ID: 1144123262 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:12177575-12177597 |
| Sequence | CTTAAGAAACAGACTTAGTC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1144123262_1144123265 | -9 | Left | 1144123262 | 17:12177575-12177597 | CCTGACTAAGTCTGTTTCTTAAG | No data | ||
| Right | 1144123265 | 17:12177589-12177611 | TTTCTTAAGCCAGATGGTGGTGG | No data | ||||
| 1144123262_1144123266 | -8 | Left | 1144123262 | 17:12177575-12177597 | CCTGACTAAGTCTGTTTCTTAAG | No data | ||
| Right | 1144123266 | 17:12177590-12177612 | TTCTTAAGCCAGATGGTGGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1144123262 | Original CRISPR | CTTAAGAAACAGACTTAGTC AGG (reversed) | Intergenic | ||