ID: 1144132279

View in Genome Browser
Species Human (GRCh38)
Location 17:12258142-12258164
Sequence CCAAGGTGATCAAACTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144132271_1144132279 30 Left 1144132271 17:12258089-12258111 CCAGCTGTGAAACTGGGACTCAA No data
Right 1144132279 17:12258142-12258164 CCAAGGTGATCAAACTTTGGAGG No data
1144132274_1144132279 -8 Left 1144132274 17:12258127-12258149 CCAGCCTTGGTTTTCCCAAGGTG No data
Right 1144132279 17:12258142-12258164 CCAAGGTGATCAAACTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144132279 Original CRISPR CCAAGGTGATCAAACTTTGG AGG Intergenic
No off target data available for this crispr