT 0: 1
1: 0
2: 0
3: 9
4: 189
Right 1144110013 17:12021492-12021514 GGGCCATCTTGGCTGTCGCCGGG 0: 1
1: 0
2: 0
3: 16
4: 107
1144110003_1144110012 1 Left 1144110003 17:12021467-12021489 CCGCCGCCGCAGTGGGCCCCGCT 0: 1
1: 0
2: 0
3: 9
4: 189
Right 1144110012 17:12021491-12021513 AGGGCCATCTTGGCTGTCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144110003 Original CRISPR AGCGGGGCCCACTGCGGCGG CGG (reversed) Intronic
901598976 1:10407656-10407678 AGATGGGCCCAGTGCGGTGGTGG + Intronic
902938308 1:19780686-19780708 AGCTGAGCCCACTGCAGAGGGGG - Exonic
902943195 1:19815021-19815043 AGCAGGGGCCACAGCGGTGGTGG + Exonic
904496062 1:30887373-30887395 AGCGAGGCCCAGTGAGGCGAAGG - Intronic
906034342 1:42741191-42741213 AGTGGGCCCCACTGCAGCGTGGG + Intergenic
906294011 1:44638005-44638027 AGCGGGGCGCAGTGGAGCGGAGG + Intronic
910450146 1:87335541-87335563 CGCCGGGCTCACTGCGGCTGCGG - Intronic
910597095 1:88992451-88992473 TGCGGGGCCGCCTGCGGGGGTGG - Intronic
915309803 1:155001288-155001310 AGGGAGGCCCCCTGCGGAGGGGG + Intergenic
919809561 1:201399884-201399906 AGCGAGGCCTACTGGGACGGTGG - Intergenic
920444527 1:206005862-206005884 TGTGGGGCCCACTGCTGCCGAGG + Intergenic
1065069024 10:22003343-22003365 AGCGGCGTCCGCGGCGGCGGCGG + Exonic
1070954472 10:80454914-80454936 AGTGGGACCCACGGCGGCGTGGG - Intronic
1071997522 10:91162885-91162907 AGCAGAGCCCGCGGCGGCGGCGG - Intergenic
1075234078 10:120710811-120710833 AGCAGGGCCCACAGGGGCAGTGG - Intergenic
1075629460 10:123992231-123992253 AACTGGGCCCAGGGCGGCGGGGG + Intergenic
1076749827 10:132537218-132537240 AGGGGAGCCCACCGGGGCGGCGG - Intergenic
1079284534 11:19117119-19117141 AGCGGGGACCGCAGCGGCGGAGG + Exonic
1080606603 11:33869490-33869512 AGCGGCGGCGACGGCGGCGGCGG - Exonic
1083545698 11:63547440-63547462 AGCTGGGCCCTCTGCTGTGGAGG - Intergenic
1084418577 11:69049034-69049056 GGCGGGGCCCGCGGCGGTGGCGG + Exonic
1085052674 11:73387847-73387869 AGCGGGGGCCTCAGCCGCGGCGG + Intronic
1089700246 11:120240220-120240242 AGCGGCTCCCGCGGCGGCGGCGG + Intronic
1089713631 11:120336186-120336208 AGCGCGGCCCTGAGCGGCGGAGG + Intergenic
1089943370 11:122442143-122442165 AGCGGAGCCCATGGCAGCGGAGG - Intergenic
1090001192 11:122960352-122960374 AGAGGGGGCCACTGTGGCAGTGG - Intergenic
1091134854 11:133179494-133179516 AGCGGGGCCCCCTGAGGCCAGGG + Intronic
1092201048 12:6583136-6583158 AGCGGGGCCCACTGCTCTAGTGG + Intronic
1095225060 12:39669741-39669763 AGGGGCGCCCACCACGGCGGAGG - Intronic
1096528755 12:52230568-52230590 AGCAGGGGCCACTGGGGCAGAGG + Intergenic
1096616032 12:52834103-52834125 GGCGGGGCCCACTGTGGCCCCGG - Exonic
1098161042 12:67648654-67648676 GGCGGGGCCTGCGGCGGCGGAGG + Intronic
1098416776 12:70243513-70243535 AGCGGGGCGCGCGGCGGGGGCGG + Intronic
1098426064 12:70366545-70366567 AGCGACGCCCCCGGCGGCGGCGG - Exonic
1098951533 12:76645158-76645180 AGAGGGGCCCAAAGCGGCAGGGG - Intergenic
