ID: 1144125037

View in Genome Browser
Species Human (GRCh38)
Location 17:12195383-12195405
Sequence ACACCTACACACACATACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144125037_1144125038 12 Left 1144125037 17:12195383-12195405 CCTAGGTATGTGTGTGTAGGTGT No data
Right 1144125038 17:12195418-12195440 ATGTGTATGAGTTTATGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144125037 Original CRISPR ACACCTACACACACATACCT AGG (reversed) Intergenic
No off target data available for this crispr