ID: 1144124440

View in Genome Browser
Species Human (GRCh38)
Location 17:12189546-12189568
Sequence GAGGAGTGCTGTTCCTCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144124433_1144124440 27 Left 1144124433 17:12189496-12189518 CCAGTTTTTGCTTCCAAGATGGC No data
Right 1144124440 17:12189546-12189568 GAGGAGTGCTGTTCCTCACATGG No data
1144124434_1144124440 14 Left 1144124434 17:12189509-12189531 CCAAGATGGCACATTGAACACTG No data
Right 1144124440 17:12189546-12189568 GAGGAGTGCTGTTCCTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144124440 Original CRISPR GAGGAGTGCTGTTCCTCACA TGG Intergenic
No off target data available for this crispr