ID: 1144132012

View in Genome Browser
Species Human (GRCh38)
Location 17:12255181-12255203
Sequence GGACTCCCAGGAAAAGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144132004_1144132012 20 Left 1144132004 17:12255138-12255160 CCTTTTGTTTCTAAAACAGCCTC No data
Right 1144132012 17:12255181-12255203 GGACTCCCAGGAAAAGAGGTTGG No data
1144132005_1144132012 1 Left 1144132005 17:12255157-12255179 CCTCGCTTAAGTTCTCCCACTGG No data
Right 1144132012 17:12255181-12255203 GGACTCCCAGGAAAAGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144132012 Original CRISPR GGACTCCCAGGAAAAGAGGT TGG Intergenic