ID: 1144123264

View in Genome Browser
Species Human (GRCh38)
Location 17:12177586-12177608
Sequence CTGTTTCTTAAGCCAGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144123261_1144123264 -7 Left 1144123261 17:12177570-12177592 CCGTGCCTGACTAAGTCTGTTTC No data
Right 1144123264 17:12177586-12177608 CTGTTTCTTAAGCCAGATGGTGG No data
1144123258_1144123264 27 Left 1144123258 17:12177536-12177558 CCTTCCAAAGTGCTAGGATTACA No data
Right 1144123264 17:12177586-12177608 CTGTTTCTTAAGCCAGATGGTGG No data
1144123260_1144123264 -4 Left 1144123260 17:12177567-12177589 CCACCGTGCCTGACTAAGTCTGT No data
Right 1144123264 17:12177586-12177608 CTGTTTCTTAAGCCAGATGGTGG No data
1144123259_1144123264 23 Left 1144123259 17:12177540-12177562 CCAAAGTGCTAGGATTACAGATG No data
Right 1144123264 17:12177586-12177608 CTGTTTCTTAAGCCAGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144123264 Original CRISPR CTGTTTCTTAAGCCAGATGG TGG Intergenic