1102887515 12:116533336-116533358 GGCGGGGCCCACGCCGGAGGGGG - Intergenic
1104841570 12:131828383-131828405 CGCGGGGCTCAGTCCGGCGGGGG + Exonic
1104954908 12:132459587-132459609 AGGGGGGCTCTCTGCAGCGGAGG + Intergenic
1105943555 13:25171225-25171247 GGCGGGGGCGACAGCGGCGGGGG - Exonic
1106517017 13:30464938-30464960 GGCGGCCCCCACCGCGGCGGGGG - Intronic
1107605279 13:42049443-42049465 AGCAGGGCTCACTGCAGCGCAGG - Intronic
1108648768 13:52455472-52455494 CGCGGTGCAGACTGCGGCGGCGG + Exonic
1109789842 13:67231194-67231216 AGCGGGACCGGCCGCGGCGGTGG + Intergenic
1113709655 13:112455032-112455054 AGCCAGGCCCACTGAGGCAGGGG + Intergenic
1113967341 13:114161481-114161503 CGCGGCGGCCACAGCGGCGGGGG + Intergenic
1115399321 14:32939423-32939445 AGAGGGGCCCTCGGCGGCGGAGG - Intronic
1117170597 14:53090710-53090732 ACCGGGCCCCACTGGGGTGGGGG + Intronic
1117297481 14:54393206-54393228 ACCTGGGCCCACAGCTGCGGAGG - Intergenic
1117675605 14:58152142-58152164 AGCGGCGGGCCCTGCGGCGGCGG + Exonic
1121751638 14:96362990-96363012 AGCTGGGCTGACTGCGGCTGCGG + Exonic
1124109367 15:26772628-26772650 AGCGCGACCCACGGCGGCGGCGG - Intronic
1124584469 15:30991956-30991978 TGCGGGGGCCACGGCGGCAGCGG + Intergenic
1126849871 15:52790373-52790395 AGGGCGGGCCGCTGCGGCGGCGG - Intronic
1127165778 15:56243819-56243841 AGCGGCGGCCGCGGCGGCGGCGG - Intergenic
1128513492 15:68327681-68327703 AGCGGGGCTCCCTGCTGCTGGGG + Intronic
1132342848 15:101088948-101088970 AGCGGGGCGCACCCTGGCGGCGG - Intergenic
1132457913 16:34217-34239 TGCTGGGCCCACTGTGGGGGTGG + Intergenic
1132572393 16:649697-649719 AGCCGGGGCCACTGCGGGGCTGG - Intronic
1132685078 16:1158833-1158855 AGCGGGGCCCTGTGGGGCCGGGG - Intronic
1132764274 16:1526459-1526481 AGCTGGGCAGACAGCGGCGGTGG - Intronic
1132791295 16:1690166-1690188 TGAGGGCCCCACTGCTGCGGCGG - Intronic
1133784415 16:8963574-8963596 GGCGGGCCCCGCGGCGGCGGCGG - Intronic
1136479522 16:30532990-30533012 AGCGGGGGCGACTCCGGCGCCGG + Exonic
1136768474 16:32811550-32811572 AGCGGCGGCAACAGCGGCGGCGG + Intergenic
1137547788 16:49416256-49416278 AGGGGGGCCTTCTGCGCCGGGGG + Intergenic
1139459405 16:67109951-67109973 AGCGGGGGCAACGACGGCGGCGG - Intronic
1139896138 16:70289330-70289352 CCTGGGGCCCACTGCGGCTGCGG + Intronic
1142182532 16:88678269-88678291 AGCGGGGGCCACTGGGCCGGAGG - Exonic
1142197167 16:88744290-88744312 AGCGGGGCCCTCTGTGGCACTGG + Intronic
1203070871 16_KI270728v1_random:1073604-1073626 AGCGGCGGCAACAGCGGCGGCGG + Intergenic
1142586854 17:979444-979466 AGCGGGGGCCGGGGCGGCGGCGG - Exonic
1142684958 17:1572266-1572288 AGGGGGGACCTCTGTGGCGGGGG - Intronic
1143181634 17:4987431-4987453 AGCGGCGCCCCCTGGCGCGGGGG + Intronic
1143554277 17:7651020-7651042 AGCGGAGACCACTGCACCGGTGG - Intronic
1144110003 17:12021467-12021489 AGCGGGGCCCACTGCGGCGGCGG - Intronic
1145144256 17:20467473-20467495 AGCGGTGGCCACAGAGGCGGTGG - Exonic
1145175707 17:20698873-20698895 AGCGGTGGCCACAGAGGCGGTGG - Intergenic
