ID: 1144132278

View in Genome Browser
Species Human (GRCh38)
Location 17:12258142-12258164
Sequence CCTCCAAAGTTTGATCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144132278_1144132282 -8 Left 1144132278 17:12258142-12258164 CCAAGGTGATCAAACTTTGGAGG No data
Right 1144132282 17:12258157-12258179 TTTGGAGGACAGATGGGCCACGG No data
1144132278_1144132287 17 Left 1144132278 17:12258142-12258164 CCAAGGTGATCAAACTTTGGAGG No data
Right 1144132287 17:12258182-12258204 GGAGGCGAGCAAATGTTTGTTGG No data
1144132278_1144132283 -7 Left 1144132278 17:12258142-12258164 CCAAGGTGATCAAACTTTGGAGG No data
Right 1144132283 17:12258158-12258180 TTGGAGGACAGATGGGCCACGGG No data
1144132278_1144132285 -1 Left 1144132278 17:12258142-12258164 CCAAGGTGATCAAACTTTGGAGG No data
Right 1144132285 17:12258164-12258186 GACAGATGGGCCACGGGAGGAGG No data
1144132278_1144132284 -4 Left 1144132278 17:12258142-12258164 CCAAGGTGATCAAACTTTGGAGG No data
Right 1144132284 17:12258161-12258183 GAGGACAGATGGGCCACGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144132278 Original CRISPR CCTCCAAAGTTTGATCACCT TGG (reversed) Intergenic
No off target data available for this crispr