ID: 1144132280

View in Genome Browser
Species Human (GRCh38)
Location 17:12258150-12258172
Sequence ATCAAACTTTGGAGGACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144132275_1144132280 -4 Left 1144132275 17:12258131-12258153 CCTTGGTTTTCCCAAGGTGATCA No data
Right 1144132280 17:12258150-12258172 ATCAAACTTTGGAGGACAGATGG No data
1144132274_1144132280 0 Left 1144132274 17:12258127-12258149 CCAGCCTTGGTTTTCCCAAGGTG No data
Right 1144132280 17:12258150-12258172 ATCAAACTTTGGAGGACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144132280 Original CRISPR ATCAAACTTTGGAGGACAGA TGG Intergenic
No off target data available for this crispr