1145791608 17:27631239-27631261 AGCGGTGGCCACAGAGGCGGCGG + Exonic
1147438727 17:40433775-40433797 AGCAGGGCCCACTGGGCAGGAGG + Intergenic
1147581939 17:41631942-41631964 AGATGGGCCCACTGAGGCAGAGG - Intergenic
1152433103 17:80260507-80260529 CGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433115 17:80260534-80260556 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433128 17:80260564-80260586 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433141 17:80260594-80260616 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433154 17:80260624-80260646 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433167 17:80260654-80260676 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433180 17:80260684-80260706 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433193 17:80260714-80260736 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433206 17:80260744-80260766 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433219 17:80260774-80260796 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433232 17:80260804-80260826 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152524346 17:80879124-80879146 AGTGGGGCACACTGCAGCTGAGG - Intronic
1152687187 17:81700498-81700520 AGCAGGGGCCACTGGGGCGCAGG + Exonic
1154047203 18:10916771-10916793 AGCGGGCCCCAAGGCGGAGGAGG + Intronic
1160990118 19:1857037-1857059 AGCGGGGCCGGCTGGGGCTGCGG - Intronic
1161014878 19:1978590-1978612 AGGGACGCCCTCTGCGGCGGAGG - Exonic
1161428515 19:4217480-4217502 AGCGGGGCCAGCGGGGGCGGTGG + Exonic
1162485921 19:10960684-10960706 AGCGGACGCCACTGCGGCGGCGG - Intergenic
1162751762 19:12833860-12833882 CGCGGGGACCGCGGCGGCGGCGG - Intronic
1163480909 19:17555786-17555808 GGCGGGGCCCCCGGCGGCAGTGG - Exonic
1165349621 19:35268876-35268898 AGCGGCGGCGGCTGCGGCGGCGG + Intergenic
1165493942 19:36141111-36141133 AGCGGGGCCGGGGGCGGCGGCGG + Exonic
1165928632 19:39342506-39342528 AGAGGGGGCGACGGCGGCGGCGG + Exonic
1166375228 19:42324066-42324088 CGCGGGGCGAACTCCGGCGGCGG - Intronic
1166986159 19:46661008-46661030 AGCGGGGCCGGCTGCGGGGCTGG - Exonic
1167199045 19:48051232-48051254 AGCAGGGCCAACTCCTGCGGAGG - Intronic
1167605367 19:50479050-50479072 AGCGGGGCCGACTCCGGGTGAGG + Exonic
1168294054 19:55370234-55370256 AGAGGGACCCACGGCGGGGGTGG - Intronic
925142847 2:1561860-1561882 TGCGGGGCCCACAGAAGCGGCGG - Intergenic
925154108 2:1637207-1637229 AGGGGGGTCCACTGGGGAGGGGG - Intronic
925609789 2:5693142-5693164 AGCGCGGCCGGCGGCGGCGGCGG + Exonic
927130043 2:20051344-20051366 AGCGGGGCCTGGTGCGGAGGGGG - Intronic
930011515 2:46941390-46941412 AGCGGGGGCCCGGGCGGCGGAGG - Exonic
930046232 2:47175770-47175792 AGCGGGGCCGAGCGGGGCGGCGG + Intronic
933214995 2:79619447-79619469 AGCAGGGCCCACTGCAGCCAAGG - Intronic
936104697 2:109614324-109614346 GGCGCGGCCCAGTGAGGCGGTGG + Exonic
