ID: 1144123258

View in Genome Browser
Species Human (GRCh38)
Location 17:12177536-12177558
Sequence TGTAATCCTAGCACTTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144123258_1144123264 27 Left 1144123258 17:12177536-12177558 CCTTCCAAAGTGCTAGGATTACA No data
Right 1144123264 17:12177586-12177608 CTGTTTCTTAAGCCAGATGGTGG No data
1144123258_1144123265 30 Left 1144123258 17:12177536-12177558 CCTTCCAAAGTGCTAGGATTACA No data
Right 1144123265 17:12177589-12177611 TTTCTTAAGCCAGATGGTGGTGG No data
1144123258_1144123263 24 Left 1144123258 17:12177536-12177558 CCTTCCAAAGTGCTAGGATTACA No data
Right 1144123263 17:12177583-12177605 AGTCTGTTTCTTAAGCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144123258 Original CRISPR TGTAATCCTAGCACTTTGGA AGG (reversed) Intergenic