ID: 1144123266

View in Genome Browser
Species Human (GRCh38)
Location 17:12177590-12177612
Sequence TTCTTAAGCCAGATGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144123261_1144123266 -3 Left 1144123261 17:12177570-12177592 CCGTGCCTGACTAAGTCTGTTTC No data
Right 1144123266 17:12177590-12177612 TTCTTAAGCCAGATGGTGGTGGG No data
1144123262_1144123266 -8 Left 1144123262 17:12177575-12177597 CCTGACTAAGTCTGTTTCTTAAG No data
Right 1144123266 17:12177590-12177612 TTCTTAAGCCAGATGGTGGTGGG No data
1144123259_1144123266 27 Left 1144123259 17:12177540-12177562 CCAAAGTGCTAGGATTACAGATG No data
Right 1144123266 17:12177590-12177612 TTCTTAAGCCAGATGGTGGTGGG No data
1144123260_1144123266 0 Left 1144123260 17:12177567-12177589 CCACCGTGCCTGACTAAGTCTGT No data
Right 1144123266 17:12177590-12177612 TTCTTAAGCCAGATGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144123266 Original CRISPR TTCTTAAGCCAGATGGTGGT GGG Intergenic