ID: 1144132012 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:12255181-12255203 |
Sequence | GGACTCCCAGGAAAAGAGGT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1144132004_1144132012 | 20 | Left | 1144132004 | 17:12255138-12255160 | CCTTTTGTTTCTAAAACAGCCTC | No data | ||
Right | 1144132012 | 17:12255181-12255203 | GGACTCCCAGGAAAAGAGGTTGG | No data | ||||
1144132005_1144132012 | 1 | Left | 1144132005 | 17:12255157-12255179 | CCTCGCTTAAGTTCTCCCACTGG | No data | ||
Right | 1144132012 | 17:12255181-12255203 | GGACTCCCAGGAAAAGAGGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1144132012 | Original CRISPR | GGACTCCCAGGAAAAGAGGT TGG | Intergenic | ||