940830033 2:158456920-158456942 AGCGGGGCGGGCGGCGGCGGCGG + Intergenic
943571512 2:189580779-189580801 GGCCCGGCCCACGGCGGCGGCGG - Exonic
945130985 2:206571766-206571788 AACGGGGCTCACTGCAGCGACGG + Exonic
946400769 2:219467265-219467287 GGCGGGGCCCACTGACGTGGAGG + Exonic
946861546 2:224004269-224004291 AGTGGGGCCCTCTGTGTCGGGGG - Intronic
947793571 2:232880880-232880902 GGCTGGGCCCACTGCGAAGGAGG + Intronic
948046911 2:234952065-234952087 CGCGGGACTCACGGCGGCGGCGG - Intronic
948427513 2:237897036-237897058 AGAGGGACCCACTGAGGCTGGGG - Intronic
1170904298 20:20498570-20498592 AGCCGGGCCCACTGAGGAGCAGG - Intronic
1171425588 20:25046700-25046722 AGCTGGGCCCACCGTGGCGAGGG + Intronic
1175847027 20:62064842-62064864 CGCGGGGCCCCCGGCGGCCGGGG + Exonic
1175984925 20:62759931-62759953 AGCCGGGGCCACAGCGGCTGAGG - Intronic
1175997116 20:62816924-62816946 AGCCGGGCCCACCTGGGCGGGGG - Intronic
1178351114 21:31873565-31873587 GGCTGGGCCCAGGGCGGCGGCGG + Exonic
1180221942 21:46364761-46364783 AGCGGGGCCCTGTGCGGCCCTGG - Intronic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1181051020 22:20238309-20238331 GGGGCGGGCCACTGCGGCGGCGG - Intergenic
1183188953 22:36309204-36309226 AGCTCGGCCCACTGTGGAGGTGG + Intronic
1183381879 22:37494271-37494293 AGCGGGCCCCACTGCCACTGTGG + Intronic
1184034057 22:41910259-41910281 GGCGGGGCCCGCTGGGGCGAGGG + Intronic
1184617157 22:45645915-45645937 AGGGGGGCGCATTGCGGAGGCGG - Intergenic
1185055260 22:48575857-48575879 AGCCTGGCCCGCCGCGGCGGCGG + Intronic
1185299907 22:50074171-50074193 AGTGTGGCCCAGAGCGGCGGCGG + Intronic
949987520 3:9552690-9552712 GGCGGGGCCGGCGGCGGCGGCGG + Exonic
953485013 3:43286739-43286761 AGCGGAGGCTACTGAGGCGGCGG - Intronic
954317620 3:49809869-49809891 TGCCGGGCCCACTGTGGAGGAGG + Exonic
954699708 3:52444931-52444953 GGCGGGGCACACTGGGGCCGGGG + Exonic
955673796 3:61429166-61429188 AGCGGTGCCCACTCCGGAAGTGG + Intergenic
955911577 3:63863966-63863988 CGCGGGTCCCGCGGCGGCGGCGG - Intergenic
956659156 3:71582379-71582401 AGTGGGGACCACGGCGGTGGCGG - Intronic
956716833 3:72086913-72086935 AGCGGTGCCCAGGGCGCCGGCGG + Intergenic
961446288 3:126983210-126983232 GGCGGGGCGGACGGCGGCGGCGG + Intergenic
961637312 3:128341665-128341687 ACCAGGGCCCACTGCTGCCGAGG - Exonic
963870724 3:150410546-150410568 GGCGGGGCTCGCTGCGGCGCCGG - Exonic
963904468 3:150762690-150762712 CGCGGTGCCCGCCGCGGCGGCGG - Exonic
965648413 3:170908599-170908621 AGCGGCGCCGGCAGCGGCGGTGG + Exonic
966182196 3:177197554-177197576 CGCGAGGCCCGCGGCGGCGGCGG + Intergenic
966849403 3:184155445-184155467 AGCGGCGGCCGCGGCGGCGGCGG + Exonic
966981112 3:185136572-185136594 AGCTGGGCCCACAGTGGTGGCGG + Intronic
967232617 3:187354734-187354756 AGCTGGATCCACTGCTGCGGAGG - Intergenic
968081019 3:195847182-195847204 AGCGAGGCCCAGGGCGGGGGAGG - Intergenic
969682235 4:8649764-8649786 AGCGGGGCCCCCGGCCCCGGGGG - Intergenic
