ID: 1144130488

View in Genome Browser
Species Human (GRCh38)
Location 17:12242114-12242136
Sequence CACCCAGATTTCTTTACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144130486_1144130488 11 Left 1144130486 17:12242080-12242102 CCACAGAGAAAATCAGTGGTGAA No data
Right 1144130488 17:12242114-12242136 CACCCAGATTTCTTTACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144130488 Original CRISPR CACCCAGATTTCTTTACTCC TGG Intergenic
No off target data available for this crispr