ID: 1144126241

View in Genome Browser
Species Human (GRCh38)
Location 17:12205570-12205592
Sequence AAGCCTTCTCACATCATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144126241_1144126244 4 Left 1144126241 17:12205570-12205592 CCTGGGATGATGTGAGAAGGCTT No data
Right 1144126244 17:12205597-12205619 GAAAATGCATGATTTGAACTGGG No data
1144126241_1144126246 14 Left 1144126241 17:12205570-12205592 CCTGGGATGATGTGAGAAGGCTT No data
Right 1144126246 17:12205607-12205629 GATTTGAACTGGGCCTTAAAGGG No data
1144126241_1144126247 17 Left 1144126241 17:12205570-12205592 CCTGGGATGATGTGAGAAGGCTT No data
Right 1144126247 17:12205610-12205632 TTGAACTGGGCCTTAAAGGGTGG No data
1144126241_1144126243 3 Left 1144126241 17:12205570-12205592 CCTGGGATGATGTGAGAAGGCTT No data
Right 1144126243 17:12205596-12205618 GGAAAATGCATGATTTGAACTGG No data
1144126241_1144126245 13 Left 1144126241 17:12205570-12205592 CCTGGGATGATGTGAGAAGGCTT No data
Right 1144126245 17:12205606-12205628 TGATTTGAACTGGGCCTTAAAGG No data
1144126241_1144126249 26 Left 1144126241 17:12205570-12205592 CCTGGGATGATGTGAGAAGGCTT No data
Right 1144126249 17:12205619-12205641 GCCTTAAAGGGTGGCTTGGTAGG No data
1144126241_1144126248 22 Left 1144126241 17:12205570-12205592 CCTGGGATGATGTGAGAAGGCTT No data
Right 1144126248 17:12205615-12205637 CTGGGCCTTAAAGGGTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144126241 Original CRISPR AAGCCTTCTCACATCATCCC AGG (reversed) Intergenic
No off target data available for this crispr