ID: 1144123261

View in Genome Browser
Species Human (GRCh38)
Location 17:12177570-12177592
Sequence GAAACAGACTTAGTCAGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144123261_1144123266 -3 Left 1144123261 17:12177570-12177592 CCGTGCCTGACTAAGTCTGTTTC No data
Right 1144123266 17:12177590-12177612 TTCTTAAGCCAGATGGTGGTGGG No data
1144123261_1144123263 -10 Left 1144123261 17:12177570-12177592 CCGTGCCTGACTAAGTCTGTTTC No data
Right 1144123263 17:12177583-12177605 AGTCTGTTTCTTAAGCCAGATGG No data
1144123261_1144123265 -4 Left 1144123261 17:12177570-12177592 CCGTGCCTGACTAAGTCTGTTTC No data
Right 1144123265 17:12177589-12177611 TTTCTTAAGCCAGATGGTGGTGG No data
1144123261_1144123264 -7 Left 1144123261 17:12177570-12177592 CCGTGCCTGACTAAGTCTGTTTC No data
Right 1144123264 17:12177586-12177608 CTGTTTCTTAAGCCAGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144123261 Original CRISPR GAAACAGACTTAGTCAGGCA CGG (reversed) Intergenic