970194635 4:13542438-13542460 AGCGGGGCCGGCGGCGGGGGCGG - Exonic
971281646 4:25246704-25246726 ACAGGAGCCCACGGCGGCGGGGG + Intronic
971377073 4:26064049-26064071 ACCGGAGCCCACGGAGGCGGGGG + Intergenic
975342574 4:73258569-73258591 GGCGGGCCCCCCCGCGGCGGCGG - Exonic
976184252 4:82429569-82429591 AGCGGGGCTAGCTGCCGCGGCGG + Exonic
980115244 4:128672899-128672921 ACAGGAGCCCACTGTGGCGGGGG - Intergenic
982042364 4:151409027-151409049 GGCGGGGCCGGCGGCGGCGGGGG + Intergenic
985758407 5:1732723-1732745 GGCGGGGCCCACTGTGGAGCTGG + Intergenic
986330518 5:6713649-6713671 CGCGGGGGCCGCGGCGGCGGCGG - Intergenic
987087975 5:14487499-14487521 AGCGGGGGCGGCGGCGGCGGCGG + Exonic
998130390 5:139648731-139648753 AGCGGAGCGCACCGCGGCGGTGG + Exonic
999062871 5:148654346-148654368 AGCGGGGACCACCGGGGCTGGGG - Intronic
1002315328 5:178339688-178339710 AGTGAGGCCCACTGAGGCGCTGG - Intronic
1005959279 6:30684605-30684627 AGGTGTGTCCACTGCGGCGGGGG + Exonic
1006368140 6:33628054-33628076 AGCTTGGCCCACTGGGGCGGTGG + Intronic
1006472656 6:34237328-34237350 CCCGGGGCCCGCGGCGGCGGCGG + Intronic
1007739533 6:44002345-44002367 GGCGGGGCCTCCTGCGGCGCGGG - Intronic
1013170611 6:107634276-107634298 AGCGGGGCGCCCGGAGGCGGCGG - Exonic
1017842333 6:158232161-158232183 AGCCGGGCCGGCGGCGGCGGCGG + Intergenic
1017992907 6:159506018-159506040 GGCTGGGCCCACTGCTGTGGGGG - Intergenic
1018400215 6:163414303-163414325 TGCGGGGCCGACGGCCGCGGGGG - Intronic
1028922405 7:96322273-96322295 AGCGGCGGCCTCTGCGGCGTGGG + Intergenic
1029453669 7:100656329-100656351 AGCGGGGGCGTCTACGGCGGAGG - Exonic
1034658559 7:152748994-152749016 AGAGGGGGCCACTGTGGCAGTGG - Intergenic
1037807457 8:22066605-22066627 AGCCGGGCCCCTTGCGGCTGAGG - Intronic
1039996746 8:42541301-42541323 GGCGGGGCTCGCGGCGGCGGCGG - Intronic
1049109849 8:140635780-140635802 GGCGGGGTCCGCGGCGGCGGCGG + Intergenic
1049388456 8:142355911-142355933 AGTGGGGCCCACTGGGTCGATGG - Intronic
1049788578 8:144462777-144462799 GGCCGGGCCCACTGAGGCGGCGG - Intronic
1053697401 9:40650740-40650762 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054308706 9:63450186-63450208 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054407370 9:64773879-64773901 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1056102439 9:83312748-83312770 GGCGGGGCGCAGGGCGGCGGAGG - Intronic
1060347260 9:122828135-122828157 AGCGGGGGACACAGCAGCGGCGG + Intronic
1062526880 9:136981451-136981473 AGCGGGGCTCAGTGGGGCTGGGG + Intronic
1202779769 9_KI270717v1_random:24098-24120 GGCGGGGGCCACGGCGGCGGGGG + Intergenic
1187419630 X:19122770-19122792 TGCGGGGCCCCCGGCTGCGGTGG - Intergenic
1190369363 X:49726722-49726744 AGCGGGGCCCACTGAGGACCTGG + Intergenic
1192925009 X:75747109-75747131 AGCGGCGGCTGCTGCGGCGGCGG - Intergenic
1197870442 X:131058448-131058470 AGTGGGGCCCACCGAGTCGGGGG + Intronic
1198286176 X:135194370-135194392 AGCAGGGCCCACAGCAGCAGGGG - Intergenic